ID: 1140441785

View in Genome Browser
Species Human (GRCh38)
Location 16:74993461-74993483
Sequence GCAGCTAGTAAGAGCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 8, 3: 54, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140441785 Original CRISPR GCAGCTAGTAAGAGCAGAGC TGG (reversed) Intronic
900018176 1:169052-169074 GATCCTTGTAAGAGCAGAGCAGG + Intergenic
900048435 1:527648-527670 GATCCTTGTAAGAGCAGAGCAGG + Intergenic
900070661 1:769500-769522 GATCCTTGTAAGAGCAGAGCAGG + Intergenic
900983470 1:6059709-6059731 GCAGCAACTCAGAGCAGAGCCGG + Intronic
901897514 1:12327167-12327189 GCAGCTGGTAAGGGCAGAACAGG + Intronic
903214254 1:21834581-21834603 ACAGAAAGGAAGAGCAGAGCGGG + Intronic
903372270 1:22844349-22844371 TCAGCCAGGAAGAGCAGGGCTGG + Intronic
903440129 1:23381592-23381614 ACAGCTAATAATGGCAGAGCTGG - Intronic
903993737 1:27291787-27291809 ACTGCTAGTAAGTGCAGAGCTGG - Intronic
904858931 1:33520619-33520641 GCAGCTCATGAGGGCAGAGCTGG + Intronic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905440000 1:37989673-37989695 TCAGCTGGTAAAAGCTGAGCGGG - Intronic
905646947 1:39631758-39631780 ACAGCAAGAAAGCGCAGAGCTGG + Intronic
905709222 1:40086583-40086605 ACAGCTAATGAGAGCAGAGGGGG + Intronic
907799964 1:57754774-57754796 ACAGCTAGTGAGAGCAGAGCTGG + Intronic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
907837434 1:58123652-58123674 ACAGCTAGTAAGGGCACACCAGG - Intronic
908400667 1:63770246-63770268 ACAACTATTAAGAGCAGAGCAGG + Intergenic
911532015 1:99054255-99054277 TCAGTTAGTAATTGCAGAGCTGG - Intergenic
912163235 1:107011730-107011752 GCATCCTGTAAGGGCAGAGCAGG + Intergenic
912682688 1:111739170-111739192 GGAGCTGGTAAGAGCGAAGCTGG - Exonic
913283130 1:117204363-117204385 CCAGCTAGGAAGTGGAGAGCTGG + Intronic
915129152 1:153685180-153685202 ACAGCAAGTGAAAGCAGAGCTGG - Intronic
918163144 1:181919666-181919688 GCAGCTAGCAAGGGCATTGCTGG + Intergenic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
920430995 1:205919050-205919072 GAAGATAGTGAGACCAGAGCAGG + Intronic
920803425 1:209210217-209210239 CCAGATAGGAAGAGCAGGGCTGG - Intergenic
921798397 1:219374270-219374292 GTAGCTGGTAAGAACACAGCTGG - Intergenic
924323377 1:242871225-242871247 GCAGCTAATAAAGGCAGAGCTGG + Intergenic
924348202 1:243092482-243092504 GATCCTTGTAAGAGCAGAGCAGG + Intergenic
1063391333 10:5651629-5651651 ACACCTAGTAAGCACAGAGCAGG + Intronic
1067314663 10:45150537-45150559 GATCCTTGTAAGAGCAGAGCAGG - Intergenic
1069341923 10:67420446-67420468 GCAGCTGGAAAAGGCAGAGCTGG - Intronic
1069950656 10:72016092-72016114 GCAGGTAGTAAGTGCCCAGCAGG + Intergenic
1070575432 10:77673659-77673681 CCAGCTAATAAATGCAGAGCAGG - Intergenic
1070577885 10:77693538-77693560 GCAGAAAGTCAGTGCAGAGCTGG - Intergenic
1070916792 10:80160360-80160382 ACAGCTAGTAACAGCTGAGCTGG - Intronic
1071427068 10:85569373-85569395 GCAGCTAGAGACAGCAAAGCAGG - Intergenic
1072741218 10:97911114-97911136 GAAGCTGGTAAGACCAGGGCAGG - Intronic
1072894570 10:99355685-99355707 ACAGCCTGTAAGAGCAAAGCTGG - Intronic
1073217352 10:101843763-101843785 GCAGCAGGTGAGCGCAGAGCCGG + Intronic
1073290340 10:102410346-102410368 GCAGCGAGTTAGCGCAAAGCTGG - Intronic
1073442358 10:103559589-103559611 ACAGCCAGCAAGAGCAGAACAGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1073471089 10:103722741-103722763 ACAGCTAGTAGCAGCAGAACTGG + Intronic
1074291484 10:112140868-112140890 GTGGCTGGTAAGTGCAGAGCAGG + Intergenic
1075199065 10:120387158-120387180 GCAGCCAGGAAGAGGAGACCTGG - Intergenic
1075497251 10:122933751-122933773 ATAGCTAGTAAGAGCACAGTAGG - Intronic
1075683375 10:124347961-124347983 GCCGTTGGGAAGAGCAGAGCTGG + Intergenic
1076930620 10:133529360-133529382 GCAGGCAGGAAGAGGAGAGCCGG - Intronic
1076974779 11:164248-164270 GATCCTTGTAAGAGCAGAGCAGG + Intergenic
1077289822 11:1783829-1783851 GCCGCTGGTGAGAGCAGAGCTGG + Intergenic
1077632569 11:3820941-3820963 CCAGCTAATAAAGGCAGAGCTGG + Intronic
1078896705 11:15603426-15603448 GCCCCTGGCAAGAGCAGAGCAGG + Intergenic
1081525649 11:43925753-43925775 TCAGCTAGAAAGGGCAGAGCTGG - Intronic
1081577065 11:44325579-44325601 GCACACAGGAAGAGCAGAGCTGG + Intergenic
1082005262 11:47415659-47415681 GCAGCGAGGAAGAGCAGCACTGG + Exonic
1085044413 11:73344777-73344799 ACAGCCAGTAAGGGCAGTGCTGG + Intronic
1085272683 11:75279548-75279570 ATAGTTAGTAAGAGGAGAGCTGG - Intronic
1085389413 11:76174971-76174993 GCAGCTGGGAAGAGCAGGGTGGG + Intergenic
1085413289 11:76304446-76304468 ACAGCTAATAAGACCAGAACTGG + Intergenic
1085565844 11:77512653-77512675 GTAGCTAGTAATAGCATAGTAGG - Intergenic
1085743912 11:79098842-79098864 GCAGCTAGTAAGACCTGAATTGG + Intronic
1085831471 11:79905862-79905884 GTAGCTAGTAAGACATGAGCAGG + Intergenic
1086590437 11:88508936-88508958 TCAGGTAGGACGAGCAGAGCGGG + Exonic
1087677335 11:101178279-101178301 ACAGCTGGTAAGATGAGAGCTGG - Intergenic
1089389004 11:118087231-118087253 GAAGTCAGTAAGGGCAGAGCTGG - Intronic
1090047898 11:123351806-123351828 ACAGCGAGTAAGAGCAGAGTGGG - Intergenic
1096469255 12:51865878-51865900 GCAGCGATTAGGAGGAGAGCTGG + Intergenic
1097134223 12:56837933-56837955 GTAGCTAGTCAGAGGTGAGCAGG - Intergenic
1100279390 12:93103850-93103872 ATAGCTAATTAGAGCAGAGCTGG + Intergenic
1100462878 12:94818461-94818483 GTAGCTAGTTAGACCTGAGCAGG + Intergenic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1100815955 12:98387416-98387438 GCAGCTAATCACAGCAAAGCAGG - Intergenic
1101364173 12:104056137-104056159 GCAGCTGGCAAGAGCAAGGCAGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101806148 12:108065561-108065583 ACAGCTAGAAAGAGCAGAGCTGG - Intergenic
1102619723 12:114184339-114184361 ACAGCTAGTCAGGGCAGAGCTGG - Intergenic
1102919483 12:116781124-116781146 ACAGCTAGTCAGTGCAGAGCTGG - Intronic
1103093701 12:118116277-118116299 GTAGTTAGTCAGAGCTGAGCAGG - Intronic
1103249110 12:119484905-119484927 TCAGGTAGTTACAGCAGAGCAGG + Intronic
1103535696 12:121632469-121632491 CCAGCCAGAAAGACCAGAGCTGG - Intronic
1103559061 12:121782785-121782807 ACAGCCAGTGAGGGCAGAGCTGG - Intronic
1103737704 12:123070915-123070937 GCAGCTAGGAAGGGCTGACCTGG - Intronic
1106009167 13:25801453-25801475 GCAGGTTGTAAGAGCAGCACTGG - Intronic
1107070206 13:36260169-36260191 GCAGCTAATAATGGTAGAGCTGG + Intronic
1108148075 13:47500798-47500820 GCAGCCAGGAAGAGCAGACTTGG + Intergenic
1111122201 13:83867839-83867861 GTAGCTAGTCAGAGAGGAGCAGG + Intergenic
1113008089 13:105730456-105730478 GCAGTAAGTAGGAGCACAGCTGG + Intergenic
1115298295 14:31855836-31855858 ATAGCTAGTAAGAGATGAGCTGG - Intronic
1117222678 14:53621343-53621365 GCAGGAAGTAAAAGCAGTGCTGG + Intergenic
1117281324 14:54243993-54244015 GCAGCTAGTAATGGTAGAGGTGG - Intergenic
1119872063 14:78026534-78026556 GCTGCTAGGCAGACCAGAGCTGG + Intergenic
1121340171 14:93100280-93100302 ACAGCTGGTAGGGGCAGAGCTGG - Intronic
1122637138 14:103135420-103135442 GGAGCTGTTAAGAGCAGCGCTGG + Exonic
1125041738 15:35195766-35195788 TCAACCAGTCAGAGCAGAGCAGG - Intergenic
1126644046 15:50857240-50857262 GCAGCTTATAAAAGCAGAGTTGG + Intergenic
1127714620 15:61637588-61637610 GAAGCTGGTAAGACCAGAACAGG + Intergenic
1127887091 15:63211150-63211172 TAAGCTAATAAAAGCAGAGCTGG - Intronic
1128536844 15:68498071-68498093 ACAGCTAGAAAGGGCAGAGCTGG + Intergenic
1128568235 15:68715159-68715181 GCAGGTAGGGAGGGCAGAGCAGG - Intronic
1128620758 15:69147629-69147651 ACATTTAGTAAGAGCAGAGCTGG + Intergenic
1128666823 15:69544457-69544479 CCCGCTAGCAAGTGCAGAGCTGG + Intergenic
1128978285 15:72168765-72168787 GCAGCTTGTACTAGCAGAGGGGG + Intronic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1130152205 15:81319740-81319762 GCACCTAGTAAGAGCCTGGCTGG + Intronic
1131867610 15:96728744-96728766 GCAGCCAGAAAGAGCAGTCCTGG - Intergenic
1132558934 16:584735-584757 GCAGCTGGTAGGAGCAGGGTAGG - Intergenic
1133197099 16:4178806-4178828 ACAGCTGTTAAGAGGAGAGCTGG - Intergenic
1133614856 16:7466607-7466629 ACAGCTAGTGAGTGCAGAGCTGG - Intronic
1133909657 16:10053424-10053446 CCAGCTAGCAAGAGAAGAGCTGG + Intronic
1134782970 16:16915641-16915663 ACAGCTGGTAAGAGCAGAGCCGG + Intergenic
1134860917 16:17559723-17559745 GCAGCTAAAAGTAGCAGAGCTGG - Intergenic
1136085270 16:27880493-27880515 GCAGCTGGTCATTGCAGAGCTGG - Intronic
1138346086 16:56321066-56321088 TCAGATAGTAAGAGAGGAGCGGG + Intronic
1138441456 16:57037421-57037443 GCAGCTAGGAAGAGGGGTGCCGG - Intronic
1138627118 16:58261230-58261252 GCAGGAAGGGAGAGCAGAGCTGG + Intronic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140800263 16:78480950-78480972 GCAAATAGTAAGAAAAGAGCAGG + Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141422007 16:83923699-83923721 GCAGCTGGTGAGGGCAGAGTTGG + Exonic
1141894991 16:86953655-86953677 GCAGCAAGTGAGAGCTGGGCAGG - Intergenic
1142097328 16:88248788-88248810 TCAGCCAGTAGTAGCAGAGCGGG + Intergenic
1142445484 16:90133409-90133431 GATCCTTGTAAGAGCAGAGCAGG - Intergenic
1142462028 17:102061-102083 GATCCTTGTAAGAGCAGAGCAGG + Intergenic
1142720649 17:1773568-1773590 TCAGCTAGTACAGGCAGAGCTGG - Intronic
1144025425 17:11272479-11272501 CCAGCTAGTGAAGGCAGAGCGGG - Intronic
1144451549 17:15384192-15384214 GCAGCTGGTGAGGACAGAGCTGG + Intergenic
1144623647 17:16833553-16833575 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1144761331 17:17709239-17709261 GTACCTAGGGAGAGCAGAGCTGG + Intronic
1144882782 17:18439163-18439185 ACAGCTGGTAAGGGCAGAGCAGG + Intergenic
1145016948 17:19405276-19405298 ACAGCTATTAATGGCAGAGCTGG - Intergenic
1145149449 17:20505223-20505245 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1145746900 17:27326807-27326829 ACAGCAAGTTAGTGCAGAGCTGG + Intergenic
1146094722 17:29918299-29918321 CCAGCTAGAAATGGCAGAGCTGG - Intronic
1146269625 17:31476547-31476569 ACAGGTAGTAATAGCAGAGCTGG + Intronic
1146448649 17:32953984-32954006 GCAGCCAGTAAGGGAAGAACTGG + Intergenic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147437305 17:40425018-40425040 GCAACTAGGGACAGCAGAGCTGG - Intergenic
1147497648 17:40932883-40932905 CCAGCCAGTAAGCGCGGAGCAGG - Intronic
1147577978 17:41613485-41613507 ACAGTTGGTAAGGGCAGAGCAGG - Intronic
1148124180 17:45228477-45228499 GAAGCCAGTAAGAGGAGAGCTGG - Intronic
1148867307 17:50635190-50635212 GCAGCCGGGAAGGGCAGAGCAGG - Intronic
1149454143 17:56773785-56773807 GCAGCTGGTGAGGACAGAGCCGG + Intergenic
1149557020 17:57580518-57580540 GCAGCTAGCAAGACCAGCACTGG - Intronic
1149621238 17:58046841-58046863 GCAGCGAGCAGGAGCAGGGCTGG - Intergenic
1150103941 17:62447988-62448010 GCAGACAGGGAGAGCAGAGCAGG - Intronic
1150863019 17:68820881-68820903 ACAGTTTGTAAAAGCAGAGCCGG - Intergenic
1151831033 17:76551006-76551028 TCAGCTAGAATCAGCAGAGCTGG + Intronic
1152772356 17:82177963-82177985 ACAGCTCATCAGAGCAGAGCTGG - Intronic
1153656847 18:7290480-7290502 TCAACTAGTAGGTGCAGAGCTGG - Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156439544 18:37170300-37170322 CCAGCTGGTAAGAGCAAAGCTGG - Intronic
1156881284 18:42083783-42083805 GCTGCTGGTGAGAGCAGAGTTGG + Exonic
1157218586 18:45807109-45807131 GCAGGTTGTCAGAGCAGTGCAGG - Intergenic
1157271917 18:46282819-46282841 ACAGCTGGTAAGGGCGGAGCAGG - Intergenic
1157478221 18:48036742-48036764 GCAGCCACTTAGAGCAGAGACGG - Intronic
1157570777 18:48710566-48710588 AGAGGTGGTAAGAGCAGAGCTGG + Intronic
1160651731 19:234429-234451 GATCCTTGTAAGAGCAGAGCAGG + Intergenic
1160918985 19:1510975-1510997 ACAGCCAGTCAGGGCAGAGCCGG - Exonic
1161604828 19:5208849-5208871 GGAGCTGGGAAGGGCAGAGCTGG - Intronic
1161615915 19:5270114-5270136 TCTGCTAGGAAGAGCAGGGCGGG + Intronic
1162136340 19:8557714-8557736 GCAGGCTGTAGGAGCAGAGCAGG + Intronic
1165075217 19:33276587-33276609 ACAGCCAGTGAGACCAGAGCTGG - Intergenic
1167320522 19:48794896-48794918 GCAGATAGTAAGTTCAGTGCCGG + Intergenic
1167698296 19:51027441-51027463 GCAGCCAGTAAGTGAACAGCTGG - Exonic
925032434 2:661217-661239 GCAGGTAGCAGGAGCACAGCAGG - Intergenic
925664050 2:6234181-6234203 GCAGGCAGTAAGTGCAGAGCCGG + Intergenic
925832041 2:7905167-7905189 ACAGCTAAGGAGAGCAGAGCAGG - Intergenic
926694135 2:15758841-15758863 ACAGCCAGCAAGAGCAGAGCTGG - Intergenic
927800209 2:26091868-26091890 ACAGCTAGTAAGATCAGATGAGG + Intronic
928167378 2:28981078-28981100 GCAGCCAGGAAGTGCATAGCTGG - Intronic
928229161 2:29481163-29481185 GCAGCTGGTAATGGCAGATCTGG + Intronic
929905126 2:46039068-46039090 CCAGCTAGTTTGAGCAGAGGTGG - Intronic
930293182 2:49521138-49521160 ACAGAAAGTAAGAGCAGACCAGG + Intergenic
931922319 2:67034223-67034245 TCAGCTAGCAAGAGCAGAGCTGG + Intergenic
933268418 2:80206941-80206963 GCAATTAGAAAAAGCAGAGCTGG + Intronic
933343284 2:81049752-81049774 GCAGAAAGTTAAAGCAGAGCTGG + Intergenic
934091214 2:88552263-88552285 GCTGCTAGCAAGAGAGGAGCTGG + Intergenic
935629859 2:105204480-105204502 ACAACTAGTAAGGGCTGAGCTGG - Intergenic
936594665 2:113836407-113836429 GTAGCTAGTAAGTGAAGAGCTGG - Intergenic
937016984 2:118615191-118615213 GCTGCTGGTATGTGCAGAGCTGG - Intergenic
937064268 2:119005481-119005503 ACAGCTAGGAAGGGCAGAGCTGG + Intergenic
937537159 2:122904005-122904027 GCAGCCAGTAAGAGAAGTGGAGG - Intergenic
941019816 2:160396374-160396396 GCACCTAGTAAGAACTGAGGTGG - Intronic
941188193 2:162343929-162343951 GGAGCCAGTAAGAGTCGAGCAGG + Intronic
941298019 2:163764609-163764631 GAAGCTACCAAGAGCAGGGCTGG - Intergenic
941808986 2:169737085-169737107 TCAGCAAGTAAGAGGAAAGCAGG - Intronic
942156115 2:173129596-173129618 GCAGCAAATAGGAGCAGAGCTGG + Intronic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
946650587 2:221889256-221889278 GCAGGTAGAAGGAGCAGAGATGG + Intergenic
947878742 2:233486325-233486347 GCAGCTGGCAGGAGGAGAGCGGG + Intronic
948017261 2:234700889-234700911 GAAGAGAGGAAGAGCAGAGCTGG + Intergenic
948473347 2:238200967-238200989 ACAGTTAGTAAGCGAAGAGCTGG + Intronic
1168839310 20:898991-899013 GCAGCTAAGAAGAGAAGATCTGG - Intronic
1169474539 20:5919015-5919037 GAAGTGAGTAAGAGCAGAGTGGG + Intronic
1172620502 20:36315648-36315670 GCAGCAAGTAAGAGTGGGGCTGG + Intronic
1172627773 20:36358051-36358073 ACAGCCAGTGACAGCAGAGCTGG - Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1174379675 20:50148544-50148566 GGAGCTAGGAAGAGCAGGGGAGG + Intronic
1175206914 20:57318155-57318177 GCTCCTGGTAAGAGCACAGCTGG - Intergenic
1175215653 20:57390647-57390669 GGGGCGAGTAAGAGCAGACCCGG - Intergenic
1175664472 20:60846325-60846347 GCAGCTACTACCAGCAGAGCTGG - Intergenic
1175744031 20:61441360-61441382 ACAGCTAGTTGGGGCAGAGCTGG + Intronic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1180105843 21:45617521-45617543 GCAGAGAGGCAGAGCAGAGCAGG - Intergenic
1183009370 22:34932246-34932268 GCAGCCTGTAAGTGCAGAGCTGG - Intergenic
1183355509 22:37356781-37356803 ACAGCTGGTAAGTCCAGAGCAGG + Intergenic
1183573199 22:38669709-38669731 GCCGCTATTGAGGGCAGAGCTGG + Intronic
1183668103 22:39256619-39256641 GCAGGTAGAAAGAGCAGGTCAGG - Intergenic
1184877537 22:47285002-47285024 GCAGCTGGTGAGCTCAGAGCCGG - Intergenic
949279613 3:2330660-2330682 TCAGCTAGAAAGTGAAGAGCTGG + Intronic
949485438 3:4533358-4533380 ATAACTAGTAAGAGCAGGGCAGG - Intronic
949707098 3:6830903-6830925 GAACCAAGCAAGAGCAGAGCAGG - Intronic
950706793 3:14787899-14787921 GCAGCTAGAAGGAGTAGAGAGGG - Intergenic
952779488 3:37081364-37081386 GCAGGTAGTGAGAGTAGAGAAGG - Intronic
953237534 3:41119606-41119628 GCAGCTGCCAAGAGCACAGCAGG + Intergenic
953711557 3:45275492-45275514 GAGTCTAGTGAGAGCAGAGCTGG + Intergenic
954803413 3:53200842-53200864 GCATCTACTAAGGGCAGATCTGG + Intergenic
954806734 3:53224973-53224995 TCACCTAGGAACAGCAGAGCAGG + Intronic
954904520 3:54048824-54048846 GAAGCTCTTAAGAGCACAGCTGG - Intergenic
956043396 3:65170176-65170198 TCAGCTAGTAACAGCTGAGCTGG + Intergenic
956188689 3:66587027-66587049 TCAGCTGGTTAGAGCAGAACTGG + Intergenic
956785646 3:72640092-72640114 ACAGCTAGTAGTGGCAGAGCTGG + Intergenic
957782491 3:84837101-84837123 GCAGCTGCTGAGAGCAGATCCGG - Intergenic
959664491 3:108905624-108905646 GAAGCTTGAAAGAGGAGAGCTGG - Intergenic
961799689 3:129437648-129437670 GCAGGTAGTGGGAGCATAGCAGG - Intronic
962477799 3:135771921-135771943 CCAGCTAGTAAGAGCAGCAGGGG + Intergenic
962843159 3:139253278-139253300 ACAGCAAGTGAGAGCAGAGCTGG + Intronic
964019179 3:151986451-151986473 ATAACTAGTAAGTGCAGAGCTGG + Intergenic
964561898 3:158005947-158005969 GCAGCTTGTAAGAACCGAGTGGG - Intergenic
964816234 3:160720161-160720183 CCAGCTAGGAACAGCAGAGACGG - Intergenic
964894830 3:161583124-161583146 GCAGATAGTGAGTGGAGAGCTGG + Intergenic
964930323 3:162012680-162012702 TCAGCTAGAAAGAACAGAGAAGG + Intergenic
965904651 3:173689048-173689070 GCAGCCAGTAAGAGCAGATCTGG - Intronic
966206177 3:177408969-177408991 GAAGGTAATAATAGCAGAGCTGG - Intergenic
966588987 3:181658832-181658854 GTAGCTGGTAAGTGCAGAGCAGG - Intergenic
967275347 3:187768722-187768744 GCAGTGAGAAAGGGCAGAGCAGG + Intergenic
967751349 3:193119670-193119692 GCAGCTAGTCAGAGCAGGGCAGG + Intergenic
967889853 3:194357241-194357263 GGAGCTAATAAGAGCCGATCGGG + Intronic
967889864 3:194357306-194357328 GGAGCTAATAAGAGCCGATCGGG + Intronic
967889876 3:194357371-194357393 GGAGCTAATAAGAGCCGATCGGG + Intronic
968366100 3:198185539-198185561 GATCCTTGTAAGAGCAGAGCAGG - Intergenic
969288474 4:6222932-6222954 ACAGCTAGTGAGAGAAGAGCTGG + Intergenic
971373419 4:26036463-26036485 TCAGCTATTGAGAGCAGACCTGG - Intergenic
971678673 4:29668263-29668285 GGAGCAAGTAAAAGGAGAGCAGG + Intergenic
972554124 4:40163902-40163924 CCGGCTATTAATAGCAGAGCCGG + Intergenic
972987072 4:44777766-44777788 GCAGCTAGTCAGACATGAGCAGG + Intergenic
972999393 4:44927011-44927033 GCAGATAGTAGCAGCAGAGTTGG + Intergenic
973225518 4:47779397-47779419 GCAGCTAAGAGGATCAGAGCAGG - Intronic
973611881 4:52643825-52643847 TCAGCCAATAAGAGCAGATCTGG + Intronic
976218704 4:82738927-82738949 CCAGCTAGTAATAACAGAGGTGG + Intronic
977467919 4:97404533-97404555 GCAGCTAGGAAGAGCAGTTCAGG - Intronic
979283196 4:118890633-118890655 GCTGCAAGTTAGATCAGAGCTGG - Intronic
980111176 4:128638676-128638698 GCAGCTACAGAGAGAAGAGCAGG + Intergenic
980621814 4:135316935-135316957 GTAGCTAGTAAGACATGAGCAGG - Intergenic
982070588 4:151690953-151690975 TCTGCTATGAAGAGCAGAGCGGG - Intronic
985047409 4:185953862-185953884 GCAGGGAGTAGGCGCAGAGCTGG + Intronic
985745125 5:1642543-1642565 GGAGGTAGAAAGGGCAGAGCTGG - Intergenic
988551565 5:32204985-32205007 GCAAGTATTAAGAGCAGAGCAGG - Intergenic
992083012 5:73252954-73252976 GTAGCAAGCAATAGCAGAGCCGG + Intergenic
993481237 5:88427091-88427113 GCTTCTAGTAAGAGCAGAGATGG + Intergenic
994147824 5:96414158-96414180 ACAGCTGGTAAGAGCAGAACTGG - Intronic
995070193 5:107912306-107912328 ATAGCTAGTAAGTCCAGAGCTGG + Intronic
996950394 5:129119105-129119127 GAAGCTCTTAAGAGCAGAACTGG - Intergenic
997302683 5:132817929-132817951 ACAGCTAGTAAATGCAGAGCTGG + Intergenic
999539576 5:152556910-152556932 GCAGCTATTTGGAGCCGAGCAGG - Intergenic
999811117 5:155128174-155128196 CCAGCTAGCAAGTGCAGAGCTGG + Intergenic
1000879914 5:166685372-166685394 GCAGCTAGTAAAAACATAGGGGG - Intergenic
1001209355 5:169795773-169795795 GCAGCCTGGCAGAGCAGAGCTGG + Intronic
1001892642 5:175352008-175352030 GCAGCCAGTGAGGGCAGAGCTGG + Intergenic
1002725326 5:181290764-181290786 GATCCTTGTAAGAGCAGAGCAGG - Intergenic
1002783668 6:385178-385200 GCATCTAGAAAGGACAGAGCAGG + Intergenic
1003638378 6:7855486-7855508 ACAGCCAGCAAGGGCAGAGCTGG - Intronic
1003695318 6:8400381-8400403 GCAGCAAGAAACAGCAGAGATGG + Intergenic
1003804378 6:9710032-9710054 ACAGCAAGTCAGAGCAGTGCTGG + Intronic
1004201738 6:13555059-13555081 GCAGCTGGGAAGAGCTGGGCTGG + Intergenic
1005670826 6:28104806-28104828 GGAGCTAGTTAGAGCTGGGCTGG + Intergenic
1006407826 6:33855505-33855527 GCAGCCAAATAGAGCAGAGCTGG + Intergenic
1006446207 6:34081183-34081205 CCAGCTTGTCAGGGCAGAGCTGG - Intronic
1006717230 6:36128342-36128364 ACAGCTGGTAAGGGCAGAGCTGG - Intronic
1006852583 6:37109722-37109744 ACAGCTAGTTAGGGCAGAGGTGG + Intergenic
1010119015 6:72351991-72352013 TCACATAGTAAGGGCAGAGCTGG + Intronic
1011186880 6:84687304-84687326 CCATCTATTAAGAACAGAGCTGG + Intergenic
1011434538 6:87322709-87322731 GCAGCTGGGAAGGGCAGAGACGG - Intronic
1012811076 6:103958982-103959004 GAAGCTGGTAAAAGCAGAGTAGG + Intergenic
1013663612 6:112323789-112323811 ACAGATAGTAAGAGATGAGCTGG - Intergenic
1015598855 6:134893039-134893061 GGAGGTAGGAAGAGCAGAACTGG + Intergenic
1015859005 6:137656170-137656192 CCACCTAGAAAGAGCAGAACAGG - Intergenic
1016206779 6:141477337-141477359 GCAGCTATTAAGAGGAGAATGGG - Intergenic
1016996596 6:149965630-149965652 ACAGCAGGTCAGAGCAGAGCAGG - Intronic
1017343792 6:153356550-153356572 CCATCTAGAAAGAGGAGAGCAGG - Intergenic
1019164326 6:170088199-170088221 GCCGCTGGTGGGAGCAGAGCTGG + Intergenic
1019686201 7:2383620-2383642 TCACCTAGGCAGAGCAGAGCGGG + Intergenic
1021458697 7:20860199-20860221 ACAGCTAGTCAGAGGTGAGCTGG + Intergenic
1022992277 7:35720328-35720350 CCAGTGAGTAAGAGCAGAGATGG + Intergenic
1023107506 7:36776885-36776907 GCTGTTGGTAAGGGCAGAGCTGG + Intergenic
1023110913 7:36809612-36809634 GTAGCCAGTAAGGGCGGAGCTGG + Intergenic
1023212532 7:37823341-37823363 GCAGCTAGAATTTGCAGAGCAGG - Intronic
1023418138 7:39950807-39950829 GCAGCCAGGAAGAGCAGAGGCGG - Exonic
1023814486 7:43939168-43939190 GCAGCTCCTGGGAGCAGAGCAGG + Intronic
1024563244 7:50661847-50661869 GCAGCTGGTGAGACCAGAGTTGG - Intronic
1027045052 7:74985653-74985675 ACAGTTAGTGAGGGCAGAGCTGG - Intronic
1029007788 7:97228779-97228801 GCTGCTAGTAAGACCAGAAGAGG - Intergenic
1029387803 7:100255257-100255279 ACAGTTAGCAAGGGCAGAGCTGG + Intronic
1030044428 7:105482175-105482197 GCAGCAAGGGAGGGCAGAGCAGG - Intronic
1031848414 7:126833540-126833562 CAAGCTAGAAAGAGCAGATCAGG - Intronic
1032033122 7:128501185-128501207 GCAGACAGGGAGAGCAGAGCAGG - Intronic
1032423606 7:131802631-131802653 GCAGGCAGGAAGAGGAGAGCTGG + Intergenic
1032916962 7:136501793-136501815 GCAGCAAGTGAGATCAGAGTGGG - Intergenic
1036473035 8:9067784-9067806 ACAGCTAGTCTGAGCAGAACTGG + Intronic
1037829371 8:22178897-22178919 GCAGGCAGGAAGAGCAGATCGGG - Intronic
1038524057 8:28258140-28258162 GCAGCCAGTAAGGGCGCAGCAGG - Intergenic
1041138388 8:54786729-54786751 CAAGATAATAAGAGCAGAGCAGG - Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1042611797 8:70608236-70608258 GCAGCTGGGAAGAGCAGAACCGG - Exonic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1044119213 8:88374197-88374219 GCAGCTAGTCAGACATGAGCAGG + Intergenic
1044199397 8:89415230-89415252 GCAGCTAGTCAGACATGAGCAGG - Intergenic
1044237058 8:89843099-89843121 GCAAAAAGTAAAAGCAGAGCTGG + Intergenic
1044343613 8:91076631-91076653 ACAGCTGGTAAGAGCAGAGCAGG - Intronic
1045041627 8:98230052-98230074 CCAGCTAAGAAGAGGAGAGCTGG + Intronic
1046463532 8:114572308-114572330 GCAGGTAGTTAGAGATGAGCAGG + Intergenic
1047291289 8:123532538-123532560 CCAGATACTCAGAGCAGAGCTGG - Intronic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1048743956 8:137592408-137592430 ACAGCTTGAAAGGGCAGAGCTGG - Intergenic
1048836318 8:138522297-138522319 GCAGCTGCCAAGAGCAGACCAGG + Intergenic
1049032616 8:140048806-140048828 GAAGCAAGTAAGAGCAGCCCTGG - Intronic
1049358008 8:142198311-142198333 GCAGCTGCTAGGGGCAGAGCTGG - Intergenic
1049467210 8:142757027-142757049 GAAGCCACCAAGAGCAGAGCAGG - Intergenic
1051493431 9:17692673-17692695 GCAGCTAGGAGGGGCAGAGGTGG + Intronic
1051681933 9:19616415-19616437 ACAGCTAGTAAATGCAGAACTGG + Intronic
1053304169 9:36972332-36972354 ACAGCAAGTAACAGCAGAGCTGG - Intronic
1054984235 9:71243328-71243350 GCAGGTAATAAGAGAATAGCAGG - Intronic
1056531602 9:87492961-87492983 CAAGGTAGTAATAGCAGAGCTGG + Intergenic
1056739286 9:89239479-89239501 TCAGCTAGTAAGTACAGAGCTGG - Intergenic
1056906029 9:90648571-90648593 GCAGCCAGGATGAGCAGAGCAGG + Intergenic
1058740814 9:107940398-107940420 ACAGCTAGCAATAGCAGAGCTGG + Intergenic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1060013905 9:120069669-120069691 ACAACTGGTAAGTGCAGAGCTGG + Intergenic
1060297706 9:122354620-122354642 ACAGCTAGTAAGGGCCGAGGCGG + Intergenic
1060523982 9:124310153-124310175 GCAGCAAAGAACAGCAGAGCTGG - Intronic
1062750469 9:138248406-138248428 GATCCTTGTAAGAGCAGAGCAGG - Intergenic
1188415158 X:29924004-29924026 ACAGCTAGTAAGAACAGAGTTGG - Intronic
1189255637 X:39636887-39636909 GCAGCTGCAAACAGCAGAGCAGG + Intergenic
1190522197 X:51291882-51291904 ACAGCTGGGAAGTGCAGAGCTGG - Intergenic
1192232605 X:69276373-69276395 ACAGCTAGTAATGGCAGAGCTGG + Intergenic
1193726536 X:85046529-85046551 GCAGCTAGTGAAACCAGAGCAGG + Exonic
1194027487 X:88770734-88770756 CCAGCTAGAAAGAGGACAGCAGG - Intergenic
1195453829 X:105045478-105045500 GCAGTTAGACAGAACAGAGCAGG + Intronic
1196696869 X:118622736-118622758 GTAGCTAGTAATGGGAGAGCTGG + Intronic
1196991962 X:121339713-121339735 ACAGCTATTAAGTGCAGAGTTGG + Intergenic
1198581097 X:138065437-138065459 ACAGCTAGTAAGAACAGAGCTGG + Intergenic
1199662343 X:150064292-150064314 TAAGCTAGTAAGAGCAATGCAGG - Intergenic
1199676264 X:150191809-150191831 ACAGCTAATAAAAACAGAGCTGG + Intergenic
1199977577 X:152903501-152903523 GCAGCCAGTGAGATCAGAGGAGG - Intergenic
1199979063 X:152911145-152911167 GCACCCAGTAGGAGCAGGGCTGG + Intergenic
1201736057 Y:17262972-17262994 ACAGCTAGGAAGAGCATAGAAGG - Intergenic