ID: 1140450664

View in Genome Browser
Species Human (GRCh38)
Location 16:75068458-75068480
Sequence CTTTCTCCCACAGCAGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140450664 Original CRISPR CTTTCTCCCACAGCAGAGTC GGG Intronic
901337785 1:8466106-8466128 CTATCTCCCACAGAAGAGTCAGG + Intronic
901905570 1:12406610-12406632 CATTCTTCCACCGCAGAGTAAGG - Intronic
904475238 1:30760559-30760581 CTTCCTCCAACTGCAGAGCCAGG - Intergenic
905274511 1:36808261-36808283 CTTTCTACAACAGGAGAATCTGG - Intronic
905304750 1:37009854-37009876 CTTCCTCCCACAGCATCCTCAGG - Intronic
906208058 1:43997487-43997509 CGTGCTCCCACCGCAGAGACTGG - Intronic
906421122 1:45668129-45668151 CTTTCTCCCACAGCTCTGACTGG + Intronic
906713924 1:47952957-47952979 TTTTCTGTCACAGCAGAGTGCGG - Intronic
907156101 1:52335657-52335679 CTTTTTCCAACACCAGAGTATGG - Intronic
907704238 1:56819293-56819315 CTTTCCTCCAAGGCAGAGTCAGG + Exonic
910122116 1:83801626-83801648 ATTTTTCCATCAGCAGAGTCTGG - Intergenic
910589094 1:88910245-88910267 TTATCTCCCAGGGCAGAGTCAGG - Intergenic
911016845 1:93342767-93342789 ATTTCTCCCACATCATAGTCAGG + Intergenic
911099966 1:94087695-94087717 TTTTCTCCCCAGGCAGAGTCTGG - Intronic
914765375 1:150632797-150632819 CTTTTCCCCACAGCTGAGGCAGG - Intergenic
918124165 1:181568204-181568226 CATTCACCCACAGGGGAGTCTGG + Intronic
919851116 1:201673632-201673654 CTCTCTCCCACATCAGAATGGGG - Intronic
920670403 1:207999801-207999823 CTTTCTCCCAGCCTAGAGTCTGG + Intergenic
920901543 1:210114365-210114387 GTTCCTCTCACAGCAGAGGCAGG + Intronic
920951460 1:210575151-210575173 ATTTCTCCCACCACAGAGTCAGG - Intronic
921598272 1:217078849-217078871 CTGTCTCCCAATGCAGAGGCTGG + Intronic
923279806 1:232432565-232432587 CTTTCTCCGAGAGCAAAATCGGG + Intronic
1063199143 10:3770778-3770800 CTTTCTCCCAGGGCAGAGAATGG + Intergenic
1067313749 10:45141465-45141487 TTTTCCCCCACACCAGAGTGTGG + Intergenic
1068257406 10:54531115-54531137 CTGTCTGCCACAGGAAAGTCAGG + Intronic
1071430326 10:85601895-85601917 CCTTCTCCCCCAGCAGAGAGGGG + Exonic
1072533612 10:96342773-96342795 CTGTCTCCACCAGCAAAGTCAGG + Intergenic
1074539947 10:114356189-114356211 CATATTCCCCCAGCAGAGTCTGG + Intronic
1076833608 10:133009091-133009113 CTTTCCCCAACTTCAGAGTCAGG + Intergenic
1081226951 11:40536087-40536109 CTTTTTCCCACAGCATCATCTGG + Intronic
1081597096 11:44466948-44466970 TCTTCTGACACAGCAGAGTCAGG - Intergenic
1082874194 11:57971454-57971476 CTTCCTCCCTCACCTGAGTCAGG - Intergenic
1082889388 11:58122291-58122313 CTTGCTCCAGCAGCAGGGTCTGG + Intronic
1084659703 11:70539650-70539672 CTGGTCCCCACAGCAGAGTCTGG - Intronic
1085198619 11:74687884-74687906 CTTTCTCCCACAGAAGCCTCAGG + Intergenic
1090270912 11:125385569-125385591 ATTTCTCAAACAGCAGCGTCAGG - Exonic
1090643290 11:128747217-128747239 CTTTGTCCCAGAGCAGAGGAGGG + Intronic
1091191693 11:133701091-133701113 CTTCCTCCCACCTCAGAGCCAGG + Intergenic
1091842221 12:3629429-3629451 CTGTCTCCCAGAGCACAGACCGG - Intronic
1093503477 12:19837795-19837817 CTCTCTCTGACTGCAGAGTCAGG - Intergenic
1093984764 12:25518141-25518163 CTTTCTCCAATAGTTGAGTCTGG + Intronic
1096806638 12:54144961-54144983 CAGTCTCCCCCAGCAGAGTCTGG - Intergenic
1100888144 12:99095261-99095283 CTACCTCCCACTGCAGAGGCTGG + Intronic
1101234948 12:102779011-102779033 CTTTCTGCCACACTAGAGACAGG + Intergenic
1102224119 12:111215992-111216014 CTTTCTCCATCAGGAGAGACTGG - Intronic
1102943219 12:116962184-116962206 CTTTCTCCCACAGAGGAGGTTGG - Intronic
1105070954 12:133234323-133234345 CATGCTCCTTCAGCAGAGTCAGG + Exonic
1105842320 13:24265528-24265550 CCATCTCCCACAGCTGAGACGGG - Intronic
1107875086 13:44783296-44783318 CTCTCTCTGACAGCAGAGCCTGG + Intergenic
1111876895 13:93908916-93908938 CTATCTTACACAGCAGAGTCAGG - Intronic
1113668673 13:112160061-112160083 CTTTCTCCCACAGCCATATCTGG + Intergenic
1113927702 13:113950727-113950749 CTTTCTCCCACAGCTGGGTCTGG + Intergenic
1114933647 14:27506763-27506785 ATTTCTACCACAGCAGTGGCAGG + Intergenic
1116353383 14:43895874-43895896 CTTTCACCAAAAGCAGAGCCTGG + Intergenic
1116614608 14:47118989-47119011 CTGCCTCCCAAAGCAGAGACTGG + Intronic
1118905793 14:70022238-70022260 TTTTCTCCCAAAACGGAGTCAGG - Intronic
1119323790 14:73746695-73746717 CTTTGGCCCAGGGCAGAGTCTGG - Intronic
1119447942 14:74682198-74682220 CTTTCTCTGATAGCAGAGTAAGG - Intronic
1120838831 14:89064964-89064986 CTTTGTCCCTAAGCAGAATCTGG - Intergenic
1121364398 14:93294487-93294509 CTTTCTTCCTCACCAGAGTATGG - Exonic
1122287408 14:100659858-100659880 CTTTCTGGCACAGTAGAGCCGGG - Intergenic
1122844796 14:104487009-104487031 TTCTCTCCCACAGCAGTGACCGG - Intronic
1124422921 15:29538129-29538151 CTACATCCCACAGCAGTGTCTGG + Intronic
1125745132 15:41992660-41992682 CTTTCTTCCTCAGGGGAGTCAGG - Intronic
1126141304 15:45441576-45441598 GTTTCCCACACAGAAGAGTCAGG - Intronic
1128079873 15:64850451-64850473 CTTTCTTCAACAGAAGATTCTGG + Intronic
1129287933 15:74541032-74541054 CTTCCTCCCACAACTCAGTCGGG + Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1132271210 15:100527412-100527434 CTTCCTCCAACAGCAGAAGCAGG + Intronic
1132974056 16:2702795-2702817 CTCACTCACACAGCAGAGGCTGG - Intronic
1133372122 16:5253084-5253106 CTTTCTTCCAAAGCTGAGCCTGG - Intergenic
1134314125 16:13102566-13102588 CTTTATCACACAGCAAAGTCAGG + Intronic
1134827179 16:17294193-17294215 CTTTCTGACAAAGCAGAGTGGGG + Intronic
1137746087 16:50821163-50821185 CATTCTCCAAAAGTAGAGTCTGG + Intergenic
1138441491 16:57037588-57037610 CTTTGTCCCACTGGAGAGTTTGG - Intronic
1140450664 16:75068458-75068480 CTTTCTCCCACAGCAGAGTCGGG + Intronic
1140753057 16:78043650-78043672 CTGTCTCCCAAACCAGAGCCTGG + Intronic
1143867037 17:9931517-9931539 GTTTCTACCACAGCAGAGAATGG + Intronic
1144645195 17:16968443-16968465 CTTTCTCCCATTGAATAGTCTGG - Intronic
1146266141 17:31454095-31454117 CATTCTCCCAGGGCAGAGACTGG + Intronic
1146281007 17:31544500-31544522 CTTTCTTCCACAGCATTCTCAGG + Intergenic
1146309794 17:31758880-31758902 CTTTTTCCCCCAGTGGAGTCTGG - Intergenic
1146951721 17:36911121-36911143 CATTCTCCCACATGAGAGACCGG + Intergenic
1149421842 17:56519305-56519327 CTTTCCCCCAAGGCAAAGTCAGG + Intergenic
1150297059 17:64016804-64016826 CTTTGTTCCAAAGCAGAGGCTGG - Intronic
1151684796 17:75640150-75640172 CTCTCTGCCCCAGCAGAGCCCGG + Exonic
1152404626 17:80089767-80089789 TTTTCTCCCAAAGCATAATCTGG - Exonic
1152532912 17:80930822-80930844 CTTCCTCCCACAGCTGGGGCAGG + Intronic
1155448535 18:25938818-25938840 CTTTCTCCCCCAGCACAGAGTGG - Intergenic
1155450781 18:25960536-25960558 CTGTCTCTCACAGTGGAGTCAGG - Intergenic
1155522318 18:26680956-26680978 CTTTTTTCCACAGCAGACTGTGG - Intergenic
1156703508 18:39852761-39852783 CTGTCTCCCCCAGCATAGTCGGG - Intergenic
1157151659 18:45224341-45224363 CTTACTCCCACAGCTGATCCAGG - Intronic
1157176866 18:45459836-45459858 GTTTTTCTTACAGCAGAGTCAGG - Intronic
1157259609 18:46166758-46166780 CTTTCAGCCACACCTGAGTCTGG - Intergenic
1157932102 18:51834416-51834438 CTTCCTCCTACAGCTGATTCTGG - Intergenic
1157974363 18:52310178-52310200 CCCTCTGGCACAGCAGAGTCGGG + Intergenic
1158180388 18:54708971-54708993 CTGTCTCCCACAGCAGACTGTGG + Intergenic
1159825526 18:73204534-73204556 CTTTCTCCCATTTCAAAGTCTGG + Intronic
1160604053 18:80035650-80035672 CTTTCTCCCAGAGTACAGTAAGG - Intronic
1160902339 19:1434724-1434746 CTTTCTCCCCCAGCAGGTTACGG + Exonic
1163875134 19:19861397-19861419 CTTTCTCCCAGAGCTGAGCCAGG + Intergenic
1163969180 19:20776083-20776105 CTTCCTCCCAGAGCTGAGCCTGG - Intronic
1163999206 19:21081982-21082004 CTTCCTCCCAGAGCTGAGCCAGG - Intergenic
1164626196 19:29729860-29729882 CTTTCATCCTCTGCAGAGTCTGG + Intergenic
1164923008 19:32103591-32103613 CTTTCTCCACCAACAGGGTCAGG + Intergenic
1168090714 19:54081419-54081441 CTCTCTCCCACCCCAGAGTGTGG + Intergenic
926115469 2:10210329-10210351 AGTTCTCTCACTGCAGAGTCTGG + Exonic
926577399 2:14597090-14597112 CTGTCTGTCCCAGCAGAGTCAGG - Intergenic
927527259 2:23756553-23756575 CTTTAGCCCATAGCAGGGTCTGG - Intronic
927971280 2:27307465-27307487 CTTTCCCCCACCCCAGAGTTGGG - Exonic
928446816 2:31340075-31340097 CTTTCTCCCAGAGGACAGGCAGG - Intronic
928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG + Intronic
929092421 2:38232637-38232659 CATCCTCCCAGAGGAGAGTCAGG + Intergenic
929915322 2:46130959-46130981 CTTTTTCCCAAAGCAGAGATAGG + Intronic
931638636 2:64362373-64362395 CTTTAAACCACAGCAGACTCAGG + Intergenic
932264804 2:70358431-70358453 CTTCTGCCCACAGGAGAGTCTGG - Intergenic
932565045 2:72900886-72900908 CTTTCTCCCACATCCATGTCTGG - Intergenic
932656581 2:73615913-73615935 CTTTCTCACACGGCAGCGGCAGG - Intergenic
935730699 2:106062937-106062959 CTTTCTCCCGCTGCTAAGTCTGG - Intergenic
936055777 2:109260901-109260923 CTTCCTCTCACAGCAGAGGCAGG - Intronic
936968007 2:118146316-118146338 CTTTCTCCCACAAAAGACTGTGG + Intergenic
936993160 2:118387158-118387180 CCTTCTCTCAGAGGAGAGTCAGG + Intergenic
938725252 2:134103137-134103159 CTGCCTCCCCCAGCAGAGACAGG + Intergenic
939199749 2:139018696-139018718 CTTGCTCCCATAGGAGACTCTGG - Intergenic
939344597 2:140947480-140947502 CTTTCTTCCACAGCAGGTTTGGG + Intronic
944145541 2:196503619-196503641 CTCCCTGCCACAGCAGAGTAGGG - Intronic
945130146 2:206562533-206562555 CTTTCTCACACTGCAGAATGTGG + Intronic
947041975 2:225932723-225932745 CTGTTTCCCAAAACAGAGTCTGG - Intergenic
948364617 2:237446521-237446543 CCTCCTCCAACAGCAGACTCTGG - Intergenic
948907256 2:240985857-240985879 CTGCCCCCCACAGCAGGGTCTGG + Intronic
1170968052 20:21093843-21093865 CTTTCTCTTACAGAAGAGACTGG - Intergenic
1172342835 20:34172243-34172265 CTTTCTCCTACAGCCAAGTCAGG + Intergenic
1175828623 20:61950477-61950499 GGTTCTCCCACACCAGACTCTGG + Intergenic
1175940633 20:62536040-62536062 CTTTCTCCAGAAGCAGAGTTGGG - Intergenic
1176157124 20:63627410-63627432 CATTCACACACAGCAGCGTCCGG - Intergenic
1176365343 21:6029522-6029544 CTCTGACCCACAGCAGGGTCTGG + Intergenic
1179758175 21:43509023-43509045 CTCTGACCCACAGCAGGGTCTGG - Intergenic
1182044822 22:27266049-27266071 GTTTCTGCCACAGCAGTGCCCGG - Intergenic
1183431161 22:37766523-37766545 CCTTCCCCCTCAGCAGAGTCTGG + Intronic
1184393176 22:44217465-44217487 CTCTGTCCTCCAGCAGAGTCAGG - Intronic
952410422 3:33044844-33044866 TTTTAACCCACAGCAGAGACAGG + Intronic
952592011 3:34967113-34967135 CTTTCTCCCAAAGCAGAAACTGG - Intergenic
952849568 3:37716303-37716325 ATCTCTCTCACAGCAGAGTATGG - Intronic
952867746 3:37865925-37865947 CTGCCTCCCACAGCAAAGGCTGG - Intronic
953469528 3:43155133-43155155 CCTTCTCCCACTGCAGGGCCCGG - Intergenic
953702476 3:45207480-45207502 CTTTCTCTCTCTGCAAAGTCTGG - Intergenic
954327400 3:49870986-49871008 CCCTCTCCCACAGCAGGGTCAGG - Intergenic
960271125 3:115675829-115675851 CTTTCTCCCACAGTATTGTATGG - Intronic
961020435 3:123501632-123501654 CTTTCTCCAACAGTAAAATCAGG + Intronic
962534291 3:136313882-136313904 CCTTCTCCGATAGCAGAATCTGG - Intronic
962688065 3:137866599-137866621 CTTTCTCCCACTGCAAATTTTGG + Intergenic
963274055 3:143313201-143313223 CCTCCACCCACAGCAGACTCAGG - Intronic
966489875 3:180516363-180516385 CTTGCTCCCATAGGAGACTCTGG + Intergenic
967836979 3:193973038-193973060 CTTTCTAACACAGGAGAGCCAGG + Intergenic
968833764 4:2947955-2947977 CTATCTGCCACAGCAAAGTCTGG + Intronic
969006154 4:4021466-4021488 GTTTGTCCCACAACAGAGTTGGG - Intergenic
969149243 4:5154672-5154694 CTCTCTCACACAGCAGCGCCAGG + Intronic
969321129 4:6413600-6413622 TGTTCTCTCACAGCAGGGTCGGG - Intronic
969595648 4:8148075-8148097 GTTTCTCCCCCAGCAAGGTCGGG - Intronic
969806795 4:9615824-9615846 GTTTGTCCCACAACAGAGTTGGG + Intergenic
971445298 4:26739465-26739487 CTTTCTCTCACAAAAGATTCAGG - Intronic
972682356 4:41318534-41318556 CCTTCTCAAACTGCAGAGTCTGG - Intergenic
975292694 4:72695747-72695769 CATGTTCCCACAGCAGAGACAGG - Intergenic
975356220 4:73407894-73407916 CTCTCCCTCACAGCAGAGTCAGG + Intronic
979468433 4:121069084-121069106 CTCCCTTCCACAACAGAGTCTGG + Intronic
980207213 4:129735266-129735288 TTTTATCCTACAGCAGATTCAGG - Intergenic
983674261 4:170273643-170273665 TTTTCTCCCACTGCAGGGTTGGG + Intergenic
984846185 4:184110012-184110034 CTTGGACCCACAGCAGAGTACGG + Intronic
985532205 5:440666-440688 TATTCTCCCAGAGCAGGGTCAGG + Intergenic
987111095 5:14687625-14687647 CCTTCTTCCTCAGCAGAGTAAGG - Exonic
992546292 5:77817226-77817248 CTTTCCCGCACTGCAGAGGCTGG - Intronic
993754001 5:91704684-91704706 CTATCTCCAACATTAGAGTCTGG + Intergenic
994269513 5:97760388-97760410 CTTTCTCCCACTACTGAGGCAGG - Intergenic
994931725 5:106196244-106196266 TTTTATCTCACAGAAGAGTCGGG + Intergenic
995198373 5:109398805-109398827 TTTACTCCTAGAGCAGAGTCAGG + Intronic
1000266079 5:159639701-159639723 CTTTCTCCTGGGGCAGAGTCAGG + Intergenic
1001951694 5:175820926-175820948 CTCGGTCCCAGAGCAGAGTCAGG + Intronic
1002954722 6:1850920-1850942 CTAATTCCCACAGCAGAGACGGG - Intronic
1002966261 6:1969644-1969666 CTTCCTCCCATCTCAGAGTCTGG + Intronic
1003337023 6:5183299-5183321 ATTTCTCCCACAGCAGATGAAGG - Intronic
1003669120 6:8139485-8139507 ATTTCTCAGAAAGCAGAGTCTGG - Intergenic
1006399402 6:33807846-33807868 CTTTCTCCCACAGCAGGCAGAGG + Intergenic
1007032515 6:38640767-38640789 CTTGCTCTCACTGCAGAGGCTGG - Intergenic
1008612860 6:53200363-53200385 CTTGCTCCAACAGCAGAGGTGGG + Intergenic
1009547001 6:65033160-65033182 CTTTCTCCCACATCTGAGCTAGG - Intronic
1010600962 6:77825948-77825970 CTTTCTCCCACATGAGTTTCAGG - Intronic
1011536075 6:88377679-88377701 CTTCCTAACTCAGCAGAGTCAGG - Intergenic
1012130792 6:95489666-95489688 CTTTGTGCCACAGCTGAGTCTGG - Intergenic
1013194159 6:107830694-107830716 CTTTCTCCCACAGAAGTGATTGG + Intergenic
1015970099 6:138734941-138734963 GTTTCCCCCAAAGCAGAGCCTGG - Intergenic
1017159136 6:151349145-151349167 ATTTCTCCCCCAGCCGAATCTGG + Exonic
1017421573 6:154278320-154278342 CTTTGTAGCACAGCAGTGTCAGG - Intronic
1017962373 6:159233399-159233421 CATTCTCCCAAAGCACAGCCAGG + Exonic
1018260848 6:161969374-161969396 CTTTCTCCCAGTGCACAGGCTGG - Intronic
1018913207 6:168116282-168116304 CTTTCTCCCTCACAAGAGTGGGG - Intergenic
1019567706 7:1692741-1692763 CTAGGTCACACAGCAGAGTCAGG - Intronic
1020017693 7:4841106-4841128 CCTTCACCCACAGCAGGGTCTGG - Intronic
1021061569 7:16118914-16118936 CTTTCTCCCTCAGCTGAGTAAGG - Intronic
1021689467 7:23217999-23218021 ATTTCTCCCACACCCGAGTTTGG - Intergenic
1022242765 7:28529083-28529105 GTTGCTCCCACAGAAGAATCAGG - Intronic
1022529706 7:31059424-31059446 CTATCTGCCCCAACAGAGTCTGG + Intronic
1025801835 7:64794211-64794233 CTTCCTCCCTGAGCTGAGTCAGG - Intergenic
1025865046 7:65373638-65373660 CTTCCTCCCTGAGCTGAGTCAGG - Intergenic
1026234216 7:68511775-68511797 CCTTCTCACACAGCAGTGCCTGG + Intergenic
1032225284 7:130026504-130026526 CTTTCTCAGTCAGCAGATTCAGG - Intronic
1032494083 7:132347965-132347987 CTTTCTCCCACAGCTGTCCCAGG - Intronic
1032781614 7:135168930-135168952 CCTTCTCACAAAGAAGAGTCAGG + Exonic
1035000012 7:155604803-155604825 CTTTCTCCAGTAGCAGAGGCGGG - Intergenic
1038610917 8:29059717-29059739 CTTTCTCACGCAGCAGTGCCAGG + Intronic
1040417005 8:47204584-47204606 CTTCCTCCCACAGCACAATAGGG + Intergenic
1042002133 8:64135980-64136002 GACTCTGCCACAGCAGAGTCTGG + Intergenic
1043516954 8:81003509-81003531 CTCTTTCCCACTCCAGAGTCTGG + Intronic
1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG + Intronic
1045799565 8:106086916-106086938 CTGTCTTCCTCAGCAGAGTAAGG - Intergenic
1047868786 8:129059489-129059511 CATATTCCCACAGCAGAGACAGG - Intergenic
1047945895 8:129879597-129879619 CTGTCTGCCAGAGCACAGTCTGG - Intronic
1049322326 8:142003156-142003178 CTCTCTGGCACAGCAGGGTCGGG - Intergenic
1053792370 9:41695886-41695908 CTTTTTCCCTCAGCAGGGTTGGG - Intergenic
1054180779 9:61907906-61907928 CTTTTTCCCTCAGCAGGGTTGGG - Intergenic
1054656812 9:67673236-67673258 CTTTTTCCCTCAGCAGGGTTGGG + Intergenic
1058723934 9:107784390-107784412 CTTTCTCCCACATCTGAACCAGG + Intergenic
1059470609 9:114502601-114502623 CTTTATGGCACAGCTGAGTCTGG + Intronic
1059833070 9:118120191-118120213 TTTTCTCCCAGAGCACAGGCTGG - Intergenic
1060068973 9:120529914-120529936 CCATCTCCCACAGAGGAGTCTGG + Intronic
1061820123 9:133222810-133222832 CTCTGTCCCCCAACAGAGTCTGG - Intergenic
1062232780 9:135491399-135491421 CTTACTCCCACAGCGGCGCCGGG - Intergenic
1062240509 9:135535112-135535134 CTCTGTCCCCCAACAGAGTCTGG + Intergenic
1186618759 X:11215487-11215509 CCTGCTCCCACAGGAGACTCGGG + Intronic
1187052933 X:15712738-15712760 CTTGCTACAACAGCAGAGTTGGG - Intronic
1189847644 X:45151361-45151383 CTTTCACCCTCAGGAGAGTCTGG + Exonic
1190328091 X:49218935-49218957 CTTTCTCACACCCCAGATTCTGG - Exonic
1190458129 X:50644741-50644763 CTGTATCTCACAGGAGAGTCTGG + Intronic
1195925225 X:110017938-110017960 CTGTCTTCCACAGAGGAGTCTGG + Intronic
1197094365 X:122575329-122575351 ATTTCTCCCACATCCGAGTTAGG + Intergenic