ID: 1140417624

View in Genome Browser
Species Human (GRCh38)
Location 16:74787412-74787434
Sequence GAGTGGGAACAGGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140417624_1140417638 12 Left 1140417624 16:74787412-74787434 CCTTCTTCCCCCTGTTCCCACTC No data
Right 1140417638 16:74787447-74787469 CACATGGAAGAGAGCAATCGAGG No data
1140417624_1140417631 -4 Left 1140417624 16:74787412-74787434 CCTTCTTCCCCCTGTTCCCACTC No data
Right 1140417631 16:74787431-74787453 ACTCCCACCCCCAGATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140417624 Original CRISPR GAGTGGGAACAGGGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr