ID: 1140449761

View in Genome Browser
Species Human (GRCh38)
Location 16:75061284-75061306
Sequence CTGGGGGTGTGGGGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4048
Summary {0: 1, 1: 2, 2: 34, 3: 334, 4: 3677}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140449761_1140449773 -4 Left 1140449761 16:75061284-75061306 CCCACCTCCCCCCACACCCCCAG 0: 1
1: 2
2: 34
3: 334
4: 3677
Right 1140449773 16:75061303-75061325 CCAGTACCCTTCCCAACCTCTGG 0: 2
1: 35
2: 467
3: 1094
4: 1761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140449761 Original CRISPR CTGGGGGTGTGGGGGGAGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr