ID: 1140441860

View in Genome Browser
Species Human (GRCh38)
Location 16:74993993-74994015
Sequence TGCCATGTTCTCTCACATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140441856_1140441860 19 Left 1140441856 16:74993951-74993973 CCTTGCATTGCAGCACTATAGCC 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1140441860 16:74993993-74994015 TGCCATGTTCTCTCACATCTGGG 0: 1
1: 0
2: 0
3: 33
4: 221
1140441857_1140441860 -2 Left 1140441857 16:74993972-74993994 CCTCTTTCAGTTCCTTGAATATG 0: 1
1: 0
2: 7
3: 55
4: 663
Right 1140441860 16:74993993-74994015 TGCCATGTTCTCTCACATCTGGG 0: 1
1: 0
2: 0
3: 33
4: 221
1140441853_1140441860 22 Left 1140441853 16:74993948-74993970 CCCCCTTGCATTGCAGCACTATA 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1140441860 16:74993993-74994015 TGCCATGTTCTCTCACATCTGGG 0: 1
1: 0
2: 0
3: 33
4: 221
1140441854_1140441860 21 Left 1140441854 16:74993949-74993971 CCCCTTGCATTGCAGCACTATAG 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1140441860 16:74993993-74994015 TGCCATGTTCTCTCACATCTGGG 0: 1
1: 0
2: 0
3: 33
4: 221
1140441855_1140441860 20 Left 1140441855 16:74993950-74993972 CCCTTGCATTGCAGCACTATAGC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1140441860 16:74993993-74994015 TGCCATGTTCTCTCACATCTGGG 0: 1
1: 0
2: 0
3: 33
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140441860 Original CRISPR TGCCATGTTCTCTCACATCT GGG Intronic
900573296 1:3370637-3370659 TGCCCTGGTCCCTCACATCAGGG - Intronic
901491886 1:9600991-9601013 ACCCATGTTCTCACACATCCTGG - Intronic
902849429 1:19141925-19141947 GGCCTTGTTCTCTTACTTCTTGG + Intronic
903363221 1:22790199-22790221 TGCCTTGTACTGTCACACCTTGG - Intronic
904868876 1:33603885-33603907 TGCCATGTTTTCTTGCCTCTGGG - Intronic
905034744 1:34910581-34910603 TCCCATGATCCCTCACATCACGG + Intronic
907821098 1:57970284-57970306 AGCCAAGCTCTCTCACCTCTAGG - Intronic
911314756 1:96342369-96342391 TGCCAGATTCTCTCCCATCTTGG - Intergenic
914256449 1:145963934-145963956 GGCCATTTTCTCTGACATCTGGG + Intronic
914280159 1:146163587-146163609 GGCCATGTTATCTCTCACCTGGG - Intronic
914541204 1:148614526-148614548 GGCCATGTTATCTCTCACCTGGG - Intronic
914625436 1:149456719-149456741 GGCCATGTTATCTCTCACCTGGG + Intergenic
915488719 1:156239844-156239866 GGCCATGTTCTCTCTTCTCTAGG + Exonic
915605234 1:156946231-156946253 TGTCATGTTCACACCCATCTTGG - Intronic
918240751 1:182617989-182618011 TGCCGTGTTTTCTCAGGTCTTGG - Intergenic
918743483 1:188167609-188167631 TTCCAAGTTCTCTGACTTCTTGG + Intergenic
919466677 1:197928416-197928438 TGTGATCTTCTCTCACTTCTTGG + Intronic
919569683 1:199231891-199231913 TGGCAGGTTCTTTCCCATCTGGG - Intergenic
920978423 1:210808336-210808358 TGCCTGGTTCTCTCAGATCATGG - Intronic
921689852 1:218135679-218135701 TGCCAGGTTCTCTAACACTTGGG + Intergenic
923451104 1:234118047-234118069 TCCCATGTTTTATCACATCCTGG - Intronic
1063629739 10:7722600-7722622 TGCCATGTTTTCTCATCTCTGGG + Intronic
1064670602 10:17709885-17709907 TGCCCTGTTTTCTGACATGTGGG - Intronic
1065284419 10:24173998-24174020 TGCCATGTTCTCTTCCATCATGG + Intronic
1065327394 10:24560894-24560916 TGCCATCTACTCCCAAATCTGGG - Intergenic
1070106586 10:73438210-73438232 TCCCAGGGACTCTCACATCTCGG - Exonic
1071450797 10:85790186-85790208 AGCCTTGTCCTCCCACATCTGGG - Intronic
1074954812 10:118378513-118378535 TGCCATCTTCAGTTACATCTTGG + Intergenic
1081021638 11:37955792-37955814 TGCCATATTTTCTCACAAATAGG + Intergenic
1081314213 11:41611876-41611898 TTCCTTGTTCTCTCTCATTTTGG - Intergenic
1081619726 11:44612103-44612125 TGCCAGGTGATCTGACATCTCGG - Intronic
1084713607 11:70859727-70859749 TGGCATGTTTTCTCACTTCGTGG - Intronic
1085517093 11:77118043-77118065 AGCTGTGTTCTCTCACCTCTGGG + Intronic
1085546737 11:77326017-77326039 TGCCCTGCTCTGTCACTTCTGGG + Intronic
1085703847 11:78768675-78768697 TGGCATATTCTCCCACAACTGGG + Intronic
1089896585 11:121936084-121936106 AGCCATGTTTTCTGAAATCTAGG - Intergenic
1090757267 11:129803561-129803583 AGCCATTTTCTTTCACAGCTGGG + Intergenic
1091446462 12:546537-546559 TCCCTTTTTCTCTCACTTCTTGG + Intronic
1094434620 12:30407872-30407894 TGGCCTGTTCTCTCTCTTCTTGG + Intergenic
1098324980 12:69291943-69291965 TGTCAATTTCTCTCATATCTAGG - Intergenic
1099890849 12:88586663-88586685 TTGCATGTTCTCTGAAATCTGGG + Intergenic
1101306651 12:103535112-103535134 TGCCATAGTCTCTCACATTCTGG - Intergenic
1102466815 12:113135077-113135099 GGCCATATTCTGTCAGATCTGGG - Intronic
1102531636 12:113551006-113551028 GGCTTTGTTCTTTCACATCTGGG + Intergenic
1105449095 13:20482954-20482976 TCCCATGTTCTCACTCATGTAGG + Intronic
1105602748 13:21901806-21901828 TGCCCTGTCCTCTCCCCTCTTGG + Intergenic
1106403050 13:29448089-29448111 TGTCATTTTCTCTCTCAGCTTGG - Intronic
1108574380 13:51778784-51778806 TGCCAAGTACTCTCTCCTCTAGG + Intronic
1109174858 13:59142915-59142937 TGCCCTGTTCTCTTGCCTCTTGG - Intergenic
1109347395 13:61131440-61131462 TGCCATGATTTCTTACTTCTTGG + Intergenic
1109890997 13:68614162-68614184 TGATATGTTCTCTCATATCAAGG - Intergenic
1110052933 13:70926787-70926809 TGCCATGTTCTCTCATAAGTGGG + Intergenic
1111075454 13:83229390-83229412 CCCAATGTTCTCTCTCATCTGGG - Intergenic
1111692255 13:91579161-91579183 TGTCATGTACTGTCACATGTGGG + Intronic
1112786150 13:102953812-102953834 TGACATGTTCTCACTCATCCAGG - Intergenic
1112938673 13:104832654-104832676 TGCTATATTTTCTCATATCTGGG + Intergenic
1116070516 14:40038789-40038811 TGCCATGGTCTCTAAGATCAGGG + Intergenic
1116584308 14:46683186-46683208 TTACATGTTCTCCCACATGTGGG - Intergenic
1118820451 14:69342062-69342084 AGCCCTGTTCTCTCCCTTCTGGG + Intronic
1121445669 14:93977344-93977366 GGCCATGTCCTGTCACATCCCGG - Intergenic
1122196084 14:100086902-100086924 TGCCATTTTCTCTAATGTCTTGG - Intronic
1124410390 15:29432124-29432146 TGACATGTTCTCTCAACTCATGG + Intronic
1125154093 15:36566680-36566702 TGCCATGTTCTGTCACGCCAAGG - Intergenic
1126304183 15:47236219-47236241 TGCCATTTTCTGTAACATCTGGG + Intronic
1126830898 15:52603740-52603762 TTCCATGTTCTCACTCATATGGG + Intronic
1128213643 15:65919055-65919077 GGCCCAGGTCTCTCACATCTTGG + Intronic
1129035469 15:72646178-72646200 TGCCAGGTTCTCTATCACCTGGG - Intergenic
1129214415 15:74091038-74091060 TGCCAGGTTCTCTATCACCTGGG + Intergenic
1129360391 15:75020604-75020626 AGCCATGTTCTCACACTGCTTGG - Exonic
1129473315 15:75766986-75767008 TGCCAGGTTCTCTATCACCTGGG + Intergenic
1130038147 15:80380243-80380265 TGCCAACTTCTCTCACATGTTGG + Intronic
1133145452 16:3782306-3782328 TGCCAGTTTCTCACACATCTTGG - Intronic
1134570118 16:15283768-15283790 TGCCATATTCTTTCACTTGTGGG + Intergenic
1134732259 16:16472281-16472303 TGCCATATTCTTTCACTTCTGGG - Intergenic
1134935178 16:18239682-18239704 TGCCATATTCTTTCACTTCTGGG + Intergenic
1135149760 16:19995182-19995204 AGCCATGGGCTCTCACATCCTGG + Intergenic
1138179984 16:54934682-54934704 TGCCATCTTTTCTCCCTTCTGGG - Intergenic
1138558071 16:57784481-57784503 TGACTTGTTCTCTCAGTTCTGGG - Intronic
1140432345 16:74915115-74915137 TGCCATCTTCTCTCACAGGCTGG - Intronic
1140441860 16:74993993-74994015 TGCCATGTTCTCTCACATCTGGG + Intronic
1144808730 17:17984993-17985015 AGCCAGGTCCTCTCACACCTGGG + Intronic
1149262491 17:54895296-54895318 TGCCTTGTCCTCTCTCATCTTGG + Intergenic
1149469684 17:56906072-56906094 TGCAATTTTGTTTCACATCTTGG + Intronic
1150866984 17:68861697-68861719 CTCCAAGTTCTCTCACATCCTGG - Intergenic
1152194718 17:78910674-78910696 TGGCATGTTCTCACTCATATGGG - Intronic
1152425914 17:80218587-80218609 TGCCATGTGCTCACACCTGTGGG - Intronic
1154094038 18:11393639-11393661 AGCCCTTTTCTCTCACAGCTGGG + Intergenic
1155421156 18:25657956-25657978 TGCCACGTGATCTCACATATAGG - Intergenic
1156126019 18:33905893-33905915 TGGGATGTTGTCTCCCATCTGGG - Intronic
1156929489 18:42624669-42624691 TACCTTGTTCTCTCACTTCAGGG + Intergenic
1157198514 18:45639599-45639621 TCCCATGTTCTCTCACATGCTGG + Intronic
1158517622 18:58143842-58143864 TGCTAGGTTGTCTCACATCTAGG + Intronic
1158536798 18:58315651-58315673 TGCCATCTTCTCTTTCAGCTGGG + Intronic
1159803811 18:72930073-72930095 TTCCATGACTTCTCACATCTGGG + Intergenic
1159949710 18:74474108-74474130 TACCAAGTTCTCTCTAATCTGGG - Intergenic
1161541553 19:4854782-4854804 TGCAATGCTCTCTCAATTCTGGG - Intronic
1162576322 19:11501103-11501125 TGCCATGATTTCTCCCATCTTGG + Intronic
1163198581 19:15744717-15744739 TTCCATGTTCTCTTATTTCTTGG + Intergenic
1163199285 19:15752296-15752318 TGACATGTTCTCACTCATGTGGG - Intergenic
1167771191 19:51520039-51520061 TACCATGTTCTCTCCAATCAAGG + Exonic
925457011 2:4024508-4024530 TGCCAGGTTCTACCACAGCTGGG - Intergenic
926709706 2:15869003-15869025 TGCAATTTTCTCTCATTTCTTGG - Intergenic
926827228 2:16918329-16918351 TGCAAGGTTTTCACACATCTTGG + Intergenic
926986627 2:18631660-18631682 TGCCAAGTTCTCTCAGCTCTTGG - Intergenic
927065256 2:19464628-19464650 TACCATATTCTATCAAATCTAGG - Intergenic
929925262 2:46202220-46202242 TGCCATGTTCTATGGGATCTGGG + Intergenic
930265469 2:49194389-49194411 TGCCATGTTCTTTCAGAGTTGGG + Intergenic
930465384 2:51741572-51741594 TGCCTTGTTCTCTTACTTTTGGG + Intergenic
930794025 2:55368754-55368776 TAGCATGTTTTCCCACATCTAGG - Intronic
930928533 2:56851479-56851501 TGCATTGTTCTCTCACATATGGG + Intergenic
932525151 2:72458064-72458086 TGTCTTGTTCTCTTACATTTTGG - Intronic
935756899 2:106283426-106283448 AGCCAGGTTTTCTCACAGCTGGG - Intergenic
936895915 2:117427310-117427332 TGCCATTCTCACTCACAGCTTGG - Intergenic
937734450 2:125272624-125272646 TGCCATGTTCACTGATCTCTTGG + Intergenic
937970592 2:127546035-127546057 TGCCAGGTACTCTCAGCTCTGGG + Intronic
938510636 2:131938747-131938769 TTCCATGTTCTCACTCATATGGG + Intergenic
938976790 2:136486424-136486446 TGCCTTGTTATCTCACTGCTTGG - Intergenic
939413782 2:141865846-141865868 TGGCATGTGAGCTCACATCTTGG + Intronic
939769523 2:146298596-146298618 AGCCCTTTTCTCTCACAGCTGGG + Intergenic
940621176 2:156115719-156115741 TGCCATGTTTTCTAACAGCATGG - Intergenic
941765177 2:169288950-169288972 TGCCCTGATCTCTGACATCTAGG - Intronic
943156417 2:184184900-184184922 TGGCATTTTCTCTCATAGCTAGG - Intergenic
945176732 2:207051045-207051067 AGCCATGTTCTCTCTCCTCCTGG + Intergenic
947090859 2:226509996-226510018 TCCCATTTTCTCTTACAGCTAGG - Intergenic
947328984 2:229008636-229008658 AGCCCTGTTCTTTCACATCTGGG + Intronic
947331299 2:229032251-229032273 TGCCATGGTTTCTCTCATGTGGG + Intronic
947896099 2:233674162-233674184 AGTCATATTCTCTCACATATTGG + Intronic
1169366962 20:5000432-5000454 TCCCATGTCCTCGCACATCCCGG + Intronic
1171195026 20:23190091-23190113 TGCCATGTGGCCTCACATCGAGG - Intergenic
1172926061 20:38536608-38536630 TTGCATTTTCTCTAACATCTAGG + Intronic
1172958419 20:38778948-38778970 TGACAACTTTTCTCACATCTGGG + Intergenic
1173809408 20:45947145-45947167 TGCCATGGTCTCTCACTTTGAGG + Exonic
1174779565 20:53376428-53376450 TGCCATCTTGTCTGACTTCTTGG + Intronic
1174855183 20:54037928-54037950 AACCCTGTTTTCTCACATCTGGG + Intronic
1175505984 20:59484445-59484467 AGGCATGTTCTCTTCCATCTGGG + Intergenic
1176783192 21:13224550-13224572 TTCCATGTTCTCACTCATATGGG - Intergenic
1177013421 21:15755491-15755513 TGCCATATTTTCTCAACTCTAGG - Intronic
1177710138 21:24763343-24763365 TGCCAAGTTCTTTCCCTTCTTGG + Intergenic
1177980830 21:27913354-27913376 TTCCATGTTCTCACTCATATGGG - Intergenic
1178672735 21:34606159-34606181 TTCATTGTTCTCTCCCATCTGGG - Intronic
1178801625 21:35801131-35801153 TGCCCTTTTCTTTCACAGCTGGG + Intronic
1181122780 22:20683235-20683257 TGCCATGGTCTCTCATGTCTTGG - Intergenic
1181179645 22:21057854-21057876 TGCCATGGTCTCTCATGTCTTGG + Intronic
1181428622 22:22862171-22862193 TCACATGTTCTCTCTCATGTGGG + Intronic
1181626336 22:24124674-24124696 TGCCATGTGCTCTCTCTCCTGGG - Intronic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
949197387 3:1328739-1328761 TGCCATGCTCTCTTGCTTCTGGG - Intronic
949604095 3:5634622-5634644 AGCCCTTTTCTCTCACAGCTGGG - Intergenic
950285682 3:11742988-11743010 TCCCAACTTCTCTTACATCTGGG + Intergenic
950649343 3:14397515-14397537 GGCCATGTTCTCTCCCTTCTGGG - Intergenic
951524842 3:23643949-23643971 TTCCCTCTTCTCTCACCTCTGGG + Intergenic
953769121 3:45765379-45765401 TGCCATGTCTTCTCACAACCTGG - Intronic
953883920 3:46705023-46705045 GGCCATGTCCTCTCAGAACTGGG + Intronic
955043537 3:55338753-55338775 TACCATGTTCTCTGAGATCTTGG - Intergenic
955617536 3:60825060-60825082 TGCTATTTTTTCTCATATCTTGG - Intronic
957901250 3:86495480-86495502 TGTCTTGTTATCTCATATCTGGG - Intergenic
959586491 3:108030046-108030068 TGAAATGCTCTCTAACATCTGGG + Intergenic
960009236 3:112815301-112815323 AGACATGTTCTCACACATCTAGG + Intronic
961535592 3:127568706-127568728 TGCCATGGTGTCTGACATCCAGG + Intergenic
962753529 3:138451647-138451669 TTCCATGTCCTCTCCCACCTCGG + Intronic
962918123 3:139926709-139926731 TACAATGTTCTATAACATCTGGG - Intergenic
964705134 3:159610218-159610240 TCCCATGTCATCTCTCATCTAGG - Intronic
965440436 3:168706394-168706416 TGCCATGCACTCTCACTTCATGG + Intergenic
965904787 3:173690330-173690352 TGCCATTTACTCTCACTTCTAGG + Intronic
967137363 3:186523713-186523735 TTTCATTTTCTCACACATCTAGG - Intergenic
969845097 4:9914228-9914250 TCCCATTTCCTCTCACCTCTCGG - Intronic
970350186 4:15194610-15194632 TGCTACGTTCTCTCTCATCTTGG + Intergenic
971204368 4:24549112-24549134 TGCCATCTTCTTTCACTTCATGG + Intronic
972680807 4:41305216-41305238 GGCCATGTTTTCTCACATATTGG + Intergenic
975075440 4:70201895-70201917 TACCAGGTGTTCTCACATCTTGG - Intronic
976686392 4:87819687-87819709 AGCCCTTTTCTTTCACATCTGGG - Intergenic
976960481 4:90965383-90965405 GGCCCTGTTTTCTCACCTCTGGG + Intronic
977020049 4:91747171-91747193 AGCCCTTTTCTCTCACAGCTGGG - Intergenic
977320698 4:95512022-95512044 TGCCATGTTCTCCCAGCACTTGG - Intronic
978183044 4:105824856-105824878 TGCCATATTCTTTCTCATCTTGG + Intronic
981717485 4:147765861-147765883 TGACATGTTCTATCCCATTTTGG + Intronic
984957259 4:185057927-185057949 TGACAGCTTCTCTCCCATCTTGG + Intergenic
985350938 4:189060462-189060484 TGCCATGTTCTGAGACCTCTGGG - Intergenic
986447497 5:7835411-7835433 TTGCATGTTCTCTGTCATCTCGG + Exonic
987517160 5:18925555-18925577 TGCCAAGGTCTTTCACTTCTTGG + Intergenic
988457737 5:31402207-31402229 TGCCATGCTCGCCCACATCTTGG - Intronic
988712635 5:33793844-33793866 AGCCCTTTTCTCTCACAGCTGGG - Intronic
989002745 5:36777846-36777868 TCCCAGGTTCCCTCACAGCTAGG + Intergenic
989752731 5:44915296-44915318 TGCCAAGATCTCTAACATCAAGG - Intergenic
991602056 5:68362443-68362465 TGCCAGGCTCTCTTGCATCTGGG + Intergenic
992695075 5:79278038-79278060 TGGCAAGTTCTCTCATGTCTCGG - Exonic
994668968 5:102743659-102743681 TACCATGAACTCTCAAATCTGGG + Intergenic
996137709 5:119865276-119865298 TGCCATAGTCTATCACAGCTGGG - Intergenic
996314341 5:122144692-122144714 TGCCATATTTTCTCTCATTTAGG - Intronic
997108972 5:131053171-131053193 TGCCATTTTTGCTGACATCTAGG - Intergenic
997821511 5:137070205-137070227 TTCCATGTTCTCTGCCTTCTGGG - Intronic
999015567 5:148100531-148100553 TGCCATGCACTTTCCCATCTGGG - Exonic
999727613 5:154449435-154449457 TGCTAAGTTCTCTTACAGCTAGG + Intronic
1002603130 5:180366286-180366308 TGCCATTCGCTCTCCCATCTTGG + Intergenic
1003045598 6:2730226-2730248 TGCCCTGTTGGCTCACATCTTGG - Intronic
1003581899 6:7347639-7347661 AGCCCTGTTCTTTCACAGCTGGG + Intronic
1004193931 6:13487542-13487564 TGCCATGTTCGCTCGCCTCGCGG + Exonic
1004804962 6:19193511-19193533 TGCCATGTTTGCTGACATCATGG - Intergenic
1005704227 6:28435636-28435658 TGCCATGTTCTCTCTGATATTGG - Intronic
1005753364 6:28903978-28904000 TGCCACGTCCTGTCACAGCTGGG - Exonic
1006424721 6:33956779-33956801 TGCCATGTCACCTCACCTCTCGG - Intergenic
1006559210 6:34895121-34895143 TGCCATATTTTCTGACATTTGGG - Intronic
1007344338 6:41216907-41216929 TGCCATGTTCTCACGAATATGGG - Intergenic
1007942078 6:45790758-45790780 TCCCATGTTCTGTCTCTTCTGGG - Intergenic
1009348528 6:62646676-62646698 TGCCTTCATGTCTCACATCTTGG - Intergenic
1010550562 6:77217306-77217328 TGCCAAGATTTCTCTCATCTTGG - Intergenic
1010875234 6:81095993-81096015 TACCATGATATCTTACATCTGGG + Intergenic
1013419480 6:109952903-109952925 TGCCCTGCTTTCTTACATCTTGG - Intergenic
1014531438 6:122563879-122563901 AGCCTTCTTCTCTCACAGCTGGG - Intronic
1014738720 6:125124168-125124190 AGCCCTTTTCTCTCACAGCTGGG + Intronic
1014918133 6:127178920-127178942 TCCCATGTTTTCTCTCCTCTGGG - Intronic
1018115086 6:160574919-160574941 TGCCACGATCCCTCACCTCTTGG + Intronic
1021343278 7:19489915-19489937 TGCAATGTTCTATCATATCAAGG - Intergenic
1021405446 7:20262353-20262375 TGACATGTTCTCTGACATGGAGG + Intergenic
1022777756 7:33545122-33545144 AGCCCTTTTCTCTCACAGCTGGG - Intronic
1022825654 7:34010105-34010127 TGCCATGTCTTCTCACCTCCAGG + Intronic
1023361806 7:39424716-39424738 TGCCATGTTCTCTTTTATCTGGG - Intronic
1023727958 7:43163757-43163779 TGCCAGGAACCCTCACATCTTGG + Intronic
1025772749 7:64528388-64528410 TGCCCTTTTCTTTCACAGCTAGG + Intronic
1026883137 7:73920012-73920034 TCCCATGTGCCCTCTCATCTGGG - Intergenic
1028017439 7:85734157-85734179 TGCGATGCTCACTCTCATCTGGG + Intergenic
1030219217 7:107079616-107079638 TGCCATGGGCTCTCTTATCTAGG + Intronic
1031773475 7:125876315-125876337 TGCCAGGTTTTCTAATATCTGGG + Intergenic
1033024881 7:137762533-137762555 TTCCATGTTGTCTCACACCCAGG + Intronic
1035106639 7:156446585-156446607 TGCCATGGTCTCTGACATGGAGG + Intergenic
1035909629 8:3551058-3551080 TGCCATGAGCTCTCACAGCATGG - Intronic
1037684535 8:21127522-21127544 CACCATGTTCTCTCTCCTCTAGG - Intergenic
1038178051 8:25199248-25199270 AGAAATGTTCTCTCACATCCAGG - Intronic
1041031953 8:53745816-53745838 TGCCTTGTTCCCCCACAGCTGGG + Intronic
1042735696 8:71985353-71985375 TGCCATTTACTCTATCATCTTGG - Intronic
1044488008 8:92776048-92776070 TGTCATGTTCTATCATAACTAGG + Intergenic
1046804093 8:118461104-118461126 TGCCTTGTTCTCACAGTTCTTGG + Intronic
1047330913 8:123885937-123885959 TGTGATGTTTTCTCACTTCTGGG + Intronic
1047785017 8:128145729-128145751 TGCCATGTTCTGTGAGCTCTTGG - Intergenic
1047797526 8:128273231-128273253 TGCCAGGACCTCTCACCTCTGGG + Intergenic
1047914134 8:129563773-129563795 TGCTGTGTTCTCAAACATCTTGG - Intergenic
1050142608 9:2532266-2532288 TTCAATGTCCTTTCACATCTTGG - Intergenic
1052904884 9:33824876-33824898 TGAAATGGTCTCTCACAACTAGG - Intronic
1055212343 9:73811883-73811905 TGCCAGGTACTCTAACCTCTAGG + Intergenic
1056346216 9:85697994-85698016 TGCAAATTTCTCTCAAATCTGGG - Intronic
1056996346 9:91464269-91464291 TTCCATTTTCTCTCCTATCTTGG + Intergenic
1057743808 9:97735465-97735487 TGACAACTTCTCTCACAACTGGG + Intergenic
1058122193 9:101151559-101151581 TGCCAGGTTCTCTGACATTCTGG + Intronic
1058555437 9:106161822-106161844 TGCCATGGCCTCTCCCAGCTTGG + Intergenic
1061159562 9:128885367-128885389 TGCCATGTACTCTCTCCTCCAGG + Intronic
1187748334 X:22433405-22433427 AGCCCTTTTCTCTCACAGCTGGG + Intergenic
1189279566 X:39811721-39811743 TGCCTTCTTCTCTCCCTTCTGGG + Intergenic
1192862890 X:75097259-75097281 TACTATGCTCTCTCACAACTAGG + Intronic
1193618910 X:83726509-83726531 TGCCATTTTCTCTCACTTGTGGG - Intergenic
1193826352 X:86231665-86231687 AGCCCTTTTCTCTCACAGCTGGG - Intronic
1195019523 X:100812688-100812710 AGCCCTTTTCTCTCACAGCTGGG - Intergenic
1199566491 X:149221180-149221202 TGACATGTTCTTTCAAATCTAGG + Intergenic
1199775707 X:151009617-151009639 TCCCTTTTTCTCTCAGATCTTGG - Intergenic
1200862726 Y:8010086-8010108 TGCCATTTTGACTCACAACTAGG - Intergenic
1201579256 Y:15493956-15493978 TACCTTGTTCTCTCACTCCTGGG - Intergenic