ID: 1140423617

View in Genome Browser
Species Human (GRCh38)
Location 16:74842020-74842042
Sequence AAGAGAACACAGATGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140423607_1140423617 21 Left 1140423607 16:74841976-74841998 CCTGAGATTTGCTTCAAACCAAT No data
Right 1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG No data
1140423616_1140423617 -2 Left 1140423616 16:74841999-74842021 CCTGTGGCAAGGTGGGAGGGGAA No data
Right 1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG No data
1140423612_1140423617 3 Left 1140423612 16:74841994-74842016 CCAATCCTGTGGCAAGGTGGGAG No data
Right 1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140423617 Original CRISPR AAGAGAACACAGATGAAACA AGG Intergenic
No off target data available for this crispr