ID: 1140449761 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:75061284-75061306 |
| Sequence | CTGGGGGTGTGGGGGGAGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4048 | |||
| Summary | {0: 1, 1: 2, 2: 34, 3: 334, 4: 3677} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1140449761_1140449773 | -4 | Left | 1140449761 | 16:75061284-75061306 | CCCACCTCCCCCCACACCCCCAG | 0: 1 1: 2 2: 34 3: 334 4: 3677 |
||
| Right | 1140449773 | 16:75061303-75061325 | CCAGTACCCTTCCCAACCTCTGG | 0: 2 1: 35 2: 467 3: 1094 4: 1761 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1140449761 | Original CRISPR | CTGGGGGTGTGGGGGGAGGT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||