ID: 1140430741

View in Genome Browser
Species Human (GRCh38)
Location 16:74900820-74900842
Sequence AAAAATACACTACACTGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 581}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140430741 Original CRISPR AAAAATACACTACACTGGGC CGG Intronic
900003192 1:26635-26657 AATAAGACACTACACTAGCCAGG + Intergenic
900022912 1:197157-197179 AATAAGACACTACACTAGCCAGG + Intergenic
900110317 1:1002563-1002585 AAAAATACAAAACACTAGCCGGG - Intergenic
900280616 1:1865423-1865445 AAAAATACAAAACATTGGCCAGG + Intronic
900388837 1:2424689-2424711 AAAAATACACAAAATTAGGCCGG + Intergenic
900711032 1:4114220-4114242 AAAAAAAAACTTCACTGGGCAGG - Intergenic
901473400 1:9473095-9473117 GAGAACACACAACACTGGGCAGG + Intergenic
902161659 1:14535368-14535390 AGAAATACACTGGACTTGGCTGG + Intergenic
902310220 1:15576399-15576421 ACAAAAACACTAAACTTGGCCGG - Intronic
902430497 1:16359380-16359402 AAAAAAACAATAAATTGGGCCGG - Intronic
902430879 1:16362209-16362231 AATAATACAATACACCGGGCTGG + Intronic
902468803 1:16633721-16633743 TAAATAAAACTACACTGGGCTGG + Intergenic
902572799 1:17357634-17357656 TAAAATACACTAAACTAGGCTGG + Intronic
902878484 1:19355195-19355217 AAAGATTTACTACACTGGGCCGG + Intronic
902883779 1:19390509-19390531 TAATAAACACTACACTGGTCAGG + Intronic
902953952 1:19911681-19911703 AAAAATACAATTTACTGGCCGGG - Exonic
903154326 1:21433933-21433955 AAAATAAAACTACACTGGGCTGG - Intergenic
904547046 1:31283305-31283327 AAAAATTCACTAAACAGGCCGGG + Intronic
904629984 1:31833766-31833788 AAAAATACACAATCCTGGCCAGG + Intergenic
904732244 1:32602845-32602867 AAAAATACAGTAAAATTGGCTGG - Exonic
905568949 1:38988915-38988937 AAAAATAACCATCACTGGGCCGG + Intergenic
905575614 1:39042198-39042220 AGGAATACAATACACTGGCCAGG + Intergenic
905628111 1:39501941-39501963 AAAGAAACCCCACACTGGGCCGG + Intronic
905980064 1:42217232-42217254 AAAAATACTCTGCAATGGGCTGG + Intronic
906331559 1:44889374-44889396 AAAAATACAAAACACCGGCCGGG + Intronic
906350565 1:45055283-45055305 AAAAATACAAAAAACTGGCCGGG - Intronic
907859184 1:58334792-58334814 ACTAATACACTACTCTGTGCTGG - Intronic
908277377 1:62489286-62489308 AAAAATACAAAACATTGGCCGGG + Intronic
908345655 1:63229563-63229585 AAAAATTTTCTACACTTGGCCGG + Intergenic
910400132 1:86830305-86830327 AAAAATATACGTGACTGGGCTGG + Intergenic
910878652 1:91902577-91902599 AAAAATAAACTGCACTTGGCTGG - Intronic
912112100 1:106356043-106356065 AAAACAAAACTACACTGGACAGG + Intergenic
912929587 1:113945006-113945028 AAAAATACAAAACACTAGTCAGG - Intronic
913105100 1:115606847-115606869 AAAAATACAAAAAACTGGCCAGG + Intergenic
913574549 1:120158362-120158384 GAATATACACTTCACTGGACAGG + Intronic
913688425 1:121255830-121255852 AAAAACAAACTACTATGGGCTGG + Intronic
914040282 1:144043473-144043495 AAAAACAAACTACTATGGGCTGG + Intergenic
914149175 1:145024447-145024469 AAAAACAAACTACTATGGGCTGG - Intronic
914295818 1:146323174-146323196 GAATATACACTTCACTGGACAGG + Intergenic
914556857 1:148773972-148773994 GAATATACACTTCACTGGACAGG + Intergenic
914615977 1:149356258-149356280 GAATATACACTTCACTGGACAGG - Intergenic
914816481 1:151066762-151066784 AAAAATACAAAACATTGGCCGGG + Intronic
914881474 1:151550190-151550212 AAAAATACAAAACACTGGCCAGG - Intronic
915395279 1:155578804-155578826 AAAAAAAAACCACACAGGGCCGG - Intergenic
916272054 1:162953523-162953545 GAAAATCCACTACAGTTGGCTGG - Intergenic
916733963 1:167590585-167590607 AAACATACCCGAGACTGGGCAGG - Intergenic
916956963 1:169848245-169848267 AAAATTATACTGCACTGGCCTGG + Intronic
917340806 1:173975600-173975622 AAAAATACAGTAAATTTGGCCGG + Intronic
918280444 1:182999070-182999092 AGAAATACACAACACTTGGTGGG - Intergenic
919106859 1:193164065-193164087 TAAAATCTACTATACTGGGCTGG - Intronic
919373069 1:196755513-196755535 AAAAATACATGACATTGGTCTGG + Intergenic
919379514 1:196840196-196840218 AAAAATACATGACATTGGTCTGG + Intronic
919514193 1:198501437-198501459 AAAAATACATATCACTGGGCTGG + Intergenic
920475745 1:206274329-206274351 AAAAACAAACTACTATGGGCTGG + Intronic
920593213 1:207242692-207242714 AAAAATACACTAAAATTAGCTGG - Intergenic
922931677 1:229395030-229395052 AAAAATACAATAAAATAGGCTGG + Intergenic
923047999 1:230369463-230369485 AGAAACACACTGCACAGGGCTGG + Intronic
923490550 1:234479712-234479734 AAAAGTACACTCCACAGGGTGGG + Intergenic
923551538 1:234968179-234968201 AAAAATACAAAAAACTAGGCGGG + Intergenic
923834720 1:237597573-237597595 AAAAATACTCTGGACTGGCCAGG - Intronic
1063479501 10:6361793-6361815 AAAAATACCCTAAAGGGGGCAGG - Intergenic
1063699824 10:8373169-8373191 AAAAATAAAATATACTTGGCCGG - Intergenic
1064128118 10:12682057-12682079 AAAAATACAAAACATTAGGCAGG + Intronic
1064679184 10:17792246-17792268 AAAAATACACAACATTAGCCGGG - Intronic
1064933814 10:20657493-20657515 ACAAATACACTACTCTGGTTGGG - Intergenic
1065164822 10:22964735-22964757 AAAAAAACACTACGGGGGGCCGG - Intronic
1066165942 10:32788481-32788503 AAAATTACCTGACACTGGGCAGG - Intronic
1066260023 10:33720379-33720401 AAAAGTACACTCCACAGGGTGGG - Intergenic
1067025200 10:42838089-42838111 AAGAGTACAACACACTGGGCTGG - Intergenic
1067119408 10:43461301-43461323 AAAAAAACAAAAGACTGGGCCGG - Intronic
1067192714 10:44084580-44084602 AAAAATACAATGCACTTTGCTGG - Intergenic
1068551970 10:58416835-58416857 AAAAATAAATTATGCTGGGCTGG + Intergenic
1068884343 10:62083219-62083241 AAAAATACATTTCACTTTGCTGG - Intronic
1068891151 10:62149342-62149364 AAAAACACAGGACACTGGCCGGG + Intergenic
1068919789 10:62471203-62471225 AAAAATACAAAAAACTGGCCAGG + Intronic
1069429930 10:68325266-68325288 AAAAACCCACTACATTGGCCGGG + Intronic
1069482159 10:68793566-68793588 AAAAATACAAAAAACTTGGCCGG - Intergenic
1069515826 10:69076293-69076315 AAGAATACAATACATTGGTCTGG - Intergenic
1070143082 10:73753371-73753393 AAAAATAGTTTACACTTGGCTGG + Intronic
1071588654 10:86850023-86850045 AAAAATTCACTACTCAGGCCGGG + Intronic
1071604498 10:86975642-86975664 AAAAATAGAATATAATGGGCCGG - Intronic
1072329159 10:94329486-94329508 AAAAATACACCACACAGGCTGGG + Exonic
1072823824 10:98585564-98585586 GAAAATACACTACTGTAGGCCGG - Intronic
1073427796 10:103466526-103466548 TAAAATAAAATACACTAGGCTGG - Intergenic
1074220731 10:111435248-111435270 CAAAATATACTACGCTGGGTTGG - Intergenic
1074461900 10:113645948-113645970 AAAAAAACACAAAACGGGGCTGG + Intronic
1077072395 11:681569-681591 AAAAATACAAAACACTAGCCAGG - Intronic
1077243828 11:1526193-1526215 AAAAAAAAATTACACTGGCCTGG + Intergenic
1078108983 11:8376700-8376722 AAAAATACAAAAAACTGGCCAGG - Intergenic
1079154898 11:17937233-17937255 TAAAATGTACTACAATGGGCCGG + Intronic
1079398265 11:20084621-20084643 AATAACACAGGACACTGGGCTGG - Intronic
1080026680 11:27622524-27622546 AAACATACACTGTCCTGGGCAGG + Intergenic
1080537421 11:33235652-33235674 AAAAATACAAAAAACTGGCCAGG + Intergenic
1080869310 11:36223431-36223453 AGAAATACATTTCACTGGCCAGG + Intronic
1081098386 11:38969648-38969670 ACTAATGCACAACACTGGGCTGG + Intergenic
1082994773 11:59244500-59244522 AAAAATACAATAAATTGGCCAGG - Intergenic
1083858460 11:65405702-65405724 AAAAATACAGTACCCAGGCCGGG + Intronic
1086449167 11:86899221-86899243 AAAAAAATACTACCCTGGCCAGG + Intronic
1087793847 11:102434656-102434678 AAAACTACACAACATTGGTCTGG - Intronic
1088473864 11:110215199-110215221 AAAAATACAAAACATTGGCCGGG + Intronic
1089068821 11:115682753-115682775 AAGAATACAAGACACTGGGAAGG + Intergenic
1089249778 11:117149844-117149866 AAAAATACCCTAGGCTGGGCAGG + Intronic
1089490025 11:118877123-118877145 AAAAATACCCAACACTTTGCCGG + Intergenic
1089707649 11:120291967-120291989 AAAAATACAATACATTAGCCAGG - Intronic
1090344840 11:126062078-126062100 AAAAATACACTCCCTGGGGCTGG + Intronic
1091376610 12:28695-28717 AATAAGACACTACACTAGCCAGG + Intergenic
1091426618 12:396094-396116 AAAAAGTCAATACACTGGCCAGG + Intronic
1092224431 12:6738404-6738426 CAAGAGTCACTACACTGGGCCGG - Intergenic
1092339020 12:7659806-7659828 AAAAATACAAAAAACTGGCCAGG + Intronic
1092988848 12:13875228-13875250 AAAAATAAAATAAAATGGGCGGG + Intronic
1093421330 12:18977958-18977980 AAAAATACAAAAAATTGGGCGGG + Intergenic
1093554805 12:20459082-20459104 AAAGAAACACTATACTGGGAAGG - Intronic
1093809066 12:23470763-23470785 AAAAATTCACTAAACAGGCCAGG - Intergenic
1094067708 12:26378940-26378962 AAAAATTCAGTCCACAGGGCAGG - Intronic
1094672743 12:32586892-32586914 AAAAATAGAATATTCTGGGCTGG + Intronic
1095334246 12:41007353-41007375 AAAAACACACAAAACTGGCCGGG - Intronic
1095901792 12:47335235-47335257 AAAAATACATTAAACTAGGCTGG - Intergenic
1096090259 12:48894746-48894768 AAAAATACAAAAAACTAGGCGGG + Intergenic
1096252679 12:50043148-50043170 AAAAATACAAAACAATGAGCCGG - Intergenic
1096289227 12:50326797-50326819 AAAAGTACACTCCACAGTGCAGG - Intronic
1096302823 12:50446721-50446743 AAAAATACAGTCCACTAGGCCGG - Intronic
1097858301 12:64491322-64491344 AAAAATACTGTACTCTTGGCTGG + Intronic
1098263090 12:68691536-68691558 AAAAATACACTATAGTAGCCGGG + Intronic
1098488202 12:71046148-71046170 ACAAATACACAACTCTGGGCTGG + Intergenic
1098900919 12:76111119-76111141 AAAAAAAAACCTCACTGGGCAGG + Intergenic
1099418867 12:82427430-82427452 AAAAATACACTACACTGGAAAGG - Intronic
1100366385 12:93924743-93924765 AAAAAATCATTACACAGGGCTGG + Intergenic
1100824454 12:98461854-98461876 AAAAATACTCTGTACAGGGCTGG + Intergenic
1101107057 12:101451144-101451166 AAAAGTACACTCCACAGGGTGGG + Intergenic
1103066937 12:117906748-117906770 TAAAATACACATCACTGGCCGGG + Intronic
1103209421 12:119155571-119155593 AAAAATACAAAACACTAGCCAGG + Intronic
1103258888 12:119567487-119567509 AAAAATACAAAACATTGGCCGGG + Intergenic
1103559682 12:121786875-121786897 AAAAATACAAAAAACTGGCCGGG + Intronic
1103794168 12:123491843-123491865 AAAAATACACAAAAATGAGCTGG + Intronic
1109179053 13:59191170-59191192 TACAATACAATACATTGGGCCGG + Intergenic
1109665081 13:65523935-65523957 AAAAATAGACTTCACTTGGGAGG + Intergenic
1110589749 13:77242407-77242429 AAAAATACATTTAACTGGCCAGG - Intronic
1110900278 13:80813443-80813465 AAAAATAAATGACAATGGGCCGG - Intergenic
1112002489 13:95223789-95223811 AAAAATACTTTACACTGGCCAGG - Intronic
1112068142 13:95816828-95816850 AAAAAGTCACTAAACTGGGCTGG + Intronic
1112321759 13:98414352-98414374 CCAAATACACGACACTGGTCAGG + Intronic
1112394834 13:99019939-99019961 AAAAATACAAAAAACTGGCCAGG + Intronic
1112479061 13:99757194-99757216 AAAAATATATAACACTTGGCCGG - Intronic
1112701186 13:102010743-102010765 TAAAATACAGTAATCTGGGCAGG - Intronic
1112758190 13:102663440-102663462 AAAAATAAATCAAACTGGGCTGG - Intronic
1113727100 13:112613000-112613022 AAAAATACAATACATTAGCCAGG - Intergenic
1113837828 13:113340481-113340503 AAAAATACAATAAAATGGCCAGG + Intronic
1114006477 14:18319241-18319263 AAAAATACAAAAAAATGGGCTGG - Intergenic
1115533773 14:34353289-34353311 AAAAATACACTTTTCTGGGCTGG - Intronic
1115568336 14:34644401-34644423 AAAAATTCAGTAAACTGGCCAGG + Intergenic
1115624162 14:35173162-35173184 CAAAATAAACTAATCTGGGCTGG - Intronic
1115987787 14:39120388-39120410 AAAAATAAAGTACACTGTGATGG + Intronic
1116355265 14:43920622-43920644 AAAACTATAATATACTGGGCTGG + Intergenic
1116447443 14:45026845-45026867 AAAAATACAAAAAATTGGGCAGG + Intronic
1116821252 14:49629800-49629822 AAAAATATAATACACTTGGCTGG - Intronic
1117405643 14:55400605-55400627 ACAAATAAAATAAACTGGGCCGG + Intronic
1117865336 14:60142684-60142706 AAAAATACCATACACAGGCCGGG + Exonic
1118212016 14:63774171-63774193 AAAAATACAAAAAATTGGGCAGG + Intergenic
1118214136 14:63792392-63792414 AAAAATACAAAACATTAGGCTGG + Intergenic
1118304887 14:64647525-64647547 AAAAATGCACTGCAGTTGGCCGG - Intergenic
1119307837 14:73622056-73622078 AAAATTATACTACACAGGCCAGG - Intergenic
1119515517 14:75245280-75245302 AAAAACAAACTAAACTGGCCGGG + Intronic
1120751254 14:88200585-88200607 AAATAAACCCTACACTGGGAAGG + Intronic
1121745491 14:96287092-96287114 AAAAATACACAAAACTAGCCGGG + Intronic
1121951155 14:98172116-98172138 CAAAATGCTCTGCACTGGGCAGG + Intergenic
1122311014 14:100794259-100794281 AAAAATACAAAAAACTGGCCGGG + Intergenic
1122498054 14:102173271-102173293 AAAAATACAAAAAACTGGCCAGG - Intronic
1122510264 14:102260959-102260981 AAAAATACAAAACAATTGGCTGG + Intronic
1122563157 14:102631497-102631519 AAAAATAGTCTGGACTGGGCCGG - Intronic
1122994965 14:105258190-105258212 AGAAATAAACTCTACTGGGCTGG + Intronic
1124033775 15:26034662-26034684 AAAAATACAAAACACTAGCCAGG - Intergenic
1124448360 15:29760671-29760693 AAAAATACACTAGTGTTGGCCGG - Intronic
1124909145 15:33901103-33901125 AAAAATACAAAAAACTTGGCTGG + Intronic
1125633986 15:41171782-41171804 TAAAATAGAGAACACTGGGCCGG - Intergenic
1125654312 15:41343648-41343670 AAAAATACAAGAAAATGGGCCGG - Intronic
1126414153 15:48400545-48400567 AAAGATAAACTAAACTGTGCTGG - Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1128037725 15:64541264-64541286 AAAAATACAAAACATTGGCCGGG + Intronic
1128172326 15:65523868-65523890 AAAAATACAAAAAATTGGGCTGG + Intergenic
1129093100 15:73172736-73172758 AGATAAGCACTACACTGGGCAGG + Intronic
1129493158 15:75949248-75949270 AAAAATACAAAACACTAGCCAGG + Intronic
1129867397 15:78919721-78919743 AAAAATACAAAACACTAGCCAGG + Intergenic
1130193746 15:81760310-81760332 GAAAGTACACTTCACTGGGTGGG - Intergenic
1130433385 15:83872083-83872105 AACAAAACAATACACTGTGCAGG - Intronic
1130561441 15:84962596-84962618 AAAAATACAAAACATTGGCCAGG - Intergenic
1130625800 15:85513099-85513121 AAAAATAGTCAACACTGGGCCGG - Intronic
1131382867 15:91978581-91978603 AAAAATACATTCCACTGAGGGGG - Intronic
1132263995 15:100450123-100450145 AAAAATAGACTAGATTGGCCAGG + Intronic
1132450310 15:101964303-101964325 AATAAGACACTACACTAGCCAGG - Intergenic
1132489154 16:215993-216015 AAAAAAACAGTAAACCGGGCTGG - Intronic
1133067828 16:3221878-3221900 TAAAATACCCGACTCTGGGCAGG + Intergenic
1133099605 16:3471204-3471226 AAAAATCAACTTGACTGGGCCGG + Intronic
1134011176 16:10854265-10854287 AAAAATACAAAACAATGAGCCGG + Intergenic
1134083612 16:11341415-11341437 AAAAATACACAAAATTGGCCGGG + Intronic
1134327162 16:13217731-13217753 GGAAATACACTTCACTAGGCCGG + Intronic
1134440898 16:14299065-14299087 AAAAAAAGAATACACAGGGCTGG - Intergenic
1134481022 16:14619301-14619323 ATAAAAACATTAGACTGGGCTGG + Intronic
1135408401 16:22214905-22214927 AAAAGTACACTCCACAGGGTGGG + Intronic
1135704912 16:24666817-24666839 AAAAAAACACCACTCTTGGCTGG + Intergenic
1135722328 16:24828276-24828298 AAAATAACACTGCACTTGGCAGG - Intergenic
1136163046 16:28433660-28433682 AAAAATACAAAAAACTGGCCGGG + Intergenic
1136199919 16:28681328-28681350 AAAAATACAAAAAACTGGCCGGG - Intergenic
1136216267 16:28795503-28795525 AAAAATACAAAAAACTGGCCGGG - Intergenic
1138811404 16:60154813-60154835 AAAAATACAAAACAGTTGGCTGG - Intergenic
1138819442 16:60241194-60241216 AAAAATACAGGATGCTGGGCAGG - Intergenic
1139377967 16:66512483-66512505 AAAAATCTACTACAGTAGGCCGG + Intronic
1139405755 16:66716530-66716552 AAAAATACAAAAAACTGGCCAGG - Intergenic
1139677461 16:68534387-68534409 AAAAATACAAAACATTGGCCGGG - Intronic
1139806429 16:69568014-69568036 AAAAATACACTGCAGTTGGCCGG + Intronic
1140090168 16:71831570-71831592 AAAAATACAAAAAATTGGGCCGG - Intergenic
1140430741 16:74900820-74900842 AAAAATACACTACACTGGGCCGG + Intronic
1140671666 16:77285465-77285487 AAAAATACAGTAAAATGGCCGGG - Intronic
1140725291 16:77806369-77806391 AAAAATACAAAAAACTTGGCCGG - Intronic
1140725313 16:77806503-77806525 AAAAATACAAAAAACTTGGCCGG - Intronic
1142068973 16:88079084-88079106 AAAAATACAAAACAATGAGCTGG + Intronic
1142985699 17:3694363-3694385 AAAAATACACAACAATTAGCTGG - Intronic
1143177583 17:4965206-4965228 AAAAATACAAAAAAATGGGCGGG - Intronic
1145088845 17:19969182-19969204 AAAAATACAAAACAATGAGCTGG + Intronic
1145182099 17:20762106-20762128 AAAAATACATTACATAGGCCGGG - Intergenic
1145842115 17:28004033-28004055 CAAAATACAATACATGGGGCTGG - Intergenic
1147222407 17:38944405-38944427 AAAAATACAAAAAACTGGCCAGG + Intronic
1148037658 17:44680142-44680164 AAAAATACAAAACACTAGCCAGG - Intronic
1148181767 17:45610949-45610971 AAAAATACAAAAAACTGGGCTGG - Intergenic
1148717628 17:49727244-49727266 AAAAATACAAAACAATTGGCCGG + Intronic
1148817850 17:50343660-50343682 AAAAAAAAACAACAGTGGGCTGG + Intergenic
1149562084 17:57615286-57615308 AAAAATACAAAAAACTAGGCAGG - Intronic
1149697006 17:58623986-58624008 AAGAATACACTAAACAGGCCGGG + Intronic
1149734484 17:58979625-58979647 AAAAATTCAGTACACTGTGTAGG - Intronic
1149823109 17:59799664-59799686 AAAAATATGCTTCACTTGGCCGG + Intronic
1151168227 17:72223111-72223133 GAAAATACACTGGAATGGGCAGG + Intergenic
1151192741 17:72410471-72410493 AAAAATCCACAACAACGGGCTGG - Intergenic
1151644364 17:75419883-75419905 AAAAACACACTCAACTGGCCGGG - Intergenic
1152008440 17:77696469-77696491 AAGAATACACAACAAAGGGCCGG + Intergenic
1152081808 17:78192158-78192180 AAAAATACAAAACACTTAGCAGG - Intronic
1153662486 18:7337751-7337773 GAAAATATTCTACACAGGGCCGG + Intergenic
1153721688 18:7910408-7910430 AAAAATACACTCCACAGGGTGGG + Intronic
1153832168 18:8933473-8933495 AAAAATACACTCCACAGGGTGGG - Intergenic
1153847311 18:9061708-9061730 TAAAATCCAGTACACTCGGCTGG + Intergenic
1154462330 18:14605327-14605349 AAAAATACCCAAGACTGGACGGG + Intergenic
1155485099 18:26332826-26332848 ATAAAAACAATCCACTGGGCTGG - Intronic
1155842069 18:30658674-30658696 AAAAGTACACTCCACAGGGTGGG + Intergenic
1155955823 18:31956035-31956057 AAAAATACAAAAAGCTGGGCTGG - Intergenic
1155987980 18:32250950-32250972 AAAAATACAAGGCACTGGCCGGG - Intronic
1156238372 18:35227184-35227206 AAAAGTACACTCCACAGGGCAGG + Intergenic
1157808447 18:50675784-50675806 AAAAATACAAAAAAATGGGCTGG - Intronic
1157916970 18:51673920-51673942 AAAAAAACACAAAACTAGGCTGG + Intergenic
1159691873 18:71498728-71498750 TAAAATATAATACAATGGGCTGG + Intergenic
1159740928 18:72169153-72169175 AAAAATACATTACAGTGGCCTGG - Intergenic
1159832793 18:73298198-73298220 AAAAATACACTAAAGCGGCCGGG - Intergenic
1159935029 18:74358275-74358297 AAAAATACACTAAACATGGCAGG - Exonic
1160533655 18:79579628-79579650 AAAAATACAAAAAACTAGGCGGG + Intergenic
1160634943 19:68243-68265 AATAAGACACTACACTAGCCAGG + Intergenic
1160712832 19:560695-560717 AAAAATACACAAAATTAGGCGGG - Intergenic
1160862362 19:1242829-1242851 AAAAATACAGAAAACTGGCCGGG + Intronic
1161131765 19:2594209-2594231 AAAAATACAAAACACTTAGCTGG + Intronic
1161515989 19:4696936-4696958 AAAAATACAAAACATTGGCCAGG + Intronic
1162104265 19:8360740-8360762 AAAAATACATAAAACAGGGCTGG + Intronic
1162347741 19:10130279-10130301 AAAAATAAACTGCTTTGGGCCGG - Intergenic
1163064364 19:14782317-14782339 AAAAATAAACAAGGCTGGGCCGG + Intergenic
1163337566 19:16683268-16683290 AAAAATGCACTAAACTGTCCAGG - Intronic
1163364970 19:16870848-16870870 AAAAATACAAAAAATTGGGCTGG - Intronic
1163731184 19:18950220-18950242 AAAAATACAAAAAAATGGGCCGG + Intergenic
1163831646 19:19549883-19549905 AAACAAACACTACCCTAGGCAGG + Intergenic
1163960502 19:20685543-20685565 CAAAATATACTACATGGGGCTGG - Intronic
1164893380 19:31845453-31845475 AAAAATACATAACACAGGCCAGG + Intergenic
1165327811 19:35124490-35124512 AAGGATCCACAACACTGGGCGGG + Intergenic
1165379497 19:35468349-35468371 AAAAATATTCTACACAGGCCGGG + Intergenic
1165543252 19:36509901-36509923 TAAAATACACTAAAATGGCCAGG + Intergenic
1165724969 19:38106400-38106422 AAAAATTAAATACACTGGCCAGG - Intronic
1165816350 19:38644833-38644855 AAAAAAACACTGGGCTGGGCTGG + Intergenic
1165997963 19:39858593-39858615 AAAAGTACACTCCACAGGGTGGG + Intergenic
1166013606 19:39962519-39962541 AAAAATACAAAACACTAGCCGGG + Intergenic
1166134430 19:40767039-40767061 AAAAATACAATAAATTGGCCAGG + Intergenic
1167966891 19:53155231-53155253 AAAAATACTCTAAATTGGCCAGG - Intronic
1167968764 19:53172047-53172069 AAAAATACACAAATCTGGCCGGG - Intronic
1168080334 19:54005458-54005480 AAAAATAAAATAAACTGGCCGGG + Intronic
1168097852 19:54125682-54125704 AAAAAAACCCCACACAGGGCTGG - Intronic
1168630960 19:57955764-57955786 AAAAAAACATTAGCCTGGGCCGG - Intergenic
925518880 2:4718634-4718656 AAAAATACACTACGGCGGCCAGG + Intergenic
925651930 2:6100061-6100083 AAAAATACAATAAAATTGGCTGG - Intergenic
925813027 2:7719785-7719807 AAAAGTACACTCCACAGGGTGGG - Intergenic
926028941 2:9568870-9568892 AAAAAAAAACTAGCCTGGGCTGG - Intergenic
926255244 2:11188404-11188426 AAAAATATACCAGTCTGGGCTGG - Intronic
926536200 2:14116055-14116077 AAAAATACAAAAAATTGGGCCGG - Intergenic
926553630 2:14331100-14331122 AAAAATGCATGACAATGGGCAGG + Intergenic
927771769 2:25868867-25868889 AAAAATACAAAACATTGGCCAGG + Intronic
928323829 2:30304281-30304303 AAAAATACAAAAAACTAGGCGGG - Intronic
928531992 2:32201776-32201798 GAAAATACATTACACAGTGCTGG + Intronic
928550280 2:32363569-32363591 TAAAATGTACTACACTGGGGAGG - Intronic
928966269 2:36978667-36978689 TAAAAAACATTACAGTGGGCCGG + Intronic
929473727 2:42223098-42223120 AAAAATACATTATATTGGCCAGG - Intronic
929733509 2:44521437-44521459 AAAAATACAAAACATTGGCCAGG - Intronic
929776484 2:44933887-44933909 AAAAATAAACAAAACTGGGTAGG + Intergenic
930017702 2:46982211-46982233 AAAAATAAACAAAACTGGCCAGG + Intronic
930815868 2:55597324-55597346 AAAAATACAAAAAATTGGGCTGG + Intronic
930966356 2:57333628-57333650 ACAAATAAGCTACACTGGTCAGG + Intergenic
931828791 2:66029046-66029068 TAAAAGACTATACACTGGGCCGG - Intergenic
931838398 2:66124461-66124483 AAAAATTCACCATGCTGGGCGGG - Intergenic
932650407 2:73549819-73549841 AACACTACACTACAATGGGTAGG - Intronic
933352569 2:81173522-81173544 ACAAATACACTACTCTGGTGGGG - Intergenic
933786107 2:85843052-85843074 AAACATACAAAACACTAGGCTGG - Intronic
934959735 2:98660834-98660856 AAAACTACACGACATTGGCCTGG + Intronic
934968876 2:98747002-98747024 AAAAACACTATACACTGGCCGGG + Intergenic
935252149 2:101273126-101273148 AAAAACACACACCACTTGGCAGG - Intronic
936035529 2:109108064-109108086 AAAAATACAAAAAACTGGCCGGG - Intergenic
936507643 2:113120418-113120440 ATAAAAACACTACACTGGCAGGG + Intronic
936519916 2:113205261-113205283 AAAATTGCACTGCACTGGCCAGG - Intronic
936566533 2:113586784-113586806 AATAAGACACTACACTAGCCAGG - Intergenic
937417126 2:121724383-121724405 AAAAATACAAGAAACTGGGCTGG - Intergenic
937448640 2:121981065-121981087 AAAAATATAATACAATGGTCAGG - Intergenic
938237571 2:129718569-129718591 AAAACTACACAACATTGGTCTGG + Intergenic
939240584 2:139554094-139554116 AAAACTACATGACACTGGTCTGG - Intergenic
940494878 2:154414490-154414512 AAAAATATAATACACAGGGTTGG - Intronic
941003097 2:160221715-160221737 AAAAACACATTAAACTGGGATGG - Intronic
941115735 2:161470132-161470154 AAAAGAACACCCCACTGGGCAGG + Intronic
941833172 2:169985387-169985409 AAAAATACAAAAAATTGGGCAGG - Intronic
941990677 2:171553945-171553967 GAAAGTACACTCCACAGGGCGGG + Intronic
944232662 2:197411799-197411821 AAAAACATACTACTCAGGGCTGG + Intronic
944561025 2:200938324-200938346 AAAAAAATACTCCATTGGGCCGG - Intronic
944807524 2:203297407-203297429 AAAAATACAAAACATTGGCCGGG + Intronic
944830218 2:203526427-203526449 AAGAATACTATACACTGGCCAGG + Intronic
944930224 2:204509925-204509947 AAAAATGCAAAGCACTGGGCCGG - Intergenic
945104382 2:206295668-206295690 AAAATTAGAGTAAACTGGGCTGG - Intronic
945666562 2:212751279-212751301 AAAATTATACTAAATTGGGCTGG + Intergenic
946379665 2:219337400-219337422 AAAAAAAAAATTCACTGGGCTGG + Intergenic
946688131 2:222291655-222291677 AAGAATACACCACACTGGTCAGG + Intronic
948154862 2:235773114-235773136 AAAAGTACACTCCACAGGGTGGG + Intronic
948649641 2:239432860-239432882 AAAAATACAAAACACTAGCCTGG - Intergenic
948744210 2:240074244-240074266 AAAAATAAACGACCCTGGCCGGG - Intergenic
948919963 2:241060645-241060667 AAAAAAAAACTATACAGGGCCGG + Intronic
1169331320 20:4718737-4718759 AAAAATACATAATGCTGGGCCGG + Intergenic
1170893323 20:20393972-20393994 AAAAATACACTACGAGGGGAAGG - Intronic
1171033820 20:21700905-21700927 AAAAATAAACTACAGAGGGTTGG - Intergenic
1171094662 20:22320087-22320109 AAATATACTTAACACTGGGCAGG + Intergenic
1172698809 20:36840151-36840173 AAAAAAACACCAGGCTGGGCAGG - Intronic
1172992098 20:39044210-39044232 AAAAATACAAAACATTAGGCAGG - Intergenic
1173278557 20:41606214-41606236 AAAAATACAAAAAACTGGCCAGG + Intronic
1173534363 20:43798082-43798104 AAAAATGAAATACACTTGGCTGG + Intergenic
1173763085 20:45581611-45581633 GAAAAAAGACTACTCTGGGCTGG - Intergenic
1174398870 20:50265033-50265055 ACAAATACAGTAATCTGGGCAGG + Intergenic
1174655004 20:52164150-52164172 AAAAATACACAACATTAGCCAGG + Intronic
1176457040 21:6922777-6922799 AAAAATACCATAAACTGGGTAGG + Intergenic
1176812181 21:13553042-13553064 AAAAATACCCAAGACTGGCCGGG - Intergenic
1176835213 21:13787859-13787881 AAAAATACCATAAACTGGGTAGG + Intergenic
1177354123 21:19984690-19984712 AAAAATAAACTAAATAGGGCAGG - Intergenic
1177530616 21:22354166-22354188 AAAAATACAAAACATTAGGCGGG - Intergenic
1177806514 21:25880155-25880177 ATAAATATCCTACACTGGTCAGG + Intergenic
1178431884 21:32524895-32524917 AAAAAGACTCAAAACTGGGCCGG + Intergenic
1178590535 21:33905751-33905773 AAAAATACACTAAATTAGCCGGG + Intronic
1178952208 21:36994342-36994364 AAAAATACAAAAAACTGGCCAGG + Intergenic
1179075951 21:38121786-38121808 AAAAATATACTACCTGGGGCCGG - Intronic
1179937930 21:44616838-44616860 AAAAATACACCCAAGTGGGCAGG - Intronic
1180430986 22:15250052-15250074 AAAAATACAAAAAAATGGGCTGG - Intergenic
1180722936 22:17922917-17922939 GAAAATACATTCCACTGAGCTGG - Intronic
1180849563 22:19008450-19008472 AAAAATAAAGTACAGTGGCCAGG + Intergenic
1180926929 22:19561710-19561732 AAAAATACACAAAATTAGGCAGG - Intergenic
1181110838 22:20601984-20602006 AAAAATACAAAGCACTGGCCGGG + Intergenic
1181499626 22:23308598-23308620 AAAAATACACCTCCCTGGCCAGG - Intronic
1182338523 22:29601481-29601503 AAAAATACGTGACACCGGGCCGG - Intergenic
1182685346 22:32118861-32118883 TAAAATACAACACACTGGGCAGG + Intergenic
1182692622 22:32174707-32174729 AAAAATACAAAACATTGGCCAGG - Intergenic
1182715001 22:32351406-32351428 TAAAATACAACACACTGGGCCGG + Intergenic
1182733620 22:32514718-32514740 AAAACTGCACCACACTGTGCTGG + Intronic
1183400460 22:37600754-37600776 AAAAATACAAAAAACAGGGCTGG + Intergenic
1183891190 22:40930288-40930310 AAAAATACAATAAACTAGCCGGG - Exonic
1183994614 22:41623546-41623568 AAAAATACAAAAAACTGGCCGGG - Intronic
1184019999 22:41814404-41814426 AAAAATACAAAAAACTGGCCAGG + Intronic
1184440032 22:44505413-44505435 AAAAATACAATATCATGGGCCGG + Intergenic
1185354545 22:50359510-50359532 AAAAAAACACTCCACAGGCCGGG - Intronic
949117523 3:345642-345664 AAAAATACAAAAAACTGGCCAGG - Intronic
949354926 3:3170274-3170296 AAAAGTACACTACAGAGGCCAGG - Intronic
949978873 3:9487082-9487104 AAAAATACAAAACAATGAGCTGG + Intergenic
950185596 3:10943495-10943517 AAAAAAAAACAAAACTGGGCAGG - Intergenic
950283821 3:11729267-11729289 ATAAATAAATTTCACTGGGCTGG + Intergenic
950380072 3:12605435-12605457 AAAAATACAAAAAACTGGGTGGG - Intronic
951336165 3:21424607-21424629 AAAAATACACTAAAATAGGCTGG - Intronic
951735210 3:25856168-25856190 AAAAATACCATAGACTGGCCCGG + Intergenic
952798984 3:37270511-37270533 ACAAAAAAGCTACACTGGGCTGG - Intronic
953489764 3:43339520-43339542 AAAAATACATTACATGGGCCGGG + Intronic
953640977 3:44707609-44707631 AAGAATTAACTGCACTGGGCTGG + Intergenic
954184963 3:48909880-48909902 AAAAATAAAATGTACTGGGCCGG + Intergenic
954548721 3:51462125-51462147 AAAAAAATTCTACACTGGCCAGG + Intronic
955019216 3:55102596-55102618 CAAAATACGCTAAACTGGGTAGG - Intergenic
955020334 3:55114669-55114691 AGAAATACACCACAGTGGCCGGG - Intergenic
955332392 3:58058082-58058104 AAAAATCCACTCAACTGGCCAGG - Intronic
955340528 3:58121872-58121894 AAAAATACATTATTCTGGCCAGG + Intronic
955400000 3:58584888-58584910 GAAAGTACACTCCACAGGGCGGG - Intronic
955861994 3:63340712-63340734 AAAAATAAAGTACATTGGCCGGG - Intronic
956071848 3:65461374-65461396 AAAAATACAAAAAACTAGGCGGG - Intronic
958029216 3:88087076-88087098 AAAAAAACAAAACAATGGGCTGG - Intronic
958627959 3:96650585-96650607 GAAAGTACACTCCACTGGGTGGG + Intergenic
958772978 3:98448392-98448414 AAAAATACACAAAACTAGTCTGG - Intergenic
959058457 3:101592466-101592488 AAAAATACATTTCACAGGCCAGG - Intronic
961121272 3:124373175-124373197 AAAAATACTGTAAACTGGGAAGG + Intronic
961601587 3:128066581-128066603 AAAAATAAACAAAACTGGCCGGG - Intronic
963053677 3:141164836-141164858 AAAAAGAAACTTCAGTGGGCTGG - Intergenic
963171871 3:142259580-142259602 AAAAGCACACTCCACAGGGCAGG + Intergenic
963698362 3:148591762-148591784 AAAAATACTGTAAACTGGGTGGG + Intergenic
964554845 3:157925748-157925770 AAAAATACACTACACAGGGTGGG + Intergenic
965222793 3:165949717-165949739 AAATATAACTTACACTGGGCAGG + Intergenic
965333417 3:167405908-167405930 AAAAATACAAAACCCTGGGGTGG + Intergenic
965344899 3:167536517-167536539 AAAAATACAAAAAACTGGCCAGG + Intronic
965563771 3:170089004-170089026 AAAAATACAAAAAACTGGCCAGG + Exonic
966183536 3:177207898-177207920 AAGAATACCCTATACTGGCCGGG - Intergenic
966702607 3:182871974-182871996 AAAAATACAAAAAATTGGGCGGG - Intronic
966805522 3:183804689-183804711 AAAAAAACAGACCACTGGGCCGG + Intronic
967141138 3:186561626-186561648 AAAAATACACAAAACTAGCCGGG + Intronic
967646566 3:191930426-191930448 AAAAATTCAAAACACTTGGCAGG - Intergenic
967784868 3:193481508-193481530 AAAAATGCTCTACACCTGGCTGG - Intronic
968247550 3:197168039-197168061 AAAAATTTTCTCCACTGGGCAGG + Intronic
968247901 3:197173097-197173119 AAAAATACACTACATGGGATTGG - Intronic
968332194 3:197880238-197880260 AAGAATACAATACACAGGCCGGG - Intronic
968785230 4:2616859-2616881 AAATATTCAATTCACTGGGCAGG - Intronic
969458517 4:7314785-7314807 AAAAAAACAGAACAGTGGGCAGG - Intronic
969922102 4:10550196-10550218 AAAAATACATTACATAGGCCAGG + Intronic
970136611 4:12932216-12932238 AAAAATAAACACCACTGGGTTGG - Intergenic
970782806 4:19759061-19759083 AAAAATAGAGCACACTGGGCAGG - Intergenic
970783398 4:19767220-19767242 AAAAATACAAAAAACTGGCCGGG + Intergenic
970889623 4:21028267-21028289 GAAAATAGACTACAGTGGGTAGG - Intronic
971366159 4:25978702-25978724 AAAAATACAGTATTCTGGCCAGG + Intergenic
971749553 4:30629935-30629957 AAAAATACATTACTATCGGCCGG + Intergenic
974022610 4:56705275-56705297 AAAAGTACACTCCACAGGGTGGG + Intergenic
974208646 4:58741424-58741446 TAAAAAAGACAACACTGGGCCGG + Intergenic
975576342 4:75866401-75866423 AAATATACACACCATTGGGCAGG - Intronic
976611733 4:87037470-87037492 AAAAATACAAAACATTGGCCGGG - Intronic
976834493 4:89355579-89355601 AAAAATACACAAAACTGGCCGGG - Intergenic
977239075 4:94544429-94544451 AAAAATACACTCCACAGTGTGGG + Intronic
978586228 4:110278634-110278656 AAAAAGACATTACACAGGGTTGG + Intergenic
979164355 4:117507895-117507917 AAAAATACATTTCCCTGGCCGGG - Intergenic
979526084 4:121718565-121718587 AAAAATACACTTCCCTGGGGTGG + Intergenic
979747046 4:124229541-124229563 AAAACTACACAACATTGGTCTGG + Intergenic
980437297 4:132794074-132794096 AAAAAGATAATACACTGGCCAGG + Intergenic
980478819 4:133357945-133357967 AAAAATAGACTAAAGAGGGCAGG - Intergenic
980775029 4:137426288-137426310 GAAAATACCCTACAATGGCCAGG + Intergenic
981019181 4:140007330-140007352 AACAAAACAAAACACTGGGCTGG + Intronic
981331187 4:143512608-143512630 AAAAAGACCCTGTACTGGGCAGG + Intergenic
982057670 4:151569224-151569246 AAAAAAGCATTACACTGGGCAGG - Intronic
982329423 4:154164645-154164667 CAAAATACTATACACTGGGTAGG - Intergenic
985287617 4:188352819-188352841 AAAACTACACAACACTGGTCTGG - Intergenic
985451212 4:190064759-190064781 AAAAATAAACTGCAGTGGACAGG + Intergenic
985915051 5:2911134-2911156 AAAAATTCACCACACTGGTATGG - Intergenic
987303130 5:16615237-16615259 AAAAATACAAAAAACTGGCCAGG + Intronic
987383648 5:17309255-17309277 AACAATGCCCTACACAGGGCAGG + Intergenic
987627266 5:20418375-20418397 AAAAAGACACTAGTCTTGGCCGG - Intronic
988180548 5:27786327-27786349 AAAAAGACACCACGCTGGGCAGG + Intergenic
988506642 5:31829611-31829633 AAAAATTCACTAAGCTGGGCTGG - Intronic
988837029 5:35043849-35043871 AAAAATACAAAACACTAGCCGGG - Intronic
989234953 5:39136228-39136250 AAAAATACAAAAAACTGGCCAGG - Intronic
989470960 5:41818033-41818055 AAACATACACAACACTTTGCAGG - Intronic
989737458 5:44725882-44725904 AAAAATACACAAAAATTGGCTGG + Intergenic
991278577 5:64882752-64882774 AAAAATACAAAACATTGGCCAGG - Intronic
992161308 5:74006351-74006373 AAACAAACACTGCACAGGGCTGG - Intergenic
992838467 5:80663822-80663844 AAAAGTACACTCCACAGGGTGGG + Intronic
993615098 5:90101663-90101685 AAAAATACAGTTGACTGGCCGGG + Intergenic
995184658 5:109259308-109259330 AAACATGAACTACTCTGGGCTGG - Intergenic
995506108 5:112862141-112862163 AAAAGTACACTCCACAGGGTGGG + Intronic
995901016 5:117066497-117066519 AAAAATACAAAAAAGTGGGCGGG + Intergenic
996027881 5:118669237-118669259 GAAAATTCATGACACTGGGCTGG - Intergenic
996271492 5:121610066-121610088 AAAAATTCACTCTATTGGGCTGG + Intergenic
996373986 5:122783238-122783260 AAAAAAACAAGTCACTGGGCAGG - Intronic
996388788 5:122937876-122937898 AAAAACACACTTCCCTGGGAAGG - Intronic
996687625 5:126301390-126301412 AAAAATACATTTCAGTGGGCGGG + Intergenic
997327782 5:133036276-133036298 AAAGATACACTAAAATGGCCAGG - Intergenic
998832732 5:146177168-146177190 AGAAATACAATGCACAGGGCCGG + Intronic
999726746 5:154444892-154444914 ATAATTACACGACCCTGGGCTGG + Intergenic
1000257211 5:159551378-159551400 TAAAAATCACTACACAGGGCTGG + Intergenic
1000264760 5:159624561-159624583 AAAAGTACACTCCACAGGGTGGG - Intergenic
1000312520 5:160058704-160058726 AGAAATACACTTCATTGGCCAGG - Intronic
1000665300 5:163987675-163987697 GAAAATAAACTATACTGGGAAGG + Intergenic
1000950264 5:167473100-167473122 AAAAAAGCACTACACAGAGCTGG - Intronic
1001431500 5:171666184-171666206 AGAAATAGACTGCACTTGGCTGG - Intergenic
1001683236 5:173574057-173574079 AAAAATACGCAACACTCAGCCGG + Intergenic
1002478788 5:179485663-179485685 AAAAATAAAACTCACTGGGCCGG - Intergenic
1002492958 5:179592411-179592433 AAAAATACAAAAAACTGGCCGGG - Intronic
1003745157 6:8992919-8992941 AAAAATACACAAAAATGAGCCGG + Intergenic
1004445268 6:15692175-15692197 AAAAATACACAAAATTGGCCAGG - Intergenic
1004851638 6:19705389-19705411 AAAAATACAAAACATTAGGCTGG + Intergenic
1004936285 6:20511530-20511552 AAAAATACAAAAAACTGGCCTGG - Intergenic
1005237831 6:23786469-23786491 AAAAATTCAATAAGCTGGGCGGG + Intergenic
1005388616 6:25311019-25311041 AAAAATACAAAAAACTGGCCGGG + Intronic
1005617471 6:27588186-27588208 AAAAATACAAAAAACTAGGCGGG + Intergenic
1006427094 6:33972446-33972468 AAAAGTACACTCCACAGAGCGGG + Intergenic
1006618711 6:35347393-35347415 AAAGATAAACTCCACAGGGCAGG + Intronic
1007154181 6:39725683-39725705 AAAAAAATACAGCACTGGGCCGG + Intergenic
1007993518 6:46282247-46282269 AAAAATAGGTCACACTGGGCTGG + Intronic
1008693770 6:54010166-54010188 AAAAATACACTATAGAAGGCAGG + Intronic
1009435571 6:63614518-63614540 AAAAAAAAATTAAACTGGGCCGG - Intergenic
1010795622 6:80113759-80113781 AAAAATGCACTCCACAGGGTGGG + Intronic
1011466163 6:87659356-87659378 AAAATTACAATAAACAGGGCCGG - Intronic
1011679024 6:89764960-89764982 AAAATTATACTTTACTGGGCTGG + Intronic
1011913160 6:92467392-92467414 AAAAATTCTTTACACTGGCCTGG + Intergenic
1013220064 6:108070587-108070609 CAAAATACATTACACTGGATAGG + Intronic
1013534664 6:111052908-111052930 AAAAGTACACTCCACAGGGTTGG + Intergenic
1014298705 6:119652863-119652885 AAAATACAACTACACTGGGCGGG + Intergenic
1014623842 6:123701945-123701967 TAAAATATAATATACTGGGCAGG + Intergenic
1014763150 6:125380361-125380383 TAAAAGACAGGACACTGGGCTGG - Intergenic
1015317545 6:131833457-131833479 AAAAATCCACCACATTGGGATGG - Intronic
1015840594 6:137472720-137472742 AAAAAGACACTTTACTGGGAGGG + Intergenic
1016000398 6:139035777-139035799 AAAAATACAAGAAACTAGGCCGG - Intronic
1016007456 6:139104313-139104335 AAAAATATAATACATTGGCCGGG - Intergenic
1017454813 6:154592046-154592068 AAAAATACAAAAAACTGGCCAGG + Intergenic
1017835050 6:158168936-158168958 AAAAATACAATAAATTGGCCTGG + Intronic
1018147938 6:160910818-160910840 AAAAAAACCCAAAACTGGGCTGG - Intergenic
1018219979 6:161568295-161568317 AAAAATAAATAACACTGGGCTGG + Intronic
1018327027 6:162681854-162681876 AAAATTACACTCCACAGGGTGGG - Intronic
1018812932 6:167310583-167310605 AAAAATAAACCAAACTGGCCGGG + Intronic
1019584322 7:1789169-1789191 CAAAATACACTAAGCTGGCCGGG + Intergenic
1020062799 7:5165195-5165217 AAAAATCCAGGACACTTGGCTGG + Intergenic
1020165458 7:5804141-5804163 AAAAATCCAGGACACTTGGCTGG - Intergenic
1020425542 7:8061961-8061983 AAAAAAACACTTTAATGGGCTGG - Intronic
1021654088 7:22857824-22857846 AAAAAAAGAATATACTGGGCGGG - Intergenic
1022437071 7:30398071-30398093 AAAAATATACAAAACTGGTCAGG - Intronic
1023083868 7:36550641-36550663 AAAAAGACAGTACACTGGTTTGG - Intronic
1023382164 7:39619858-39619880 AAAAAAAAACAACACTAGGCAGG - Intergenic
1024880920 7:54084327-54084349 AAAAATACAAAACATTGGCCAGG - Intergenic
1025008823 7:55378834-55378856 AAAAATATACTCCAGTAGGCTGG + Intronic
1025043307 7:55667344-55667366 CAAAATACATTACAAGGGGCCGG + Intergenic
1025708597 7:63888806-63888828 GAAAAGACAGTACACTGAGCAGG + Intergenic
1026052001 7:66954694-66954716 AAAAATACACAAAAGAGGGCTGG - Intronic
1026252410 7:68682441-68682463 AAAAAAACAAAACACGGGGCTGG - Intergenic
1026843079 7:73681794-73681816 AAAAATACAAAACACTAGCCAGG + Exonic
1027143959 7:75681070-75681092 AAAAATACAAAAATCTGGGCTGG - Intronic
1027193606 7:76012835-76012857 AAAAATACACAAAAGTGGGAAGG - Intronic
1028111041 7:86941735-86941757 AAAATTAGACTACAATGGGAAGG + Intronic
1029430856 7:100529119-100529141 AAAAATACACAAAATTAGGCGGG - Intergenic
1029589156 7:101495712-101495734 AAAAATACCCTACGCTGGCCGGG - Intronic
1030203927 7:106934273-106934295 AAAAAAACAACACACAGGGCCGG + Intergenic
1030481802 7:110113724-110113746 GAAAATGCACTACACAGGACTGG - Intergenic
1032149360 7:129414713-129414735 AGAAATAAACAACACTTGGCTGG - Intronic
1032315086 7:130829830-130829852 AAAGATACACTGAACAGGGCAGG - Intergenic
1032742386 7:134751814-134751836 AAAAATACACAAAATTAGGCGGG + Intronic
1033006557 7:137570883-137570905 TTAAAAACATTACACTGGGCTGG - Intronic
1033322839 7:140355896-140355918 AAAAATACACTAAAATGGGCTGG + Intronic
1033874656 7:145800147-145800169 AAAAATAAATTAAAATGGGCAGG + Intergenic
1034148953 7:148898256-148898278 AAAAATACACTAAAATTAGCCGG + Intergenic
1034397013 7:150834340-150834362 AAAACTCCACGACACTGGTCTGG + Intronic
1035199496 7:157251972-157251994 AAAAATACAAAAAACTGAGCCGG + Intronic
1036205126 8:6799951-6799973 ACAAATGCACCACTCTGGGCCGG - Intergenic
1036732698 8:11280449-11280471 AAAAGTACACTCCACAGAGCGGG + Intergenic
1036824580 8:11966213-11966235 AGAAATACACAGCACAGGGCCGG - Intergenic
1037186995 8:16076666-16076688 AAAAATACAAAACAATTGGCCGG - Intergenic
1037945349 8:22986249-22986271 AAAAAAGCAATGCACTGGGCTGG - Intronic
1038010500 8:23472022-23472044 AAAAATCCAATACTCTGGGGAGG - Intergenic
1038142647 8:24863634-24863656 AAAAGTACACTCCACAGGGTGGG + Intergenic
1038519804 8:28221008-28221030 ATCAAAAAACTACACTGGGCAGG - Intergenic
1038561273 8:28582650-28582672 AAAAATACAAAAAACTTGGCTGG + Intergenic
1038783234 8:30586923-30586945 AAAACAACACAACACTGGTCAGG + Intronic
1039666289 8:39533691-39533713 GAAAATATATTACAATGGGCCGG - Intergenic
1039703073 8:39981045-39981067 AAAAATGCAATGCACTGGCCGGG - Intronic
1040108527 8:43554514-43554536 GAAATTAAACCACACTGGGCAGG - Intergenic
1040985352 8:53287996-53288018 AAAAATACACAAAATTGGCCGGG + Intergenic
1041000999 8:53453150-53453172 AAGAATAGACTACACAGGGCAGG - Intergenic
1041226195 8:55701132-55701154 AAAAATACAAAACAATTGGCCGG + Intronic
1041326004 8:56665100-56665122 AAAAAACCACCACCCTGGGCCGG - Intergenic
1041334022 8:56759487-56759509 AAAAAAACACTGCAATGGGCAGG + Intergenic
1042310965 8:67379141-67379163 AAAAATACAAAAAACTGGCCAGG + Intergenic
1042322736 8:67495125-67495147 AACACTACACTACACTAAGCTGG - Intronic
1042354714 8:67814453-67814475 AAAAATCCATTACATTGGTCTGG + Intergenic
1042554541 8:70022884-70022906 AAAAATACACCAACCTGGGCTGG - Intergenic
1042947670 8:74171259-74171281 AAAAATACCTTACATTGGCCGGG - Intergenic
1043259657 8:78180593-78180615 AAAACTACACTCCACAGAGCAGG + Intergenic
1043806494 8:84678561-84678583 TAAAAAACGCTACACTTGGCTGG - Intronic
1044133805 8:88559488-88559510 AAAAATCCCCTCCAGTGGGCAGG + Intergenic
1044668091 8:94651386-94651408 AGAAATACACAACATTGGCCTGG - Intronic
1045025356 8:98081630-98081652 TATAATCCACTACACTGGCCGGG + Intronic
1045304231 8:100943823-100943845 AAAAATACAATACAATTAGCTGG + Intronic
1045368284 8:101495851-101495873 AAAAATACAATACAGGGGCCAGG + Intronic
1045857807 8:106783853-106783875 AAAAATATCCAACACTGGGCCGG - Intergenic
1046396176 8:113642837-113642859 CAAAATACAAGACTCTGGGCAGG - Intergenic
1046931387 8:119845245-119845267 AAAAATACAAAAAACTTGGCCGG - Intronic
1048566317 8:135601454-135601476 AAAAATTCACTAGACAGAGCAGG + Intronic
1048849307 8:138629448-138629470 AAATATAAAATATACTGGGCCGG - Intronic
1049028463 8:140014169-140014191 GAAAATACACTCCTCTGAGCGGG - Intronic
1049136739 8:140908917-140908939 TAAAATACATGAAACTGGGCCGG + Intronic
1049842477 8:144782025-144782047 AAAAATACACAACTTGGGGCTGG + Intronic
1049885995 9:26748-26770 AATAAGACACTACACTAGCCAGG + Intergenic
1049920143 9:355496-355518 AGAAATACACCATTCTGGGCTGG - Intronic
1050152289 9:2628749-2628771 AAAGATAGACTACACAGGGAGGG + Intronic
1050452643 9:5799535-5799557 AAAAAAACACTGCATAGGGCAGG + Intronic
1050912754 9:11094028-11094050 GAAAATACAGTATATTGGGCAGG + Intergenic
1051234606 9:14985985-14986007 AAAAATACAATACACCAAGCCGG - Intergenic
1052946607 9:34173497-34173519 AAAAATACACAAAATTGGTCAGG + Intergenic
1053578518 9:39378308-39378330 AAGAATACACTTCACAGGCCGGG - Intergenic
1053843041 9:42206387-42206409 AAGAATACACTTCACAGGCCGGG - Intergenic
1054100103 9:60937113-60937135 AAGAATACACTTCACAGGCCGGG - Intergenic
1054108940 9:61085970-61085992 AAAAATACAAAAAATTGGGCCGG + Intergenic
1054121500 9:61212740-61212762 AAGAATACACTTCACAGGCCGGG - Intergenic
1054586243 9:66969772-66969794 AAGAATACACTTCACAGGCCGGG + Intergenic
1054611917 9:67245155-67245177 AAAAATACAAAAAATTGGGCCGG - Intergenic
1055215593 9:73856975-73856997 AAAAATAATGTACATTGGGCTGG - Intergenic
1055484134 9:76740286-76740308 AAAAATACAATAAATTGGCCAGG + Intronic
1058361145 9:104147684-104147706 AAAAATACACTCCCCAGGGCTGG - Intergenic
1058948255 9:109879031-109879053 AAAAATAACCAACACTGGGCTGG - Intronic
1059111347 9:111560780-111560802 AAAAATACAAAACACTAGCCAGG + Intronic
1059288179 9:113196311-113196333 AAAAAGAATATACACTGGGCAGG + Intronic
1059633151 9:116146636-116146658 AAAAAAAAACTACAATGAGCTGG + Intergenic
1060285246 9:122245680-122245702 AAAAATACTTTAAACTGGCCAGG + Intronic
1060634781 9:125191312-125191334 AAAAATACAAAATACTGGGGAGG + Intergenic
1060697127 9:125718835-125718857 AAAAATACAAAACACTGGCTGGG + Intergenic
1060974698 9:127757954-127757976 AAAAATACAAAAAACTGGCCGGG - Intronic
1061122637 9:128653416-128653438 AAAAATAAAAAAAACTGGGCCGG + Intronic
1061126162 9:128677322-128677344 AAAAATACAATAAACTAGCCAGG + Intergenic
1061557637 9:131381578-131381600 AAAAATACAAAACAATTGGCTGG - Intergenic
1062050886 9:134446529-134446551 CAAAAGTCACTTCACTGGGCCGG - Intergenic
1062209269 9:135354704-135354726 AAAAAAACACTACAAAGGCCGGG + Intergenic
1185447125 X:264439-264461 AAAAATAAAATAAAGTGGGCCGG + Intergenic
1185474004 X:402655-402677 AAAAATACACTAAATTAGCCGGG + Intergenic
1185789577 X:2918589-2918611 AAAAATACAATACAGGTGGCGGG + Intronic
1187170237 X:16843945-16843967 ACAAAGCCACAACACTGGGCTGG - Exonic
1187626971 X:21125789-21125811 TAAAATACTCTACACTGAGGTGG - Intergenic
1189815166 X:44817514-44817536 AAAAGCACACTTCACAGGGCAGG + Intergenic
1190408908 X:50115121-50115143 AAAAGTACACTACACAGGGTGGG - Intergenic
1190776087 X:53553301-53553323 AAAAATACAAAAAACTGGCCGGG - Intronic
1190819115 X:53957049-53957071 AAAAATACAAAAAACTGGCCAGG + Intronic
1190830650 X:54056365-54056387 AAAAATATGATACTCTGGGCTGG - Intergenic
1192990998 X:76456000-76456022 AAAAATACACTCCACAGTGTGGG - Intergenic
1193687100 X:84591284-84591306 AAAACTACACTACAGGGGGAGGG + Intergenic
1193933004 X:87580864-87580886 AGAAATAGACATCACTGGGCAGG + Intronic
1194674817 X:96782258-96782280 AAAAATACAAAACAATTGGCCGG - Intronic
1196486897 X:116222255-116222277 AAAAATACACAAGACAGGCCAGG - Intergenic
1196759437 X:119188051-119188073 GAAAGTACACTCCACAGGGCCGG - Intergenic
1196854549 X:119970569-119970591 AAAAGTACACTCCACAGGGTGGG + Intergenic
1196922606 X:120600204-120600226 AAAAGTAAAATACACTGGCCGGG + Intronic
1198053303 X:132969614-132969636 AAAAATACAAAACATTGGCCAGG - Intergenic
1198302628 X:135346229-135346251 AAAAATACACTGCAATAGGGAGG - Intronic
1198410972 X:136367512-136367534 ACAAAAACACTGCACTGGGTTGG + Intronic
1198619775 X:138493517-138493539 ATAAAAAAACTACACTGGCCTGG - Intergenic
1198696575 X:139346474-139346496 AAAAATACAATTAGCTGGGCTGG - Intergenic
1199357725 X:146881101-146881123 GAAAGTACACTCCACTGGGTGGG - Intergenic
1200174477 X:154103609-154103631 AAAAATATACTATAATCGGCTGG + Intergenic
1200936128 Y:8740055-8740077 GAGAACACACTACCCTGGGCTGG + Intergenic
1202052950 Y:20799329-20799351 AATAAAACAATACACTGAGCTGG - Intergenic