ID: 1140450742 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:75068962-75068984 |
| Sequence | CTGAATGAAGAGAGGGAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2488 | |||
| Summary | {0: 1, 1: 2, 2: 12, 3: 196, 4: 2277} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1140450742_1140450749 | 19 | Left | 1140450742 | 16:75068962-75068984 | CCCTCCTCCCTCTCTTCATTCAG | 0: 1 1: 2 2: 12 3: 196 4: 2277 |
||
| Right | 1140450749 | 16:75069004-75069026 | TGATGCCCGAAGAACACCAAAGG | 0: 1 1: 0 2: 0 3: 3 4: 60 |
||||
| 1140450742_1140450750 | 20 | Left | 1140450742 | 16:75068962-75068984 | CCCTCCTCCCTCTCTTCATTCAG | 0: 1 1: 2 2: 12 3: 196 4: 2277 |
||
| Right | 1140450750 | 16:75069005-75069027 | GATGCCCGAAGAACACCAAAGGG | 0: 1 1: 0 2: 0 3: 5 4: 94 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1140450742 | Original CRISPR | CTGAATGAAGAGAGGGAGGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||