ID: 1140442828

View in Genome Browser
Species Human (GRCh38)
Location 16:74999892-74999914
Sequence GTCGCCGGTGCCCCGGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140442828_1140442835 -6 Left 1140442828 16:74999892-74999914 CCGCCTCCCGGGGCACCGGCGAC 0: 1
1: 1
2: 0
3: 16
4: 173
Right 1140442835 16:74999909-74999931 GGCGACTCCGAGAGGGCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 110
1140442828_1140442840 4 Left 1140442828 16:74999892-74999914 CCGCCTCCCGGGGCACCGGCGAC 0: 1
1: 1
2: 0
3: 16
4: 173
Right 1140442840 16:74999919-74999941 AGAGGGCGCCCGGCGGCGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 183
1140442828_1140442836 -3 Left 1140442828 16:74999892-74999914 CCGCCTCCCGGGGCACCGGCGAC 0: 1
1: 1
2: 0
3: 16
4: 173
Right 1140442836 16:74999912-74999934 GACTCCGAGAGGGCGCCCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1140442828_1140442837 0 Left 1140442828 16:74999892-74999914 CCGCCTCCCGGGGCACCGGCGAC 0: 1
1: 1
2: 0
3: 16
4: 173
Right 1140442837 16:74999915-74999937 TCCGAGAGGGCGCCCGGCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1140442828_1140442839 3 Left 1140442828 16:74999892-74999914 CCGCCTCCCGGGGCACCGGCGAC 0: 1
1: 1
2: 0
3: 16
4: 173
Right 1140442839 16:74999918-74999940 GAGAGGGCGCCCGGCGGCGGAGG 0: 1
1: 0
2: 2
3: 44
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140442828 Original CRISPR GTCGCCGGTGCCCCGGGAGG CGG (reversed) Exonic
900117241 1:1033921-1033943 GACGCCGGGGTCCCTGGAGGCGG + Intronic
900339760 1:2182456-2182478 GTCCCCGGTGCCCCGCCAGCTGG - Intronic
900935926 1:5766396-5766418 GCAGCCGGGGACCCGGGAGGAGG - Intergenic
901844740 1:11974759-11974781 GTAGCGGGTGCCCCTGGTGGTGG - Exonic
903324735 1:22563444-22563466 GCCGCCGCCGCCCCGGGCGGGGG - Intergenic
903413721 1:23167898-23167920 GCCGGGGGTGCGCCGGGAGGCGG + Intronic
903505274 1:23829878-23829900 GTCACCTGAGCCCAGGGAGGTGG - Intronic
903788315 1:25875617-25875639 GTCGCCTGGGCCCGCGGAGGCGG - Intergenic
904682207 1:32237180-32237202 ATCACTGGAGCCCCGGGAGGTGG - Intergenic
906151770 1:43591746-43591768 GTCAGGGGTGCCCAGGGAGGAGG - Intronic
907689253 1:56645640-56645662 GGCGCCGGTGCCAGGCGAGGCGG - Intronic
908195505 1:61742775-61742797 GTCCGCGCTGACCCGGGAGGCGG + Intronic
908825964 1:68132898-68132920 GCTGCTGGAGCCCCGGGAGGTGG + Intronic
911991803 1:104707547-104707569 GTTGCCGGTGCCTGGGGAAGGGG - Intergenic
912486676 1:110034728-110034750 GCCCGCGGTGCCCCGGGTGGTGG - Exonic
915165676 1:153946576-153946598 GTCCCCGGCGCCGCGGGAGCTGG - Exonic
916214726 1:162385096-162385118 GTGGCCGGTTCCCTGGGAGAAGG + Intronic
922794540 1:228333565-228333587 GTAGCCTGGGCCACGGGAGGAGG - Exonic
924289719 1:242524708-242524730 GCCGCCGCCGCCCCGGGAGCCGG - Intergenic
924534590 1:244924048-244924070 ATCGCTGGACCCCCGGGAGGCGG - Intergenic
924801254 1:247331107-247331129 GGCGCCGGTGCTCGGGGGGGCGG - Intronic
1071537287 10:86444650-86444672 GTTGCCAGTGCCCAGGGAGGAGG + Intronic
1073196441 10:101695152-101695174 ACCGCCGCCGCCCCGGGAGGAGG + Exonic
1077147409 11:1052346-1052368 GGGGCAGGTGCCCCAGGAGGGGG - Intergenic
1079033372 11:17002067-17002089 GTCGCTGGTGCTCTGGGAAGTGG - Intronic
1080758442 11:35224649-35224671 ATCGCTTGAGCCCCGGGAGGTGG + Intronic
1083448457 11:62726808-62726830 GCCGCCGGAGCCCCCGGAGGCGG - Exonic
1083454760 11:62771379-62771401 GGGGCCGGGGCCCCGGGAGAGGG + Exonic
1083670381 11:64296881-64296903 GTGGCTGATGCCCTGGGAGGGGG + Exonic
1084000157 11:66291789-66291811 GCCGCCGGTGCCGCGGGGGCGGG + Intergenic
1089343154 11:117773228-117773250 GATGCAGGTGCCCTGGGAGGAGG - Intronic
1089782455 11:120883170-120883192 CTCCCCGGGGCCCAGGGAGGTGG - Intronic
1092899468 12:13044723-13044745 GTCGCCGCTGTCCCGAGGGGAGG + Intronic
1101302387 12:103495589-103495611 GTCGCCGGGGCAACGGGGGGCGG + Intronic
1102677262 12:114667380-114667402 GTTGCCGGGACCTCGGGAGGAGG + Intergenic
1105517600 13:21104424-21104446 GTGGCTGGTGCCCAGCGAGGCGG - Intergenic
1111396079 13:87671848-87671870 GTCGCCGCTGCGCTGGGGGGCGG + Intergenic
1111691056 13:91563870-91563892 CTCCCCGGTCCTCCGGGAGGAGG - Intronic
1112050711 13:95642063-95642085 GGCGGCGGCGGCCCGGGAGGCGG - Exonic
1113737592 13:112689786-112689808 AGCGCCTGCGCCCCGGGAGGCGG + Intergenic
1113768351 13:112894338-112894360 GTCGGCGCAGCCCTGGGAGGAGG + Intergenic
1120730240 14:87993179-87993201 GACTCCGGCGCCCAGGGAGGCGG + Exonic
1120788015 14:88554704-88554726 CGCGGCGGGGCCCCGGGAGGCGG - Exonic
1121108827 14:91298285-91298307 GTTGCCGGGAACCCGGGAGGCGG + Intronic
1122691712 14:103534826-103534848 CTCCCTGGTGCCCTGGGAGGCGG - Exonic
1124073091 15:26413876-26413898 ATCGCTTGTACCCCGGGAGGTGG + Intergenic
1125685002 15:41558912-41558934 GTCGCCGGGGCTCCGCGGGGGGG + Intronic
1132527996 16:426794-426816 GTCGACGCTGCCCCTGGAGTCGG + Intronic
1132778732 16:1611410-1611432 ATCGCCTGAGCCCCGGGAGGCGG + Intronic
1132889579 16:2197026-2197048 GGCGCCAGTGCCCCTGGAGCCGG + Intergenic
1132975501 16:2709301-2709323 GTCTCCGGTCTCCCGGGATGGGG - Intergenic
1133248011 16:4461991-4462013 TCCTCCAGTGCCCCGGGAGGTGG + Intronic
1133339087 16:5025291-5025313 GTTGCAGGTGCCCTGGCAGGTGG + Exonic
1134039989 16:11060967-11060989 GTTGCCGCTGACTCGGGAGGAGG + Exonic
1136414745 16:30096230-30096252 GCCGCCGCTGCGGCGGGAGGGGG + Intronic
1136540053 16:30923948-30923970 ACCGCCGGTTCCCGGGGAGGGGG - Intronic
1139432120 16:66916408-66916430 GTTGCCGCTGCCCCGTGAGGGGG - Exonic
1140442828 16:74999892-74999914 GTCGCCGGTGCCCCGGGAGGCGG - Exonic
1141054587 16:80803939-80803961 GGCGCGGGCGCCGCGGGAGGCGG + Intronic
1142586612 17:978740-978762 GTCCCCGGTCCCCGGGGAAGGGG + Intronic
1143199245 17:5100683-5100705 GACAGCGGTGCCCTGGGAGGAGG - Intergenic
1143625979 17:8110354-8110376 GGCGCCGCCGCCCCGGGATGGGG - Intronic
1144565075 17:16353217-16353239 GTCGCCGCGGGCCCAGGAGGAGG - Exonic
1144771371 17:17761495-17761517 GTGGCCAGTGCCCCGGGGGATGG + Intronic
1145214854 17:21043368-21043390 GCCGCCAGGGTCCCGGGAGGCGG - Intronic
1146910803 17:36647262-36647284 GTCCCCGCTGCCCCTGAAGGTGG + Intergenic
1147211447 17:38874698-38874720 GTCGCCTGTCCCCCTGCAGGGGG - Intronic
1147285737 17:39401569-39401591 GCCGCCGGCGCCGCGGGAGGTGG - Exonic
1148113811 17:45162832-45162854 GTCACCAGTGGCCCTGGAGGAGG + Exonic
1148698565 17:49575440-49575462 GGCGCCCGTTCCCCGGGAGCGGG - Intergenic
1150147464 17:62780989-62781011 CTCGCCGGTGCCTGGGAAGGAGG + Intronic
1152162355 17:78676736-78676758 GTCTCCGGTGCACAGGGAGGGGG + Intronic
1152355355 17:79804192-79804214 CTAGCCGTTGCCCCGGGAGGAGG + Intergenic
1152406654 17:80101724-80101746 GTCGCCGGGGCCGCGGGTGGAGG + Intergenic
1152751856 17:82065877-82065899 GTCGCCGGTCCCCTCGGAGCCGG - Intronic
1152866621 17:82727488-82727510 GTATCCGGTGCGCAGGGAGGTGG + Exonic
1158411287 18:57208320-57208342 GTCGCCTGAGCCCCAGGCGGTGG - Intergenic
1158435814 18:57435268-57435290 GCCGCAGCTGCCCCGGGAGGCGG - Intergenic
1160865141 19:1252996-1253018 GACGCAGGCGCCCAGGGAGGAGG - Intronic
1161166492 19:2790662-2790684 GCCGCAGGTGCCGAGGGAGGTGG + Intronic
1161583409 19:5092693-5092715 CTCGCCAGTGCCCCTCGAGGGGG - Intronic
1162131060 19:8526523-8526545 GTCGCCGAAGCCGCGGGAGAAGG + Exonic
1162201854 19:9026113-9026135 ATCGCTTGAGCCCCGGGAGGCGG + Intergenic
1162861175 19:13506511-13506533 GGCGCGGGGGCCCGGGGAGGAGG + Intronic
1166331346 19:42079737-42079759 CTCGCCGGTGGGCCAGGAGGAGG - Exonic
1166361415 19:42254283-42254305 GCCACCGGTGGCGCGGGAGGAGG + Intronic
1166674486 19:44731639-44731661 ATCACCTGAGCCCCGGGAGGTGG + Intergenic
1167648914 19:50719345-50719367 GGGGCCGGGGCCGCGGGAGGGGG - Intronic
1167756512 19:51416512-51416534 GCCGCCGCAGCCCTGGGAGGGGG - Intronic
925058880 2:875943-875965 GTGGCCGGTTCTGCGGGAGGCGG + Intergenic
927809373 2:26173122-26173144 GCCGCGGCGGCCCCGGGAGGTGG + Exonic
928094169 2:28393752-28393774 GCCGCTGCTGCCCCGGGACGAGG - Exonic
929075728 2:38077252-38077274 GCCGCCGGTGCGCAGCGAGGTGG - Intronic
930011476 2:46941199-46941221 GGCGCCGGGGCCCGGGGCGGAGG + Exonic
931711016 2:64989205-64989227 GTCGCGGGTGCCGCAGGGGGCGG - Intronic
937477067 2:122225310-122225332 GTGGTGCGTGCCCCGGGAGGTGG - Intergenic
938000473 2:127731206-127731228 ATCGCCTGAGCCCAGGGAGGCGG + Intronic
941158761 2:162011093-162011115 GTCGCTGAAGCCCCGAGAGGTGG - Intronic
945465991 2:210171241-210171263 GTCAGCGGCGCCCCGGGTGGGGG - Exonic
946235584 2:218322965-218322987 GTCGCCTGAGCCCTGGGAAGGGG - Intronic
946692338 2:222319236-222319258 GTGGCCGGTGCCTCGCCAGGGGG + Intergenic
947702527 2:232246419-232246441 GTTGCCAGTGCCCCGGGAGAGGG + Intronic
948158230 2:235801712-235801734 GCGGCCTGTGCCCCGGGAGGAGG + Intronic
949014527 2:241702010-241702032 GCGGGCGGTGCCGCGGGAGGCGG - Intergenic
1172109305 20:32536191-32536213 GGCTGCGGTGCCCCGGGAGGCGG - Intronic
1173164566 20:40677940-40677962 GTCAGCAGTGCCCAGGGAGGGGG + Intergenic
1174386521 20:50191010-50191032 AACGCGGGTGCCCGGGGAGGGGG - Exonic
1175074054 20:56358960-56358982 CGCGCCGCTGACCCGGGAGGCGG - Exonic
1175286477 20:57840187-57840209 GTAGCTGGTGCCTCCGGAGGCGG - Intergenic
1175784928 20:61706355-61706377 GTTGTCGGTGCCTCGGGTGGTGG - Intronic
1179750300 21:43463607-43463629 GTCGCCCCTACCCCAGGAGGGGG - Intergenic
1180005705 21:45019422-45019444 GGCGCCGGTGCCTGGGCAGGTGG + Intergenic
1180037170 21:45255982-45256004 GTGGCAGGTGCCTCAGGAGGTGG + Intergenic
1180099973 21:45579539-45579561 GATGCCGGTGCCCTGGGATGGGG + Intergenic
1180100110 21:45579894-45579916 GACGCGGGTGCCCCGGGATGCGG + Intergenic
1180875238 22:19172029-19172051 GTCTCCCGGGCCCCGAGAGGAGG + Intergenic
1182521756 22:30888640-30888662 GTCGCTTGAGCCCAGGGAGGTGG + Intronic
1184766965 22:46577168-46577190 GGCGCCGGGGAGCCGGGAGGAGG - Intronic
1185032601 22:48452389-48452411 ATAGACGGTGCCCTGGGAGGGGG - Intergenic
954388799 3:50258358-50258380 GTCGGCGGTGGCCCTGGAGGTGG - Exonic
956322089 3:68008130-68008152 GGCGCTGGTGCCCCTGCAGGTGG + Intronic
959085820 3:101849753-101849775 GTCGCAGGCGCCCGGGGCGGCGG - Exonic
961905978 3:130263834-130263856 CACGCCGGGGCCCCAGGAGGTGG + Intergenic
965360555 3:167734516-167734538 GCCCCTGGTGCCCCGGGAGAGGG - Intronic
965520281 3:169663217-169663239 TGCGCCGGGGCCCCGGGTGGAGG - Intronic
968079199 3:195834922-195834944 GGTGCTGGGGCCCCGGGAGGAGG + Intergenic
968286132 3:197509972-197509994 GTCCCAGCTGCCCCAGGAGGAGG - Exonic
968356697 3:198113726-198113748 GTCGCCCGTTCCTCGGGAGTCGG - Intergenic
968596887 4:1490323-1490345 GGGGCCGGGGCTCCGGGAGGCGG - Intergenic
968745162 4:2356202-2356224 GTCGCTGGAGCCCAGGCAGGGGG - Intronic
968870753 4:3240930-3240952 GTCGTCTGTGCCCGAGGAGGAGG - Exonic
968975463 4:3820102-3820124 GTAGCAGGTGCCCGGGGAGAGGG - Intergenic
971351818 4:25862623-25862645 GTCCCCGGGGCCCCGCGCGGAGG + Intronic
972533132 4:39977841-39977863 GCCGTCCGTGCCCCGGGAGCCGG + Exonic
984111770 4:175625935-175625957 GTCCCAGCTGCTCCGGGAGGTGG + Intergenic
985064243 4:186105306-186105328 GGCGGCGGAGCCCCGGGAGTAGG - Intronic
985489282 5:169818-169840 GTCCCTGCTGCCCCTGGAGGCGG + Intronic
985574230 5:666120-666142 GTCGCCTGTGCCCCTGTAGAGGG - Exonic
989643267 5:43603432-43603454 GTCGGCGGTGTCCCGGGCGCAGG + Intronic
999288249 5:150406989-150407011 GGCCCCGGTGCCCAGGGAGGAGG + Intronic
999341671 5:150778706-150778728 GTTGCCGGGGCCCCGGGACCGGG + Exonic
999353055 5:150895615-150895637 TTCGCTGGTGTCCCGGAAGGTGG + Exonic
1002297927 5:178241642-178241664 ATCAGCGGTGCCCTGGGAGGGGG - Intronic
1002446166 5:179291328-179291350 GTCACTGGTGCCCAGGGCGGTGG + Intronic
1002491626 5:179582309-179582331 ATCACCGGAGCCCAGGGAGGTGG - Intronic
1002785010 6:393506-393528 GTCGCCGGAGCCGCAGGAGGAGG + Intronic
1002991765 6:2245375-2245397 GTCCCCGGAGCCCCGGGCGCTGG + Exonic
1003175845 6:3751807-3751829 GGCGCCCGTTCCGCGGGAGGCGG - Exonic
1006589136 6:35141351-35141373 GTCGCCGGGGCAACGGGACGGGG + Exonic
1010044035 6:71420303-71420325 GGCGCCCCTACCCCGGGAGGGGG + Intergenic
1010200111 6:73274942-73274964 TTAGCGGGTGCCCCTGGAGGAGG + Intronic
1019505034 7:1386422-1386444 CCCGTCGGTGCCCAGGGAGGTGG - Intergenic
1019812542 7:3175202-3175224 GAGGCAGGGGCCCCGGGAGGTGG - Intergenic
1023267476 7:38422706-38422728 ATCGCCTGAGCCCAGGGAGGTGG - Intronic
1023606556 7:41936649-41936671 GCAGCCTGTGCCCAGGGAGGGGG - Intergenic
1026558554 7:71428922-71428944 GTGGCCGGTGTCCCTGGAAGTGG - Intronic
1026904713 7:74056405-74056427 GTCGGAGGTGTCCCGGGAGTTGG + Exonic
1026909583 7:74084214-74084236 CTCGCCGGGGGCCGGGGAGGGGG - Intronic
1029720878 7:102363776-102363798 GTGGTGGGTGTCCCGGGAGGCGG + Intergenic
1032344379 7:131106019-131106041 GCCGGCGGTGCCCGGGGCGGTGG - Intergenic
1033253179 7:139777776-139777798 GTGGCCGGCGCCGGGGGAGGGGG + Intronic
1034274141 7:149816725-149816747 GTCCCTGGTTCCCCGGGATGGGG + Intergenic
1034393176 7:150801257-150801279 GACGCCAGGGCCCTGGGAGGAGG + Exonic
1034488729 7:151381767-151381789 GTCACCGGTGACGCGGTAGGCGG + Intronic
1040598874 8:48865147-48865169 CTCGCCTGTGCTCCGGGATGGGG + Intergenic
1041580742 8:59456974-59456996 GTCGGCGGGGGCCAGGGAGGAGG - Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1047961839 8:130016689-130016711 GACGCCGGGGCCCCGCGATGCGG - Intronic
1049651490 8:143771809-143771831 GGCTCCGGTGCGCCGGGAGCAGG + Intergenic
1049782635 8:144435868-144435890 GTCTCCAGTGCCCCGGGGGCGGG + Exonic
1051171569 9:14322707-14322729 GGCGCCCGGGACCCGGGAGGCGG + Intronic
1054781995 9:69174201-69174223 GCCGCCGCCGCCGCGGGAGGAGG + Intronic
1056992301 9:91423601-91423623 GTCGCCGGGCCCCCGGCCGGCGG + Intronic
1057547282 9:96027664-96027686 GCCGTCGGCGCCCCGGGAGAAGG - Intergenic
1058023727 9:100117620-100117642 AACGCCGGTGCAGCGGGAGGTGG - Intronic
1059769930 9:117415134-117415156 GGCGGCTGGGCCCCGGGAGGCGG - Intergenic
1060735080 9:126061632-126061654 GTCGGAGCTGCCCCTGGAGGAGG - Intergenic
1060963677 9:127699478-127699500 GTCGCCTCTGGCCCTGGAGGCGG + Intronic
1061084952 9:128393204-128393226 GGCGGCGGTGGCCCGGGCGGCGG + Intergenic
1062574723 9:137200794-137200816 ATGGTCGGTGGCCCGGGAGGGGG - Exonic
1203792673 EBV:160092-160114 CTCGACAGTGCCCCCGGAGGTGG - Intergenic
1185505455 X:630089-630111 GGCGCTGGAGACCCGGGAGGCGG + Intronic
1187181323 X:16946487-16946509 GGCTCCGGTGCCCAGGAAGGCGG - Intergenic
1188615260 X:32150411-32150433 GTTGCCGGTGCCGCTGGTGGTGG + Intronic
1189320300 X:40083507-40083529 GACCCCGACGCCCCGGGAGGAGG - Intronic
1195168905 X:102247003-102247025 GTCCCCCGAGCCCCAGGAGGGGG + Intergenic
1195189952 X:102440083-102440105 GTCCCCCGAGCCCCAGGAGGGGG - Intronic
1195310658 X:103629210-103629232 CTCCCCCGTCCCCCGGGAGGGGG + Intronic
1196734964 X:118975143-118975165 GGCGCCGGCGCCCCCGGACGAGG + Exonic
1198480208 X:137033874-137033896 GCCGCCCGAGCCCCGAGAGGCGG - Intergenic
1200083664 X:153592254-153592276 GTCGCCGGTGTCCCGGGAGGAGG - Intronic