ID: 1140449773

View in Genome Browser
Species Human (GRCh38)
Location 16:75061303-75061325
Sequence CCAGTACCCTTCCCAACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3359
Summary {0: 2, 1: 35, 2: 467, 3: 1094, 4: 1761}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140449762_1140449773 -5 Left 1140449762 16:75061285-75061307 CCACCTCCCCCCACACCCCCAGT 0: 1
1: 0
2: 34
3: 319
4: 3616
Right 1140449773 16:75061303-75061325 CCAGTACCCTTCCCAACCTCTGG 0: 2
1: 35
2: 467
3: 1094
4: 1761
1140449759_1140449773 1 Left 1140449759 16:75061279-75061301 CCATCCCCACCTCCCCCCACACC 0: 1
1: 13
2: 219
3: 1021
4: 5888
Right 1140449773 16:75061303-75061325 CCAGTACCCTTCCCAACCTCTGG 0: 2
1: 35
2: 467
3: 1094
4: 1761
1140449757_1140449773 9 Left 1140449757 16:75061271-75061293 CCCATTAACCATCCCCACCTCCC 0: 119
1: 391
2: 760
3: 999
4: 1328
Right 1140449773 16:75061303-75061325 CCAGTACCCTTCCCAACCTCTGG 0: 2
1: 35
2: 467
3: 1094
4: 1761
1140449760_1140449773 -3 Left 1140449760 16:75061283-75061305 CCCCACCTCCCCCCACACCCCCA 0: 1
1: 2
2: 82
3: 802
4: 4897
Right 1140449773 16:75061303-75061325 CCAGTACCCTTCCCAACCTCTGG 0: 2
1: 35
2: 467
3: 1094
4: 1761
1140449761_1140449773 -4 Left 1140449761 16:75061284-75061306 CCCACCTCCCCCCACACCCCCAG 0: 1
1: 2
2: 34
3: 334
4: 3677
Right 1140449773 16:75061303-75061325 CCAGTACCCTTCCCAACCTCTGG 0: 2
1: 35
2: 467
3: 1094
4: 1761
1140449758_1140449773 8 Left 1140449758 16:75061272-75061294 CCATTAACCATCCCCACCTCCCC 0: 112
1: 340
2: 705
3: 1042
4: 1688
Right 1140449773 16:75061303-75061325 CCAGTACCCTTCCCAACCTCTGG 0: 2
1: 35
2: 467
3: 1094
4: 1761
1140449763_1140449773 -8 Left 1140449763 16:75061288-75061310 CCTCCCCCCACACCCCCAGTACC 0: 1
1: 0
2: 17
3: 183
4: 1670
Right 1140449773 16:75061303-75061325 CCAGTACCCTTCCCAACCTCTGG 0: 2
1: 35
2: 467
3: 1094
4: 1761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140449773 Original CRISPR CCAGTACCCTTCCCAACCTC TGG Intronic
Too many off-targets to display for this crispr