ID: 1140446947

View in Genome Browser
Species Human (GRCh38)
Location 16:75037121-75037143
Sequence AAAGCTTCAAAAGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140446947_1140446948 -6 Left 1140446947 16:75037121-75037143 CCAGCAGCATCTTTTGAAGCTTT 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1140446948 16:75037138-75037160 AGCTTTCATGATGAGCAGAATGG 0: 1
1: 0
2: 2
3: 21
4: 147
1140446947_1140446949 25 Left 1140446947 16:75037121-75037143 CCAGCAGCATCTTTTGAAGCTTT 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1140446949 16:75037169-75037191 GTTGAGATCTGTATTCATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140446947 Original CRISPR AAAGCTTCAAAAGATGCTGC TGG (reversed) Intronic
900241383 1:1619071-1619093 AGAGCCTCAAAAGCTGCTGGCGG + Intronic
904981087 1:34502428-34502450 AAAGCCAAAAAAGATTCTGCTGG + Intergenic
907323037 1:53617714-53617736 AAATTTTTAAAAGATGGTGCAGG + Intronic
910902210 1:92133471-92133493 ACAGTTCCAAAAGAAGCTGCTGG - Intronic
911601523 1:99853048-99853070 CAAGCTTAAAAAGAGACTGCAGG - Intronic
913347852 1:117825944-117825966 AAATCATTAAATGATGCTGCCGG + Intergenic
917922840 1:179765361-179765383 TAAGCTCCCAAAGATACTGCCGG + Intronic
918576843 1:186071303-186071325 AAAGCTAAAAAAGATGATGAAGG + Intronic
919659787 1:200233217-200233239 AAAGCTTAATAAGATGATACAGG - Intergenic
920597648 1:207288961-207288983 AGAGGTGCAAAAGATGCTGTAGG - Intergenic
923954793 1:239004307-239004329 AATGATTCAAAAGAAGCTGCTGG + Intergenic
1062799399 10:368322-368344 AAATCTTCAAAAGGTTCTGAAGG - Intronic
1064076521 10:12273304-12273326 AAAGCTTAAAAAGATGGGTCAGG + Intergenic
1066628237 10:37431743-37431765 AAACCTTCAATAAATGCTGCAGG - Intergenic
1067070287 10:43126116-43126138 AAAGCTGGAAAACATCCTGCAGG + Intronic
1069408127 10:68123863-68123885 AAAGTTTAAAAAAATACTGCAGG - Intronic
1069595583 10:69667863-69667885 AAAGCCTCTAAAAAAGCTGCTGG + Intergenic
1070269086 10:74934487-74934509 AAAGATTTAAAGGATGCAGCCGG - Intronic
1071092923 10:81941050-81941072 AAAGTTTAAAATGATACTGCAGG + Intronic
1073533752 10:104255557-104255579 AAAGCTAAAAGAGCTGCTGCCGG - Intronic
1074136299 10:110629858-110629880 ACAGGTGCAAAAGAAGCTGCTGG + Intergenic
1075245508 10:120818697-120818719 AAAGCTTCAAAGGAGGGTGCAGG + Intergenic
1079368765 11:19832234-19832256 AAAGCTTCAAAACATGCAGAGGG - Intronic
1079659250 11:23019188-23019210 GAAGCTTCAAAAGCTGTTACTGG - Intergenic
1083171593 11:60926700-60926722 CAAGCTTGGAAAGATGGTGCAGG + Intronic
1083783889 11:64932991-64933013 AAAGCATCAAAAGATGGCCCAGG + Intronic
1085052816 11:73388540-73388562 AAAGCTTCTAGAGAAGCTTCTGG + Intronic
1085755757 11:79200056-79200078 GATGCTTCTAGAGATGCTGCAGG - Intronic
1085841455 11:80016072-80016094 AAAGCATAAAAAGAGGATGCCGG - Intergenic
1086864797 11:91967641-91967663 AATTCTTCAAAGAATGCTGCAGG - Intergenic
1087127082 11:94639093-94639115 AAAGGTTTATGAGATGCTGCAGG + Intergenic
1087150739 11:94857290-94857312 AAAACTTCAAATGATTCTGAAGG - Intronic
1087164573 11:94988777-94988799 GAAGCTTCTAAGGATGCTTCTGG + Intronic
1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG + Intergenic
1088470211 11:110182071-110182093 AAAGCTGCTAAAGCAGCTGCTGG - Intronic
1088544521 11:110946178-110946200 AAAGCTTGAGAAAGTGCTGCTGG - Intergenic
1089041704 11:115457423-115457445 AGAACTCCAAAAGATGTTGCTGG + Intronic
1090774470 11:129950990-129951012 CCAGCCTCTAAAGATGCTGCTGG - Intronic
1091251365 11:134146865-134146887 AAGGATTCAAAAAATGCTCCTGG - Intronic
1091506810 12:1078367-1078389 TAATCTTTAAAAGATGATGCTGG + Intronic
1094542747 12:31376127-31376149 AAAGCTTCAAAACATGAAGAAGG - Intergenic
1097182349 12:57178640-57178662 ACAGCTTCTAAAGAGGCTGCTGG - Intronic
1099348678 12:81537211-81537233 AAAGTTTAAAAAAATTCTGCTGG + Intronic
1100860503 12:98800445-98800467 AAATGTTCAAAAGATACTGTAGG - Intronic
1102648504 12:114419645-114419667 AAAGCCAAAAAACATGCTGCGGG - Intergenic
1105058845 12:133129868-133129890 AGAGATTCAAGAGAGGCTGCTGG + Intronic
1108240922 13:48462823-48462845 AACTCTTCAAAAAATGGTGCTGG - Intronic
1109038483 13:57298334-57298356 AAATATTCATAAGATACTGCTGG - Intergenic
1110636168 13:77768965-77768987 AAATTCTCAAAAGATGCTGCTGG - Intergenic
1111171027 13:84527068-84527090 AAAGCTTCTGAAAATGGTGCTGG + Intergenic
1114788890 14:25633382-25633404 AAACCTTCTAAAGGTGCTTCAGG + Intergenic
1116790495 14:49335100-49335122 AAAGCTTCAGAAGAGGTTTCAGG - Intergenic
1116841811 14:49826385-49826407 AGTGCTTCTAAAGATGCTACAGG + Intronic
1118873009 14:69759051-69759073 GAAGCTTCAACAGAAGCTCCTGG + Intronic
1123758535 15:23415569-23415591 AAAGCTTCAGAAGAAACTCCGGG + Intergenic
1124403041 15:29367099-29367121 AATGCTTCCAAGGTTGCTGCAGG - Intronic
1127491130 15:59465047-59465069 AAATCTTCAATAAATGGTGCTGG - Intronic
1129624301 15:77180593-77180615 AAAGCCTCTACAGATGTTGCTGG - Exonic
1130554539 15:84913583-84913605 AAATTCTCAAAGGATGCTGCTGG + Intronic
1131927248 15:97399173-97399195 AAAGCTTTAAAAGATTGTGGGGG + Intergenic
1133128679 16:3663113-3663135 AAAACCTCAAAGGATGCTTCAGG + Exonic
1133993084 16:10726042-10726064 ATAACTTCAGAAGAAGCTGCAGG + Intergenic
1135323965 16:21514141-21514163 ACAGGTTCAGAAGATGCTGTGGG - Intergenic
1136335448 16:29607409-29607431 ACAGGTTCAGAAGATGCTGTGGG - Intergenic
1138203347 16:55106227-55106249 AAACCAGCAAAAGCTGCTGCGGG + Intergenic
1138723044 16:59104249-59104271 AAAGCTTTAAAAGAAGCTCTAGG - Intergenic
1140158643 16:72460568-72460590 CAAGCTTCAAAAGATGCCCCTGG - Intergenic
1140446947 16:75037121-75037143 AAAGCTTCAAAAGATGCTGCTGG - Intronic
1140454964 16:75099654-75099676 AGAGGTTCAACAAATGCTGCCGG - Intronic
1141443572 16:84044423-84044445 AAAGCTTGGGAAGATGATGCTGG - Intergenic
1142036174 16:87863250-87863272 ACAGGTTCAGAAGATGCTGTGGG - Intronic
1143029905 17:3962113-3962135 AAAGCTGAAAAAGCTGCTGCCGG + Intronic
1144377980 17:14664630-14664652 AAAGCTTCCTAAGATGTTGAGGG + Intergenic
1144485680 17:15662302-15662324 AAAGCTTAAAAAGCTACTGTGGG + Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149116960 17:53109114-53109136 AAAGCTTCAAGAGATTCCCCAGG - Intergenic
1152317870 17:79591260-79591282 AAGGCTTCAGAAGTTACTGCTGG + Intergenic
1155241905 18:23871875-23871897 AGAGATTCAATAGATGCTGAGGG + Intronic
1158484214 18:57850480-57850502 AAAGCTGAAGAAGATGCTGAAGG + Intergenic
1161331894 19:3692507-3692529 CAACCTTCAAAAGGTCCTGCTGG + Intronic
1161918542 19:7249059-7249081 ATGGCTTCAAAAGATACTGGGGG - Intronic
1163192485 19:15687584-15687606 AACCCTTCAAAAGAAGCTACAGG + Intronic
1163200834 19:15767749-15767771 GACCCTTCAAAAGAAGCTGCAGG - Intergenic
1165156972 19:33795104-33795126 ATAGCTTACAAAGATGCCGCAGG - Intergenic
1165590277 19:36963427-36963449 AAAGCCTCAACAGCTGCTCCTGG + Intronic
1165975574 19:39673441-39673463 CAAGCTTGCAAAGCTGCTGCTGG - Intergenic
1166898690 19:46041137-46041159 AAAGCTTAATGAGATGCTTCTGG + Intronic
1167123721 19:47534836-47534858 AAGTCTTCAAAAAATGCTGCTGG + Intronic
1168186149 19:54700876-54700898 GAAGCTTCCCAAGATGCAGCCGG + Intronic
1168303021 19:55417585-55417607 AAAGATTCAAATGAAGCGGCCGG + Intergenic
1168351817 19:55680375-55680397 CAAGAATCAAGAGATGCTGCAGG - Intronic
925032525 2:661731-661753 TGAGCCTCACAAGATGCTGCAGG - Intergenic
925579860 2:5399313-5399335 CAAGCTTCCAGCGATGCTGCTGG - Intergenic
929703939 2:44190511-44190533 AAAGCTTCAAAAAGTGATACAGG - Intronic
931461048 2:62450455-62450477 AAGGCTTCAAAAGGTGGTGAAGG + Intergenic
933821528 2:86116578-86116600 ACAGATTCCAAAGATGATGCTGG - Exonic
934166015 2:89294912-89294934 AAAGCTTAAAAAGAGTCTGAGGG + Intergenic
934201262 2:89887544-89887566 AAAGCTTAAAAAGAGTCTGAGGG - Intergenic
935188015 2:100751678-100751700 GCAGCTTCTTAAGATGCTGCAGG + Intergenic
936696103 2:114950198-114950220 AAAGCTTCTAAAGATGATAAAGG - Intronic
938254045 2:129840218-129840240 CAAGTTTCAAAAGATGTTTCTGG - Intergenic
939067330 2:137499325-137499347 AAAGTTTCACAAAATTCTGCAGG - Intronic
939341735 2:140905056-140905078 AAAGTTTTAAAAGAAGTTGCAGG - Intronic
940734026 2:157428841-157428863 AAAACTTCAAAGGATGCTTTGGG - Intronic
941236813 2:162985429-162985451 AGGACTTCAAGAGATGCTGCTGG - Intergenic
941530411 2:166662978-166663000 GTCTCTTCAAAAGATGCTGCTGG - Intergenic
941583985 2:167333659-167333681 AAAGCATCTCAAGATGCTGCTGG + Intergenic
942308064 2:174628112-174628134 AAAAATTCACAAGAGGCTGCTGG + Intronic
946553431 2:220828315-220828337 TAAGCTTTATAATATGCTGCTGG - Intergenic
946799509 2:223397719-223397741 AAAGCTTAAAATGGAGCTGCAGG - Intergenic
1171123964 20:22586116-22586138 TCAGCAGCAAAAGATGCTGCCGG - Intergenic
1172260502 20:33560294-33560316 AATGAATCCAAAGATGCTGCTGG - Intronic
1172308433 20:33898538-33898560 AGAACTTCCAAAGAAGCTGCAGG - Intergenic
1172858077 20:38023740-38023762 AAAACTTCAGAATATGCTGAAGG - Intronic
1174317062 20:49712038-49712060 AAATGATCAGAAGATGCTGCTGG - Intronic
1175441218 20:58993484-58993506 AAAGCTTAACAAGCAGCTGCAGG - Exonic
1176384548 21:6132290-6132312 AAAGCTTCAAAATATGCAGCTGG - Intergenic
1177341335 21:19804922-19804944 ACAGCTTTAAAAAATGCGGCTGG - Intergenic
1177984566 21:27958117-27958139 AAAGACTCAACAAATGCTGCAGG + Intergenic
1179738924 21:43405962-43405984 AAAGCTTCAAAATATGCAGCTGG + Intergenic
1182632076 22:31694368-31694390 AAATGTTTAAAAGTTGCTGCTGG - Intronic
1184031729 22:41899092-41899114 AAAGCTTCTGAAGATGCTGGGGG - Intronic
949253912 3:2021563-2021585 ACAGCTTCAGCAGATGCTTCTGG + Intergenic
950687308 3:14627795-14627817 AAAGGGTGAAAACATGCTGCTGG + Intergenic
951646512 3:24897806-24897828 AAAACTTTAAAAGAAACTGCCGG + Intergenic
951679784 3:25282802-25282824 AAAGCTTCCAAAGATGTGGGTGG - Intronic
954404686 3:50338853-50338875 CAAGCTTCAAATGATGCTGAGGG - Intronic
954966458 3:54615878-54615900 TAAGAATCAAATGATGCTGCTGG - Intronic
956522688 3:70123184-70123206 AAAGATTCTACTGATGCTGCTGG + Intergenic
956548416 3:70433879-70433901 AGAGCTTCAACAAATGGTGCTGG - Intergenic
956902168 3:73728230-73728252 AAAGCTTCAAAATATCTTGGGGG + Intergenic
958790522 3:98645723-98645745 GATCCTTCAAAAGAAGCTGCAGG - Intergenic
959681708 3:109104071-109104093 ACAGCTTCACAAGAAACTGCAGG + Intronic
959921109 3:111869363-111869385 AAAGACTCAAAGGATGCTACAGG - Intronic
961857954 3:129892258-129892280 AAAGATTAAAAAGCTGCTTCTGG - Intronic
962094677 3:132280986-132281008 AAAGGTTTAAAAAAGGCTGCCGG - Intronic
962278747 3:134034641-134034663 GAAGCTTCATCAGCTGCTGCAGG - Intronic
963062609 3:141236617-141236639 AAAGCTCAAAATGATACTGCTGG - Intronic
963540044 3:146574325-146574347 AAAGCTTCCAAAGATGTGTCAGG - Intergenic
963992249 3:151668147-151668169 AAAGCTTCAAAAGCAGGTCCTGG - Intergenic
965372719 3:167884454-167884476 AAAGCATCAAAAGCTGCAGGAGG - Intergenic
965731025 3:171772960-171772982 AGAGCTTCAAAAAATACTCCTGG + Intronic
965752809 3:171994138-171994160 AAAAGTTCAAGAAATGCTGCTGG + Intergenic
966298760 3:178455055-178455077 GAAGCTTCCAAATATGCTGGCGG - Intronic
966721682 3:183069294-183069316 ACATATTCAAAAAATGCTGCAGG + Intronic
967401847 3:189071763-189071785 TGAGCTTCAAAAGATGATGTAGG + Intronic
971755864 4:30707520-30707542 AACTCTTCAATAGATGCTGCTGG - Intergenic
972091803 4:35295966-35295988 AAAGTATCAAAAGATGCTTTGGG - Intergenic
972550401 4:40127513-40127535 AAAGCTGAAAAAGATGCAGCTGG - Intronic
973566742 4:52196364-52196386 AAAGCTTCAAAGTGTGATGCAGG - Intergenic
974900938 4:67997382-67997404 AAGGCTTCAAAAGTAGCTTCTGG + Intergenic
979366155 4:119826028-119826050 AAATCTACAAATAATGCTGCTGG - Intergenic
980330063 4:131399980-131400002 AAAGCTTTATAATGTGCTGCTGG + Intergenic
981812789 4:148794594-148794616 AAAGTTCCGAAAGATGGTGCAGG + Intergenic
982423785 4:155232233-155232255 ACAGATTCAAGAGATGCTCCAGG + Intergenic
982560400 4:156922713-156922735 AAATCTTCATGAGATGCTGTTGG + Intronic
982569912 4:157035738-157035760 AAGGCTGCAAAATATGTTGCAGG + Intergenic
983976906 4:173945618-173945640 ATAGCTTCAAAAGATTCTCTTGG - Intergenic
986838137 5:11665044-11665066 TGAGCATCAAAAGATGCTGATGG + Intronic
987731460 5:21778488-21778510 AAAACTTCAGACGATTCTGCCGG + Intronic
987733007 5:21801457-21801479 AAAGTCTCAAAACATACTGCTGG + Intronic
989395347 5:40949993-40950015 AACGCTTTAAAAGCTGCTTCAGG + Exonic
990577796 5:57139892-57139914 AAATCTTCAATAAATGGTGCTGG - Intergenic
991445184 5:66692060-66692082 GTAGCTGCAAAAGATGCTACAGG + Intronic
992040769 5:72828704-72828726 AATGCTACAAAAGATGTTACTGG - Intronic
992431186 5:76713507-76713529 AAAGCTTAAAAGGATGCTTTGGG - Intergenic
992944713 5:81798738-81798760 AGAGCAGCAAAAGATGTTGCTGG + Intergenic
995132943 5:108649317-108649339 AGAGCTTCAAGAGATACTGATGG + Intergenic
996905979 5:128600637-128600659 AAAGCTTCATAAGATGTAGAAGG - Intronic
997079932 5:130726160-130726182 AAATCTACTAAGGATGCTGCTGG + Intergenic
997681553 5:135759767-135759789 AGAACTTCAGAAGAAGCTGCGGG + Intergenic
998858974 5:146424549-146424571 AAAGCTTCAAAGGGTGGTACTGG + Intergenic
999393568 5:151212159-151212181 AAAGCTGCAGAGGAGGCTGCCGG + Intronic
999638396 5:153646361-153646383 AAAGCATAAAAAGGTGCTACAGG - Intronic
1000563867 5:162823846-162823868 AGAGGTTCAAAAGATGCTTCTGG - Intergenic
1000818079 5:165948677-165948699 AAAGCTTCTAATGATTTTGCTGG + Intergenic
1000928017 5:167217255-167217277 AAAACTCCAAAGGATTCTGCTGG - Intergenic
1001098674 5:168796266-168796288 AAAGCAACAAGAGACGCTGCAGG + Intronic
1001834677 5:174821962-174821984 ACAGGTTCAAAAGGTGTTGCAGG - Intergenic
1002597365 5:180332909-180332931 AAGATTTCAAAAGATGCTGTGGG - Intronic
1003350325 6:5311285-5311307 ATAGATTAAATAGATGCTGCAGG + Intronic
1003417427 6:5924102-5924124 AAAACCTCAAAACATACTGCTGG - Intergenic
1004996549 6:21199132-21199154 AGAGCTTGAGAAGATGCTGAAGG + Intronic
1006236495 6:32637893-32637915 AAAGCTTCAAAAGTTGTTCAGGG - Intronic
1007753587 6:44084462-44084484 AAAGCCTCAAAAGAGGCCCCAGG - Intergenic
1008599083 6:53072099-53072121 AATGCTGCTAAAGATTCTGCAGG + Intronic
1009859738 6:69311900-69311922 AAAGCTGCAAAAGAGGATGTAGG - Intronic
1011404604 6:87005495-87005517 ATATCTTCAATAAATGCTGCCGG + Intronic
1012811414 6:103964143-103964165 AAAGCTTCAAAAGACAGTGGAGG + Intergenic
1013319112 6:108969337-108969359 GAAGCTTTTATAGATGCTGCAGG + Intronic
1016068123 6:139705026-139705048 ACTGCTTCAAAATATGGTGCTGG - Intergenic
1016279999 6:142405370-142405392 AAAACCTCAAAATCTGCTGCTGG + Intronic
1017449401 6:154540374-154540396 AAAACTTCACAAGCTTCTGCAGG - Intergenic
1018329039 6:162708122-162708144 ATAGCTTTAAAATATGCTGTTGG - Intronic
1018769733 6:166959901-166959923 TGAGGTTTAAAAGATGCTGCTGG + Intergenic
1019759379 7:2798625-2798647 ATATCTACAAAAGATCCTGCTGG - Intronic
1021951902 7:25783166-25783188 AAACCTTCAAAATATGTGGCTGG - Intergenic
1022263075 7:28725981-28726003 AATGCTTCCAAAGGTGGTGCAGG + Intronic
1022805488 7:33817122-33817144 ATAGCTACAAAGGATGCTACTGG - Intergenic
1024618507 7:51136501-51136523 AAAACTGGAGAAGATGCTGCAGG + Intronic
1025025558 7:55513615-55513637 AAGACCTCTAAAGATGCTGCAGG + Intronic
1026065147 7:67064798-67064820 AAATTTTCAACAAATGCTGCTGG + Intronic
1031814523 7:126416787-126416809 ACAGCTTCTAAAAATGCTCCAGG - Intergenic
1037615337 8:20514152-20514174 TGGGCTTCAAAAGATGCTGGTGG + Intergenic
1039368441 8:36958981-36959003 AAAGTTACAATAGCTGCTGCTGG - Intergenic
1039985332 8:42442715-42442737 AAATCTACAAAATATCCTGCTGG + Intronic
1040572809 8:48624968-48624990 ACAGTTTCAAAAGATCCTCCGGG - Intergenic
1041480961 8:58319299-58319321 AGATCTTTAAAAGATGCTGCTGG - Intergenic
1041552047 8:59113852-59113874 GAAACTTCAAAAGACCCTGCGGG - Intronic
1041709816 8:60884176-60884198 AAAGCTTAAAAAAATGTTCCCGG - Intergenic
1042005123 8:64171169-64171191 AAATCATTAAAAGATGCTGGAGG + Intergenic
1046055498 8:109073459-109073481 ATTGTTTCAAAAGATGATGCTGG + Intergenic
1046610737 8:116422066-116422088 AAAGGTTAAAAAAATCCTGCTGG - Intergenic
1047091872 8:121584004-121584026 AAGGACTCAAAAGATTCTGCCGG + Intergenic
1048366481 8:133743077-133743099 TCAGCTTCAAAAGATGCTTAAGG - Intergenic
1048975513 8:139670862-139670884 AGAGCTGCAGAAGATGCTGCTGG - Intronic
1049331126 8:142053905-142053927 AAAGCTTGATTAGATCCTGCTGG + Intergenic
1050689994 9:8216020-8216042 GAATCTTCAAATGATGCTGGTGG + Intergenic
1051325967 9:15968837-15968859 AAAGCTTAAAAAGAAGCCACCGG - Intronic
1051722721 9:20054994-20055016 AATGCTTCAAAATGTGGTGCAGG - Intergenic
1052432791 9:28388818-28388840 AAAGCTTCTAAATATGTGGCAGG - Intronic
1054904234 9:70400791-70400813 AAAGCTTGAAAAGCTGCTGGTGG - Intronic
1055549560 9:77419423-77419445 AAAGCTTGAAAGACTGCTGCAGG + Exonic
1055643529 9:78341263-78341285 ATAGCTACAAAAGATGTTACTGG - Intergenic
1057317279 9:93977787-93977809 AAAGAATGAACAGATGCTGCTGG + Intergenic
1057835695 9:98443252-98443274 AGAGCTTCAACAGAAGGTGCAGG - Intronic
1058301926 9:103385635-103385657 AAAGCATCATCAAATGCTGCTGG - Intergenic
1060536388 9:124392383-124392405 AAAGCTGCCAAAGTTGCTCCAGG + Intronic
1186648885 X:11537539-11537561 AAAGCAATAAAAGATGATGCTGG + Intronic
1188825823 X:34833227-34833249 AAAACTTCAAGAAATGCTGGCGG - Intergenic
1188852052 X:35144100-35144122 AGTTCTTCAAAAGATGCAGCTGG - Intergenic
1189190890 X:39103988-39104010 ATATCTACAAAAGATACTGCTGG - Intergenic
1189611170 X:42737580-42737602 CAAGTTTTAAAAAATGCTGCTGG + Intergenic
1191758617 X:64623207-64623229 AAAGCTTGAAGAGCTGATGCAGG - Intergenic
1193296803 X:79842927-79842949 TAAGCTTCTTAATATGCTGCTGG - Intergenic
1194989471 X:100530751-100530773 AAAGATTCAACAAATGGTGCTGG - Intergenic
1195668018 X:107448316-107448338 AAAGCTTCAGAAGAGGCCGGAGG - Intergenic
1200051971 X:153437988-153438010 AAAGTTTTAAAAGATTCAGCTGG + Intergenic
1200795242 Y:7335154-7335176 AAACCTTCAAAACATGATGTGGG + Intergenic
1200930342 Y:8691295-8691317 AAAAATTCAAAAGATTCTGCAGG - Intergenic