ID: 1140450742

View in Genome Browser
Species Human (GRCh38)
Location 16:75068962-75068984
Sequence CTGAATGAAGAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2488
Summary {0: 1, 1: 2, 2: 12, 3: 196, 4: 2277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140450742_1140450749 19 Left 1140450742 16:75068962-75068984 CCCTCCTCCCTCTCTTCATTCAG 0: 1
1: 2
2: 12
3: 196
4: 2277
Right 1140450749 16:75069004-75069026 TGATGCCCGAAGAACACCAAAGG 0: 1
1: 0
2: 0
3: 3
4: 60
1140450742_1140450750 20 Left 1140450742 16:75068962-75068984 CCCTCCTCCCTCTCTTCATTCAG 0: 1
1: 2
2: 12
3: 196
4: 2277
Right 1140450750 16:75069005-75069027 GATGCCCGAAGAACACCAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140450742 Original CRISPR CTGAATGAAGAGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr