ID: 1140429864

View in Genome Browser
Species Human (GRCh38)
Location 16:74893214-74893236
Sequence ACAGAGAGACTATCCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 1, 2: 6, 3: 46, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140429864 Original CRISPR ACAGAGAGACTATCCTGGGT GGG Intronic
901843887 1:11970477-11970499 AAAGGGAGATTATCCTGGGGGGG - Intronic
905072868 1:35242819-35242841 AAAGGAAGATTATCCTGGGTAGG + Intergenic
905107393 1:35572674-35572696 AGAGAGAGACTTGCCTGGGATGG - Intergenic
905319323 1:37104746-37104768 AGAGGGAGACAATCCTGGCTTGG + Intergenic
906092738 1:43196379-43196401 AAAGAGATGCTATGCTGGGTAGG - Intronic
909022312 1:70445584-70445606 ACAGACTGGTTATCCTGGGTTGG + Intergenic
909723972 1:78811479-78811501 TAAGGGAGATTATCCTGGGTAGG + Intergenic
909786594 1:79621558-79621580 AAAGAGAGAGAATGCTGGGTAGG + Intergenic
910268390 1:85365902-85365924 AAAGGGAGATTACCCTGGGTGGG + Intronic
910752968 1:90654344-90654366 AAAGGGAAATTATCCTGGGTGGG - Intergenic
911459234 1:98168741-98168763 AAAGGGAGATTATCCTGGATGGG + Intergenic
912501598 1:110126328-110126350 TTAGGGAGATTATCCTGGGTGGG + Intergenic
915446359 1:155976978-155977000 ACAGAGGTTCCATCCTGGGTTGG - Intronic
918344609 1:183595749-183595771 AAAGGGAGAATATTCTGGGTGGG - Intronic
922083711 1:222324861-222324883 AAAGGGAGATTATCCTAGGTGGG - Intergenic
923496395 1:234529285-234529307 AAAGAGAGATTATCCTGGGTGGG + Intergenic
924736668 1:246763277-246763299 ACCCAGAGACTATGCTGGGTCGG + Intronic
1063733522 10:8725522-8725544 AAAGGGAAACGATCCTGGGTGGG - Intergenic
1066018912 10:31276954-31276976 AAAGAGAGATTATCCTGGTTGGG + Intergenic
1067558437 10:47288013-47288035 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1068799126 10:61119770-61119792 AAAGGGAGACTATTCTGGGTGGG - Intergenic
1069606627 10:69742982-69743004 AAAGAGAGACTAACTGGGGTTGG + Intergenic
1070274541 10:74992923-74992945 AGAGAGTGACTATCGTGGATTGG + Intronic
1071083281 10:81838501-81838523 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1072723298 10:97794198-97794220 AAAGTGAGATGATCCTGGGTAGG - Intergenic
1074276382 10:112006278-112006300 AGAGAGAGAGGATCCTGGGCTGG - Intergenic
1074599784 10:114901767-114901789 ATGGGGAGATTATCCTGGGTGGG - Intergenic
1074911310 10:117911876-117911898 AAAGAGAGATTATCCTGGGTGGG - Intergenic
1075538252 10:123289642-123289664 AAAGGGAGATTATCCTAGGTGGG - Intergenic
1076294249 10:129372368-129372390 ACAGAGAGACTCTGCTTGCTGGG - Intergenic
1076301282 10:129428676-129428698 TCAGAGAGTCTCTTCTGGGTGGG - Intergenic
1076759322 10:132593132-132593154 AAAGGGAGATAATCCTGGGTGGG - Intronic
1078553695 11:12300427-12300449 AAAGAGAGATTGTCCTGGGTGGG + Intronic
1080833858 11:35921552-35921574 AAAGGGAGATTATCCTGAGTAGG - Intergenic
1081039160 11:38189406-38189428 TAAGAGAGATTATCCTGGGTGGG - Intergenic
1081352672 11:42073521-42073543 AAATAGAGATTATCTTGGGTTGG - Intergenic
1083644584 11:64165160-64165182 ACAGAGTGACCTTCCTGGGCTGG - Intronic
1085183628 11:74557136-74557158 CAAGAGAGATTATCTTGGGTGGG + Intronic
1085536728 11:77225481-77225503 AGAGAGAGACTATCTTGATTAGG - Intronic
1085798328 11:79564272-79564294 ACAGAGAGAATATTCAAGGTGGG + Intergenic
1086072532 11:82814907-82814929 GCAGAGGGACTATCCAGGGAAGG - Intergenic
1087127279 11:94640484-94640506 AAAGGGAGATAATCCTGGGTGGG + Intergenic
1088086627 11:105988353-105988375 AAAGGGAGATTATCCTAGGTGGG + Intergenic
1088712600 11:112522025-112522047 AAAAAGAGATTATCCTGGATTGG + Intergenic
1089537145 11:119168059-119168081 ACAGAGAGGCTCTCCAGGGCAGG - Intronic
1090986602 11:131772397-131772419 AAAAGGAGATTATCCTGGGTGGG + Intronic
1091743908 12:2978747-2978769 GAAGAGAGACTATCAGGGGTTGG - Intronic
1092508589 12:9128674-9128696 TCAGAGGGAGGATCCTGGGTAGG + Intergenic
1093169287 12:15841366-15841388 ATAGAGAGACTGTCCTGTGCTGG + Intronic
1093821169 12:23619580-23619602 ACAAAGAGACAAACCTGGGAAGG + Intronic
1095487488 12:42700007-42700029 AAAGGGAGAATATCCTGAGTGGG - Intergenic
1097689549 12:62721597-62721619 ACAGAGAGGTTCTCCTGGGAAGG + Intronic
1100049673 12:90432474-90432496 ACAGAGAGAATATGCTGGACTGG - Intergenic
1101709024 12:107247822-107247844 AAAGGGAGATGATCCTGGGTGGG + Intergenic
1104454503 12:128899949-128899971 ACAGAGGTAGTTTCCTGGGTTGG + Intronic
1106803177 13:33277842-33277864 ACAAAGATTCTATCTTGGGTAGG - Intronic
1108284212 13:48890017-48890039 AAAGGGAAACTAACCTGGGTGGG + Intergenic
1110733248 13:78905450-78905472 ACAGGGAGATTATCCTGGGTGGG + Intergenic
1113916097 13:113874975-113874997 GCAGAGAGAGTTTCCTGGGAAGG + Intergenic
1115661064 14:35494666-35494688 ACAGAGAGACTCTTCTGTTTGGG + Intergenic
1115699135 14:35932290-35932312 ATTGAAAGATTATCCTGGGTGGG + Intronic
1116448252 14:45037288-45037310 AAAGGGAGATTATCCTGGGGAGG - Intronic
1118393472 14:65316031-65316053 AAAGGGAGATTATCCTGGGCAGG + Intergenic
1119433499 14:74583479-74583501 ACAGAGAGACTAGGCTGGCCTGG + Intronic
1119620381 14:76127256-76127278 ACAGGAAGGCTCTCCTGGGTGGG + Intergenic
1120540893 14:85749042-85749064 AAAGAGAGATTATTCTGGGTGGG + Intergenic
1120946243 14:90000238-90000260 AAAGGGAAACAATCCTGGGTGGG - Intronic
1122236297 14:100332411-100332433 ACAGAGAGACTGAGCTGGGTTGG + Intergenic
1122629358 14:103100231-103100253 ACAGACAGACACTCCTGGGCCGG + Exonic
1124660817 15:31549557-31549579 AAAGGGAGATTATCCTGGGTTGG + Intronic
1126564038 15:50076195-50076217 ACACAGAAACCATCCTGGGCTGG + Intronic
1126781674 15:52144308-52144330 ACAGAAAGAATATATTGGGTAGG - Intronic
1128715452 15:69904518-69904540 ACAGAGACACTATCCCTGGCAGG - Intergenic
1130134867 15:81174113-81174135 ACAGAGAGAGCAACCTGAGTAGG + Intronic
1132206031 15:99986860-99986882 AAAGAGCTACTATCCCGGGTGGG + Intronic
1132837630 16:1962353-1962375 ACAGAGAGGCCATTCTGGGCGGG + Intronic
1137389942 16:48072861-48072883 AGAGGGAGACCATCCTGGGGTGG + Intergenic
1138198665 16:55073122-55073144 AAAGGGAGATTATCCTGAGTGGG + Intergenic
1138217522 16:55217601-55217623 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1138499132 16:57427870-57427892 AAAGGGAGATTATCCTGAGTAGG - Intergenic
1139482806 16:67240053-67240075 ACAGACACACTCTCCCGGGTGGG - Intronic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1141137341 16:81474796-81474818 GCACAGAGACTGTCCTGGGCTGG - Intronic
1141901963 16:86996814-86996836 GCATGGAGACTCTCCTGGGTGGG + Intergenic
1143824187 17:9590846-9590868 CCACAGAGACTATCCAGGGATGG - Intronic
1144626398 17:16846360-16846382 ACCGAGAGCCTATCCTGCCTTGG + Intergenic
1144880036 17:18426360-18426382 ACCGAGAGCCTATCCTGCCTTGG - Intergenic
1145152197 17:20518024-20518046 ACCGAGAGCCTATCCTGCCTTGG + Intergenic
1147580542 17:41625059-41625081 ACCGAGAGCCTATCCTGCCTTGG + Intergenic
1151266834 17:72963027-72963049 AAAGGGAGATTATCCTGGGTGGG - Intronic
1155336337 18:24769056-24769078 ACTAAAAGATTATCCTGGGTTGG - Intergenic
1156619784 18:38835877-38835899 ACAGAAAGATTAACCAGGGTTGG - Intergenic
1157784230 18:50467761-50467783 AAAGGGAGAGTATCCTGGGTGGG - Intergenic
1159406228 18:68006380-68006402 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1159892059 18:73962241-73962263 AAAGAGAGATTATCCTGGGAGGG - Intergenic
1165997713 19:39856367-39856389 ACAGGGAGATTATCCTGGATTGG - Intergenic
1166395787 19:42439809-42439831 ACTGAGAAACTATCCCAGGTTGG + Intronic
1167797260 19:51717573-51717595 AAAAGGAGATTATCCTGGGTGGG + Intronic
1168567400 19:57436221-57436243 TCAGACAGAAGATCCTGGGTTGG + Intronic
927982563 2:27383514-27383536 ACAGCGAGAGTCTCCTGCGTTGG + Exonic
928308065 2:30187525-30187547 ACAGAGAGGCCATTCTGGGCGGG - Intergenic
929554666 2:42918326-42918348 AGAGAGAGAGTATCCTAGGTTGG + Intergenic
929693367 2:44093035-44093057 AGAAAGAGACAGTCCTGGGTGGG - Intergenic
933120112 2:78525924-78525946 ACATAGAGACTATCCTAGATGGG - Intergenic
936017461 2:108970580-108970602 ACACAGAGAATAACCAGGGTGGG + Intronic
936102009 2:109590380-109590402 GAAGGGAGACTATCCTGGTTGGG + Intronic
937275912 2:120683982-120684004 ACAGGTAGACTATCTCGGGTGGG - Intergenic
937382615 2:121394242-121394264 AAAGGGAGATTATCCTGGATGGG + Intronic
941046473 2:160681434-160681456 ACAGAGAGAATAACCAGTGTTGG - Intergenic
943682680 2:190784817-190784839 AAAGGGAAATTATCCTGGGTGGG + Intergenic
945332978 2:208560988-208561010 AAAGGCAGATTATCCTGGGTGGG - Intronic
948609387 2:239157119-239157141 TCAGAGAGCCTATCCCCGGTGGG + Intronic
1168858504 20:1027956-1027978 ACAGAGAGACTCCCCTGGGTTGG - Intergenic
1169556991 20:6761813-6761835 AAAGACAGGTTATCCTGGGTAGG + Intergenic
1169781096 20:9311473-9311495 AAAGAGAGACACTCCTGGTTGGG - Intronic
1170540185 20:17379810-17379832 AAGGAAAGACTATCCTGGGTGGG + Intronic
1170663510 20:18364979-18365001 AAAGGGAGATTATCTTGGGTGGG - Intergenic
1173993807 20:47322702-47322724 ACAGAAATACCATCCTGGCTGGG - Intronic
1174456285 20:50650908-50650930 AAAGGGAGATTAGCCTGGGTGGG + Intronic
1178527848 21:33347605-33347627 AATGAGAGACTATTCTGGGTGGG - Intronic
1180021829 21:45133441-45133463 AAAGGGAGATTTTCCTGGGTGGG - Intronic
1181185189 22:21098332-21098354 AAAGGAAGATTATCCTGGGTGGG - Intergenic
1182064040 22:27417773-27417795 CCTGAGAGACCTTCCTGGGTGGG + Intergenic
1183298851 22:37048368-37048390 ACAGAGAGGCAACCCTAGGTGGG + Intergenic
1183882746 22:40849017-40849039 ATAGAGAGACTATCCTGCAATGG - Intronic
1184196415 22:42932159-42932181 ACAGAGAGAAGATCCTGTGCTGG - Intronic
1184560051 22:45257364-45257386 AAAGGGAGATTGTCCTGGGTGGG - Intergenic
1184591954 22:45490842-45490864 ACAGATAGATAATCCTAGGTAGG + Intergenic
1185199171 22:49491455-49491477 ACTGAGTGGCTTTCCTGGGTGGG - Intronic
953061281 3:39430291-39430313 GGAGAGAGACTATGCTGGGGAGG + Intergenic
954712449 3:52511914-52511936 ACAGAGAGACGAGGCTGGGCAGG - Intronic
955414997 3:58683937-58683959 ACAGAGAGATTATCCTCAGTGGG - Intergenic
955467956 3:59255882-59255904 CCTGAGAGAATATCATGGGTGGG + Intergenic
956148748 3:66219431-66219453 AAATGGAGATTATCCTGGGTAGG + Intronic
956384638 3:68703655-68703677 AAAGGGAGATTATCCTAGGTGGG - Intergenic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
956896908 3:73670746-73670768 ACAGAGAGAAGATCATTGGTGGG + Intergenic
960850713 3:122050900-122050922 CCAGAGAGAGTATTCTTGGTTGG + Intergenic
961343995 3:126249457-126249479 ACTGATAGACAATTCTGGGTTGG - Intergenic
963686579 3:148442566-148442588 AAAGGGAGATTATCCTGGGTTGG - Intergenic
963921570 3:150910651-150910673 AAAGGGAGATTATCCTGGGTGGG - Intronic
965168245 3:165224692-165224714 ACAGAGAGAATTCCTTGGGTGGG - Intergenic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
966026950 3:175295922-175295944 AAAGTGAGACTAGCCTGGGTTGG - Intronic
966264947 3:178028642-178028664 AAAGAGAGATTATGCTGGATGGG + Intergenic
968046491 3:195626668-195626690 CCAGACAGACTCTCCTTGGTGGG + Intergenic
968308162 3:197663373-197663395 CCAGACAGACTCTCCTTGGTGGG - Intergenic
969204475 4:5633043-5633065 AAAGGAAGACTCTCCTGGGTGGG + Intronic
970224100 4:13839204-13839226 ATAGAGAGATTATTCTGGGTTGG - Intergenic
970242223 4:14021519-14021541 AAAGAGAGGTCATCCTGGGTGGG + Intergenic
970242232 4:14021558-14021580 AAAGAGAGGTCATCCTGGGTGGG + Intergenic
970507199 4:16743525-16743547 AAAGAGAGATTTTCCTGGGCAGG + Intronic
971149361 4:24014784-24014806 AAAGAGAGGTAATCCTGGGTGGG - Intergenic
971382395 4:26110855-26110877 CCAGAGAGACTGTCCTGAGAAGG - Intergenic
971509285 4:27404170-27404192 AAACAAAGATTATCCTGGGTGGG - Intergenic
972003302 4:34066497-34066519 AAAGAGAGATTATTCTGAGTAGG - Intergenic
972869588 4:43280690-43280712 AAAGAGAGATTATCCTGTGTGGG - Intergenic
973878409 4:55243841-55243863 AGGGAGAGACTTTCCTGGCTGGG + Intergenic
973987753 4:56372089-56372111 AAAGGGAGATTATCCAGGGTTGG + Intronic
975271129 4:72434733-72434755 AAAGGGAGAGTATCCTGTGTGGG + Intronic
978171260 4:105673035-105673057 AAAGAGGGATTATCCTGGATGGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979411066 4:120380356-120380378 AAAGGGAGATTATCCTGGGTGGG - Intergenic
983839935 4:172444912-172444934 ACATCGAGAATATCCTGGCTTGG - Intronic
986180262 5:5386470-5386492 ATACAGAGATTATCCTGGGTGGG + Intergenic
987636659 5:20551514-20551536 AAAGAGACACTTTCCTGGCTTGG + Intronic
988015012 5:25544958-25544980 TCAGAGAGAAAAGCCTGGGTGGG - Intergenic
989433781 5:41386612-41386634 AAAGAGAGATTATCCTGAGTGGG + Intronic
990321408 5:54633065-54633087 AGAGAGATACTACCCTGGGCCGG - Intergenic
990491234 5:56304963-56304985 ACAGAGAGACGATCATGTGAAGG - Intergenic
993454437 5:88111217-88111239 TCAGTGAGACTATCCTGCTTGGG - Intergenic
994627655 5:102242014-102242036 ACAGAGAGAATCTCTTGGGGTGG + Intronic
996145330 5:119967819-119967841 ACAGATTGAGTATCCTAGGTGGG - Intergenic
998404782 5:141868155-141868177 AAAGAGAAACTATCCCTGGTTGG + Intronic
999265364 5:150263871-150263893 TCAGAGAGACATCCCTGGGTTGG - Intronic
1002297869 5:178241395-178241417 CCAGAGAGACTCTTCTGGGAAGG + Intronic
1002444122 5:179278705-179278727 ACAGAGAGAGGATCATGGGGAGG + Intronic
1002709505 5:181186152-181186174 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1004221734 6:13753207-13753229 TCATGGAGACTTTCCTGGGTAGG - Intergenic
1004594726 6:17088320-17088342 AAGGAGATATTATCCTGGGTGGG + Intergenic
1004883542 6:20031515-20031537 AAAGGGAGATTCTCCTGGGTGGG + Intergenic
1005361851 6:25038440-25038462 AAAGAGAGATTATCCTGGGTGGG + Intronic
1007115253 6:39338893-39338915 GCTCAGAGACCATCCTGGGTGGG - Intronic
1007245105 6:40455860-40455882 TAAGGGAGATTATCCTGGGTGGG + Intronic
1007664024 6:43503940-43503962 AGAGAGAGAAGATCCTGGGCAGG + Intronic
1008743194 6:54635443-54635465 AAAGGGAGATTATCCTAGGTGGG - Intergenic
1010402782 6:75466010-75466032 GCAGAGAGAATAACCTGGGTGGG - Intronic
1010486264 6:76418135-76418157 AAAGTGAAATTATCCTGGGTGGG + Intergenic
1011301962 6:85885088-85885110 ACTGAGAGCCTATTCTGGGCTGG + Intergenic
1011360582 6:86520027-86520049 AAAAAGAGATTATCTTGGGTAGG + Intergenic
1012007633 6:93734465-93734487 AAAGAAAGATTATCCTAGGTGGG - Intergenic
1013045650 6:106482285-106482307 AAAGGGAGATTATCCTGAGTAGG - Intergenic
1013770300 6:113620925-113620947 ACAGAGAGACAAGACAGGGTTGG - Intergenic
1014328260 6:120027141-120027163 GAAGACAGATTATCCTGGGTGGG - Intergenic
1015208820 6:130672312-130672334 AAAAAGAGATTATCCTGGGTGGG + Intergenic
1016185817 6:141196592-141196614 AAAGAGATACCATCCTGGCTGGG - Intergenic
1017652221 6:156594132-156594154 TCAAAGAGACTGTTCTGGGTGGG - Intergenic
1018255192 6:161911541-161911563 ACAGAGACATTATCCAGGGTTGG - Intronic
1018726312 6:166615776-166615798 ACAGAGCGCCCATCCTGGGGGGG - Intronic
1020197369 7:6051722-6051744 GCAGAAAGAATATCCTTGGTGGG - Intronic
1020565840 7:9794478-9794500 AAAGGGATATTATCCTGGGTGGG + Intergenic
1021785203 7:24144268-24144290 AAAAGGAGATTATCCTGGGTAGG + Intergenic
1023547039 7:41328911-41328933 ACTGAGAGACTAACTTGGGAGGG + Intergenic
1024153999 7:46601791-46601813 ACAGAGAGCATAACCTGAGTGGG + Intergenic
1024685613 7:51741738-51741760 AAAGGGAGACCATACTGGGTGGG + Intergenic
1024701864 7:51912162-51912184 ACAGAGAGACAATACGGTGTAGG - Intergenic
1025990508 7:66493416-66493438 ACAGAAACACTGTGCTGGGTCGG + Intergenic
1026868629 7:73837515-73837537 ACAGAAAGACTGCCCTGGGAAGG - Intronic
1027213170 7:76166429-76166451 ACAGAAACACTGTGCTGGGTCGG + Intergenic
1027798012 7:82718103-82718125 CCAAAGAGACTATACTGGGGTGG - Intergenic
1028054754 7:86227409-86227431 ACACAGACACCATCCTAGGTTGG - Intergenic
1031221205 7:118967994-118968016 AGGGGGAGATTATCCTGGGTGGG - Intergenic
1031979174 7:128113283-128113305 ACAGAGAGTAGACCCTGGGTGGG + Intergenic
1032969878 7:137148487-137148509 AAAGGGAGATTGTCCTGGGTGGG - Intergenic
1033351460 7:140565682-140565704 ACAGCGAGTCCATCCTGAGTAGG + Intronic
1033720301 7:144051579-144051601 ACAGAAAGCAGATCCTGGGTAGG - Intergenic
1034595127 7:152182251-152182273 TGAGAAAGACTATCCTGGATGGG + Exonic
1036370910 8:8162276-8162298 AAAGAGAGATTATTCAGGGTGGG - Intergenic
1036879984 8:12503360-12503382 AAAGAGAGATTATTCAGGGTGGG + Intergenic
1037177850 8:15967738-15967760 GCAGAGACTCTTTCCTGGGTGGG - Intergenic
1037909956 8:22738377-22738399 TCAGACAGAGGATCCTGGGTTGG + Intronic
1040784918 8:51154506-51154528 AAAGAGAGATCATCCTGAGTGGG - Intergenic
1040958478 8:53005110-53005132 AAAGAGAGATCCTCCTGGGTGGG - Intergenic
1041745984 8:61210003-61210025 AAAGAAAGATTATCATGGGTGGG + Intronic
1042388723 8:68207790-68207812 AGAGAGAGAATTTCCTGAGTTGG - Intronic
1044483788 8:92725314-92725336 ACAGAGAGAATATGTTGGGGTGG + Intergenic
1044942617 8:97358791-97358813 ACAGTCAGACTAACCTGGGTTGG - Intergenic
1046608928 8:116402966-116402988 AAAGGGAGAATATCCTGAGTGGG - Intergenic
1047909533 8:129512515-129512537 ACATAGATCCTATCCTGGTTAGG + Intergenic
1048205048 8:132408660-132408682 TCAAGGAGATTATCCTGGGTGGG + Intronic
1048603893 8:135947610-135947632 GCAGAGAGATTATCCTTGGTGGG - Intergenic
1050603045 9:7272079-7272101 CCAGAGAGAGTCTCCTGGGCAGG + Intergenic
1050761055 9:9071366-9071388 AGAGGGAAATTATCCTGGGTGGG + Intronic
1051362288 9:16291842-16291864 AAAGAAAGACTATCCTGAGTGGG - Intergenic
1055158113 9:73089638-73089660 AAAGGGAGATTATCCTAGGTAGG + Intergenic
1056218650 9:84429632-84429654 AAAGAGTGATTATCCTGGTTGGG - Intergenic
1056941579 9:90960860-90960882 ACAGGGAGACGGTCCTGGCTGGG + Intergenic
1058677591 9:107413659-107413681 AAAGGCAGATTATCCTGGGTGGG + Intergenic
1058763375 9:108158627-108158649 GCAGAGTGACTACACTGGGTGGG - Intergenic
1058852791 9:109028636-109028658 AAAAAGAGATTATGCTGGGTGGG + Intronic
1059585905 9:115606016-115606038 ATAGGGAGATTATCCTGGGTAGG + Intergenic
1059837350 9:118170708-118170730 ACAGGGAGAAAATCCTGGGAAGG - Intergenic
1061611600 9:131750209-131750231 ACAGAGAGTCCATCTTGGGGGGG + Intergenic
1186893342 X:13981860-13981882 AAAGAGAGATAATCCTGGGAGGG + Intergenic
1186996729 X:15131515-15131537 AAAGAGAGATGATCTTGGGTGGG - Intergenic
1187084076 X:16023566-16023588 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1189364497 X:40377857-40377879 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1189869339 X:45366161-45366183 AAACAGATATTATCCTGGGTGGG + Intergenic
1189968995 X:46399091-46399113 AAAGGGAGATTATCTTGGGTGGG - Intergenic
1190221848 X:48516963-48516985 ACAGTGAGGGCATCCTGGGTTGG - Intronic
1190665630 X:52693819-52693841 ACAAAGAGAATCTCCTGGGTGGG - Intronic
1190673788 X:52764591-52764613 ACAAAGAGAATCTCCTGGGTGGG + Intronic
1191663208 X:63671417-63671439 ACAGTGAGACTACCTTGGGGAGG - Intronic
1192868605 X:75163343-75163365 AAAAAGAGATTATCTTGGGTGGG - Intergenic
1193450576 X:81659783-81659805 AAAGGGAGACTATCCTGGGTAGG - Intergenic
1193530742 X:82651083-82651105 ACAGAGAGCCTAGCCTTTGTGGG - Intergenic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1194939434 X:99992046-99992068 ATGGAGAAACTATTCTGGGTGGG - Intergenic
1195525330 X:105882442-105882464 AAAGAGAGATTATCTTTGGTTGG - Intronic
1198170271 X:134098390-134098412 AGAGAGTTACTATGCTGGGTGGG + Intergenic
1198597443 X:138251988-138252010 AAAGAGAAATTATTCTGGGTGGG - Intergenic
1198843823 X:140887993-140888015 AAAGGGAGATTTTCCTGGGTGGG + Intergenic
1199545834 X:149006658-149006680 ACACAGAGATTATTCTGGGTGGG - Intergenic
1199725664 X:150578088-150578110 AAAGAGAAGTTATCCTGGGTAGG + Intronic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic