ID: 1140451296

View in Genome Browser
Species Human (GRCh38)
Location 16:75072882-75072904
Sequence ATCTCAGAGGGGAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140451296_1140451303 4 Left 1140451296 16:75072882-75072904 CCCTCCAGCTTCCCCTCTGAGAT 0: 1
1: 0
2: 2
3: 42
4: 347
Right 1140451303 16:75072909-75072931 ATACTGTGTTGGTGTAGTGATGG 0: 1
1: 0
2: 1
3: 8
4: 117
1140451296_1140451302 -7 Left 1140451296 16:75072882-75072904 CCCTCCAGCTTCCCCTCTGAGAT 0: 1
1: 0
2: 2
3: 42
4: 347
Right 1140451302 16:75072898-75072920 CTGAGATGCAGATACTGTGTTGG 0: 1
1: 0
2: 1
3: 16
4: 176
1140451296_1140451304 5 Left 1140451296 16:75072882-75072904 CCCTCCAGCTTCCCCTCTGAGAT 0: 1
1: 0
2: 2
3: 42
4: 347
Right 1140451304 16:75072910-75072932 TACTGTGTTGGTGTAGTGATGGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140451296 Original CRISPR ATCTCAGAGGGGAAGCTGGA GGG (reversed) Intronic
901738775 1:11328876-11328898 ATCTCAGAGGAGGAGATGGCTGG + Intergenic
905870329 1:41399897-41399919 TTCTCTTAGGGGAAGCTGGCAGG - Intergenic
906460507 1:46032448-46032470 TCCACAAAGGGGAAGCTGGAAGG - Intronic
907544817 1:55250498-55250520 ATCTCAGGAGTGAAGCTGGCTGG - Intergenic
908020496 1:59893277-59893299 ATCTCACAAAGGAAGCAGGAAGG + Intergenic
909241874 1:73223489-73223511 ATCTCAAAGGGTTAGCTTGAGGG - Intergenic
909490723 1:76223396-76223418 ATTTCAGAGTGGAAGGTGGGAGG + Intronic
911048732 1:93651369-93651391 CTGGCAGATGGGAAGCTGGATGG + Intronic
915092002 1:153433067-153433089 GTCTCAGAAGGGATCCTGGAGGG - Intergenic
915529837 1:156497063-156497085 TTCCCAGTGGGGAAGCTGGGGGG - Intronic
915602742 1:156932432-156932454 ATCACAGAGGTGGGGCTGGAGGG + Exonic
916000762 1:160612885-160612907 CTCTTACAGGGGCAGCTGGAGGG + Intronic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
917402348 1:174664619-174664641 ATCTAAGAGGAGCACCTGGAAGG - Intronic
918420631 1:184361127-184361149 TTCTGAGAGTGGAAGGTGGAAGG - Intergenic
918821886 1:189267063-189267085 ATTTGAGAGGTGAAGCTGGTTGG + Intergenic
919220151 1:194617694-194617716 ACCTCAGAGGTGAAGCTGGCTGG - Intergenic
920040935 1:203096739-203096761 AGCTCAGAGAGGCAGCTGGTAGG + Intronic
920335152 1:205240280-205240302 CTCACAGAGGGGCAGCTGGATGG - Intronic
921259508 1:213373215-213373237 ATTTAAGAAGGGTAGCTGGAGGG + Intergenic
922041731 1:221903998-221904020 AGCTCAGTGGGGAAGCTGAGGGG - Intergenic
922414210 1:225405586-225405608 ATCCCAGGGTGGAAGGTGGAAGG - Intronic
924257583 1:242197556-242197578 ATATCTGAGCTGAAGCTGGAAGG - Intronic
924778661 1:247128514-247128536 CTCTCAGAGGAGCAGCTGGATGG + Intronic
924782993 1:247169905-247169927 CTCTCAGAGGAGCAGCTGGATGG - Intronic
924883452 1:248188011-248188033 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883465 1:248188076-248188098 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883479 1:248188142-248188164 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
1062953341 10:1522352-1522374 CTCTAAGAGGGGGAGGTGGAAGG + Intronic
1063114468 10:3064141-3064163 ACCGCAGAGGGGAAGTGGGAAGG + Intergenic
1063140362 10:3251315-3251337 ATCTCAGAGGAGTTTCTGGAGGG - Intergenic
1063371858 10:5527402-5527424 ATTCCTGAGGGGATGCTGGATGG + Intergenic
1063455975 10:6182903-6182925 TTCACAGAGGGTCAGCTGGAAGG + Intronic
1064393354 10:14959928-14959950 ATGGCAGAAAGGAAGCTGGAGGG + Intronic
1067828561 10:49596980-49597002 CTTTGAGAGGGGAACCTGGACGG - Intergenic
1067970415 10:50963859-50963881 AACTGAGAGGTGAAGCTGGCTGG + Intergenic
1068844412 10:61655779-61655801 AGAACAGAAGGGAAGCTGGATGG - Intergenic
1069687880 10:70330726-70330748 TTCTGAGAAGTGAAGCTGGATGG - Intronic
1070052924 10:72906464-72906486 GGATCAGAGGGGGAGCTGGATGG + Intronic
1070558887 10:77550870-77550892 ATCTGGGAGGTGAAGCTTGAGGG - Intronic
1070904631 10:80060789-80060811 GTCTCAAAGGCGAAGCTGAATGG - Intergenic
1072339143 10:94429664-94429686 ATAACAGAGGGGAAGTTGGATGG - Intronic
1072954437 10:99876316-99876338 ATCTCAGCAGGGAGGCGGGAGGG + Exonic
1073730633 10:106283189-106283211 ATCTCAAGGGGGAAGATGGGAGG + Intergenic
1074900587 10:117813164-117813186 ATTTCAGAGGCCAAGGTGGAAGG - Intergenic
1075790968 10:125084309-125084331 ATCTCAGGGAAGAAGCTGCACGG + Intronic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1076630210 10:131847735-131847757 ATCTCACAGGCGAGGCTGGTGGG + Intergenic
1076671384 10:132122638-132122660 GTCTCAGAGAGGAAGCCAGATGG + Intronic
1077248217 11:1549253-1549275 AGCTCAGAGGGGATCCTGGTGGG - Intergenic
1078357689 11:10644660-10644682 TTCTCACTGGGGAAGCTGGGGGG + Intronic
1079325928 11:19492543-19492565 AAATCAGAGGGTAAGCTGGAAGG + Intronic
1079885637 11:25985151-25985173 TTTTCAGAGAGGAAGCAGGAGGG + Intergenic
1080221586 11:29911772-29911794 ACCCCAAAGTGGAAGCTGGATGG - Intergenic
1080941270 11:36921391-36921413 ATCTCAGTGGGCAGGCTGGTTGG + Intergenic
1081190570 11:40099504-40099526 ACCTCAGTGGGCAAGCTGGTTGG - Intergenic
1081191286 11:40105290-40105312 ATCTCAGTGGGCAGGCTGGTTGG - Intergenic
1083153496 11:60808675-60808697 CTCACAGAGAGGAAGCTGGTGGG + Intergenic
1083213467 11:61203880-61203902 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083216349 11:61222716-61222738 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083219231 11:61241542-61241564 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083513871 11:63237454-63237476 ATCTCACAGCAGAAGGTGGAAGG - Intronic
1084171859 11:67404787-67404809 AATTCATAGGGGAAGCTGGCTGG - Intronic
1084670911 11:70606096-70606118 ATGGCAGGGGGGCAGCTGGAAGG + Intronic
1084764981 11:71302312-71302334 CTCGCACAGGGGATGCTGGAGGG - Intergenic
1084918418 11:72449259-72449281 ATCTGTGAGGAGAAGCGGGAGGG + Intergenic
1085510857 11:77087438-77087460 AACTCAGAGAAGGAGCTGGAGGG - Intronic
1087237045 11:95731627-95731649 AGCTGAGAGGGGAAGATGGCAGG - Intergenic
1087775501 11:102253133-102253155 ATCTCATGGTGGAAGGTGGAAGG + Intergenic
1089164912 11:116468365-116468387 ATTTCCTGGGGGAAGCTGGATGG + Intergenic
1089335470 11:117720076-117720098 ATCTCTCCGTGGAAGCTGGAAGG + Intronic
1089528719 11:119113138-119113160 AAGCCAGAGGGGAAGCTGGAAGG - Intronic
1089768325 11:120784722-120784744 AGCTCAGCGGGGCAGCTGGAAGG - Intronic
1089932749 11:122330505-122330527 ATTACAGAGAGGAAGCTGGAGGG - Intergenic
1090996120 11:131867255-131867277 AACGCAGTGGGGAAGTTGGAAGG + Intronic
1091206524 11:133824979-133825001 ATGTCAGAGGTGGAGATGGAAGG + Intergenic
1091266582 11:134276444-134276466 CCCTCGGAGGGGAAGCGGGAGGG - Intronic
1091323922 11:134670116-134670138 ACCACTGAGGGGAAGCTGGGAGG - Intergenic
1091695714 12:2626788-2626810 CTCTCAGTGGGGAAGATGGCAGG + Intronic
1092121185 12:6044990-6045012 ATATCAGAGGGGAAGCAGCAGGG - Intronic
1092187335 12:6490521-6490543 TTTTCAGAGGGGTGGCTGGAAGG - Intergenic
1092569096 12:9702316-9702338 AGCTCAGAGGGACAGCTTGATGG - Intergenic
1092817134 12:12322170-12322192 AAGGCAGAGGGGATGCTGGAGGG + Intergenic
1093092028 12:14932499-14932521 AGCCCAGGGTGGAAGCTGGATGG + Intronic
1093850185 12:24027150-24027172 ATCTCAGAAGCTAAGGTGGAGGG - Intergenic
1096055511 12:48648089-48648111 ATCTCAGAAGAGGAGCTTGAAGG + Intergenic
1096407952 12:51357464-51357486 AGCAGAGAGGGGAAGCAGGATGG + Intronic
1096828234 12:54295381-54295403 TTCCCTCAGGGGAAGCTGGAGGG - Exonic
1096924221 12:55124536-55124558 AACTGAGAGGTGAAGCTGGCTGG + Intergenic
1097054946 12:56243618-56243640 GTCTCAGAGGGGAGCCTGCAGGG - Intronic
1097572944 12:61356262-61356284 AGCATGGAGGGGAAGCTGGAGGG - Intergenic
1098436862 12:70476914-70476936 ACCTCAGAGGGCAGGCTGGTTGG - Intergenic
1099465907 12:82987848-82987870 ATCTCAGAATGGGATCTGGATGG + Intronic
1100526213 12:95422032-95422054 ATCTCAGAGGGGTTGTTGTAGGG + Intergenic
1100873047 12:98932222-98932244 TTCTCAGAGGTGGAGCTGCAGGG - Intronic
1101687382 12:107038452-107038474 TTCTCAGAAGGAAAGATGGATGG + Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103467972 12:121157124-121157146 ACCTGAGAGGGGAGGCTGGGAGG - Intronic
1103649825 12:122423371-122423393 ATCCCAGGGGGGAAGGAGGATGG - Intergenic
1104131799 12:125901042-125901064 CTCCCAGAGGGGAATGTGGATGG - Intergenic
1104622908 12:130331708-130331730 ATCACAGAGGGCAAGGGGGATGG + Intergenic
1104903116 12:132199666-132199688 AAGACAGAGTGGAAGCTGGAAGG - Intronic
1106241302 13:27915832-27915854 AGCTCAGAAGGGAAGCAGCAGGG + Intergenic
1106847156 13:33748663-33748685 ATTTCAGAGGGACAGCTTGATGG - Intergenic
1107256018 13:38427552-38427574 ATCTCAGTGGGCAGGCTGGTTGG + Intergenic
1107425742 13:40291086-40291108 ATCTCTCAGGAGAAGCAGGAGGG + Intergenic
1107993537 13:45839318-45839340 ATCTAACAGTGGAAGCTGGTTGG - Intronic
1111333073 13:86786371-86786393 ATCTCATGGCGGAAGGTGGAAGG + Intergenic
1112159961 13:96856771-96856793 ATTTCAGAGTGGAAGATGGAGGG - Intergenic
1112170990 13:96971526-96971548 AACTCAGGAGGGAAACTGGAAGG + Intergenic
1112214909 13:97420077-97420099 ATCTCAGTCAGGGAGCTGGAGGG + Intergenic
1113452467 13:110420960-110420982 CTCTCAGCGGGGAAGCTGGATGG + Intronic
1114128507 14:19760331-19760353 ATTACAGAAGGGCAGCTGGAAGG - Intronic
1114663618 14:24366495-24366517 ATTTCCGAGATGAAGCTGGAAGG + Intronic
1115078427 14:29419973-29419995 ATATCAGAGAGGAAGGAGGAAGG - Intergenic
1118077131 14:62311704-62311726 ATATCTCAGGGGCAGCTGGAAGG + Intergenic
1118886443 14:69870721-69870743 ATCCCATAGTGGAAGCAGGACGG - Intronic
1120890334 14:89485509-89485531 AGCTCAGAGGGGAGGATGGCAGG + Intronic
1121853479 14:97245391-97245413 TTCTGAGGGGGGCAGCTGGATGG + Intergenic
1121870745 14:97404633-97404655 TGCTCACAGGGGAGGCTGGAAGG - Intergenic
1122641682 14:103163703-103163725 ACTTCAGAGGGGCAGCTTGATGG + Intergenic
1122771228 14:104098772-104098794 ATGGCAGGGAGGAAGCTGGAGGG + Intronic
1122811666 14:104292305-104292327 AGCTGAGAGAGGAAGGTGGAGGG + Intergenic
1123205624 14:106710377-106710399 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1123210674 14:106757652-106757674 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1123398465 15:19960589-19960611 ATCTCTGAGGAGAATCTAGATGG - Intergenic
1123571447 15:21614599-21614621 ATTACAGAAGGGCAGCTGGAAGG - Intergenic
1123608066 15:22057190-22057212 ATTACAGAAGGGCAGCTGGAAGG - Intergenic
1123754391 15:23385659-23385681 ATCTCAGGTGGGCAGCTGTAGGG - Intergenic
1123809623 15:23910142-23910164 ACCTCAGAGGGCAAACGGGAAGG + Intergenic
1126023967 15:44427985-44428007 ACCTAAGAGGTGAAGCTGGCGGG - Intronic
1126857739 15:52855151-52855173 ATCTCAGAGGGGCAGAGAGAAGG - Intergenic
1127601160 15:60538262-60538284 GTCTCAGAGGGAGACCTGGAAGG - Intronic
1128005297 15:64234001-64234023 ATTTGAGAGAGGAAGCGGGAGGG - Intronic
1130681769 15:86003105-86003127 ATGGCAGAGGGGAAGCTAGAGGG + Intergenic
1202980301 15_KI270727v1_random:348988-349010 ATTACAGAAGGGCAGCTGGAAGG - Intergenic
1132826086 16:1906392-1906414 AACTCACAGGGCAAGCTGGGGGG - Intergenic
1134108733 16:11501616-11501638 ATCTCAGAGGGGAATCTCTGAGG - Intronic
1134461972 16:14437338-14437360 ATCTCAGGTGGGCAGCTGAAGGG + Intronic
1136069862 16:27781253-27781275 CTCACAGAGGGAATGCTGGAAGG - Intergenic
1136779784 16:32890120-32890142 ATCTCTGAGGAGAATCTAGAAGG + Intergenic
1138934831 16:61706292-61706314 ATTTCAAAGGGGAAGCGAGAGGG + Intronic
1139018792 16:62723204-62723226 ATTTCATAGTGGAAGATGGAAGG + Intergenic
1139911317 16:70399198-70399220 ACCTCAGATGGGAAGCAGAAGGG - Exonic
1139922116 16:70467058-70467080 CTATTAGACGGGAAGCTGGAGGG + Intronic
1140451296 16:75072882-75072904 ATCTCAGAGGGGAAGCTGGAGGG - Intronic
1141367516 16:83457076-83457098 ATCTCAGAGGCGATGGAGGATGG + Intronic
1141622196 16:85242271-85242293 CTGGCAGAGGGGAAGCAGGAGGG - Intergenic
1142108675 16:88319548-88319570 CTCTCAGAGGGGAAGCAGCGGGG + Intergenic
1144058803 17:11563092-11563114 ATTTCAGAGAGGGAGCTGGCTGG + Exonic
1144721990 17:17477299-17477321 GGCTGAGAGGAGAAGCTGGAGGG - Intronic
1145214741 17:21042990-21043012 ATCGCCGAGGGGAGGCTGCAAGG + Exonic
1145296034 17:21593268-21593290 AGCTTGGAGGAGAAGCTGGAGGG + Intergenic
1145972948 17:28967672-28967694 AACTCAAAGGGGAAGATGTAAGG - Intronic
1146252581 17:31362307-31362329 TTATCAGCGGGGAAGCAGGAAGG - Intronic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1146655331 17:34631633-34631655 ATCTCAGAGGGGTGGGTGGAGGG - Intronic
1146750506 17:35374044-35374066 CTCTCCGAGGGGTATCTGGAAGG - Intergenic
1147188350 17:38724996-38725018 CCCTCAGAGGGGAGGCAGGAAGG - Intronic
1147455682 17:40536722-40536744 TTCACAGAGGAGAGGCTGGAAGG + Intergenic
1148647583 17:49228023-49228045 ATATCAGCTGGGAATCTGGAAGG - Intronic
1148771961 17:50072517-50072539 ACATCAGAGAGGAGGCTGGAGGG + Intronic
1149782211 17:59407079-59407101 ATCTGAGAGAGGAGGCTGGAGGG + Intergenic
1152922203 17:83071677-83071699 CTCTCAGATGGGGAGCTGGAGGG + Intergenic
1154139627 18:11811380-11811402 AGCTCACAGGGGAAGGTGGGTGG - Intronic
1155593466 18:27454494-27454516 ACCTCAGTGGGGAGGCTGGTTGG + Intergenic
1157543479 18:48530494-48530516 ATCCCATAGTGGAAGGTGGAAGG + Intergenic
1157714915 18:49877797-49877819 ATCTCAGATGTGGAGATGGAGGG + Exonic
1157967467 18:52224383-52224405 ATCTCATAGCAGAAGGTGGAAGG - Intergenic
1158886384 18:61830788-61830810 TTCTCAGTGAGGCAGCTGGATGG + Intronic
1161251795 19:3284784-3284806 AGCACAGAGGAGAAGCTGGGCGG + Intronic
1161279545 19:3438302-3438324 ATCACAGAGCAGAAGCTGGTGGG - Intronic
1161554528 19:4933080-4933102 ACCCCAGAGGGGAGGCAGGAAGG - Intronic
1161717164 19:5882538-5882560 CTGGCAGATGGGAAGCTGGAAGG - Intronic
1161994834 19:7705773-7705795 ACCGCAGAGGGGAAGCGGGTGGG - Intergenic
1162331592 19:10033143-10033165 AAGTCAGAGGGGAAGAAGGAGGG + Intergenic
1164054819 19:21613831-21613853 CTCTCAGAGGAGCAGCTGGATGG - Intergenic
1164229071 19:23272145-23272167 CTCTCAGAAGAGCAGCTGGATGG - Intergenic
1164243857 19:23414003-23414025 CTCTCAGAAGAGCAGCTGGATGG - Intergenic
1164537667 19:29098460-29098482 CACTCAGAGGGGAAGGTGAAGGG - Intergenic
1164633795 19:29778416-29778438 ATCTAAGAGTGGAAGTGGGATGG + Intergenic
1165347703 19:35259149-35259171 AGCCCAGAGGGTAAGCTGGAGGG - Intronic
925434745 2:3827181-3827203 AACCCTGAGGGGAGGCTGGAAGG + Intronic
926045674 2:9708040-9708062 ATCCCAGGGAGGAAGCTAGAGGG - Intergenic
926397065 2:12454303-12454325 ATTTGATAGGGGAAGCTGGCAGG - Intergenic
926464859 2:13175639-13175661 ATTTCAGAGGGAAGGCTTGATGG - Intergenic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
928669668 2:33589028-33589050 AACTCACAGGAGAAGCAGGAAGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
928981592 2:37141306-37141328 ATTTCAGAGAAGTAGCTGGATGG - Intronic
929164843 2:38871625-38871647 ATCTCATGGTGGAAGATGGAAGG + Intronic
929172850 2:38948884-38948906 AGATCAGAGGGGAATTTGGAGGG - Intronic
930355974 2:50320647-50320669 AACACAGAGGGGAAGGAGGAGGG + Intronic
931530732 2:63211235-63211257 GTCTCAGAGGGGCACCTGGCCGG - Intronic
931767374 2:65468841-65468863 ATCTCAGAGGGGCAATTGTAAGG - Intergenic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
932581466 2:72995060-72995082 CACTGAGAGGGGAAGCTAGAAGG - Intronic
933165453 2:79070147-79070169 ACTTCAGAGGGGCAGCTTGATGG + Intergenic
933392193 2:81685302-81685324 ATATCAGAGGGGAAATTGCAGGG - Intergenic
933705981 2:85290745-85290767 ATTTAAGAGGGTAAGCTGGCAGG + Intronic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
936058947 2:109282036-109282058 GTGTCAGAGGGGATGCTGGTGGG + Intronic
936083252 2:109449392-109449414 ACCTCAACGGGGAGGCTGGAGGG + Exonic
937056733 2:118943838-118943860 AGGTCAGTGGGGAAGCAGGAAGG + Intronic
937393538 2:121514391-121514413 ATCTCTTAGGGAAAGTTGGAGGG - Intronic
937666177 2:124489728-124489750 CTCTCAGAATGGAAGATGGAGGG - Intronic
938622255 2:133068300-133068322 TGCTCTGAGGGGAAGCTGGGAGG - Intronic
938969647 2:136420513-136420535 CTCCCAGAGTGGAAGCTGGAGGG - Intergenic
939956894 2:148534710-148534732 AGCCCACAGGGAAAGCTGGAAGG + Intergenic
940177479 2:150894739-150894761 TTCTAAGAGTGGAAGCTGGTGGG + Intergenic
940624059 2:156150298-156150320 ACCTCAGAGGGAAGGCTGGTTGG + Intergenic
943536052 2:189152063-189152085 ATCTCAGAGGAGAACTAGGAAGG + Intronic
944336439 2:198540722-198540744 ATCTCAGTGGGGAAGTGGCAAGG + Intronic
944803176 2:203256263-203256285 ATCTAAAAGGGGAAACTGGCCGG - Intronic
946166802 2:217869449-217869471 AGCTGAATGGGGAAGCTGGAGGG + Intronic
946393072 2:219428321-219428343 ATCTCAGAGGAGAAACTTGAAGG - Intergenic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
948284319 2:236772061-236772083 TTCTCAGAGGGGAACCTGGCAGG - Intergenic
948375828 2:237519727-237519749 AGCCCAGAGGGGGAGCTGGTTGG - Intronic
948956715 2:241298639-241298661 TTCACAGTGGAGAAGCTGGAAGG + Intronic
1169357232 20:4917465-4917487 TTCTCAGCTGGGAAGCTGGGTGG + Intronic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1170487041 20:16828866-16828888 ATTTCAGTGGGGAAGTGGGAAGG + Intergenic
1172649856 20:36495283-36495305 ATCTCATAGTGGCAGATGGATGG + Intronic
1173129231 20:40372170-40372192 ATCTCTGAAGGTAAGCTGCATGG + Intergenic
1174467734 20:50730885-50730907 ATCCCAAAGTGGAAGCGGGAAGG + Intergenic
1175265681 20:57702066-57702088 ATTTCAGAAGGGAAGCTGAGAGG - Intronic
1175457389 20:59125674-59125696 AGCTCAGGGAGGAAGGTGGAGGG + Intergenic
1176145169 20:63562250-63562272 GGGCCAGAGGGGAAGCTGGAGGG + Intronic
1176745155 21:10645332-10645354 ATCTCTGAGGAGAATCTAGATGG - Intergenic
1177812792 21:25942881-25942903 AGTTCAGTGGGGAAGATGGATGG - Intronic
1177942308 21:27425745-27425767 TTCTCAGAGGGGGAGATGGAAGG + Intergenic
1178514372 21:33233920-33233942 AAGTCAGAGAGGAAGATGGAAGG + Intronic
1178903345 21:36615395-36615417 AACTCAGAGGGGCACCTGCAGGG - Intergenic
1181293847 22:21819103-21819125 ACATGACAGGGGAAGCTGGAGGG + Intronic
1181814655 22:25429264-25429286 TTTTTAGAGGGGAAGCTGGTGGG + Intergenic
1183929909 22:41229998-41230020 CTCCCAGAAGGGAAGCTGGAGGG + Intronic
1184001194 22:41674886-41674908 ACCTCAGGGGGGAAGCTGGCAGG + Exonic
1184130879 22:42515719-42515741 CCCTCAGTGGGGAAGCAGGAGGG + Intronic
1184141055 22:42577549-42577571 CCCTCAGTGGGGAAGCAGGAGGG + Intergenic
1184142657 22:42587242-42587264 ATATCTGAGTGGAAGTTGGAGGG - Intronic
1185329874 22:50247696-50247718 CTCTTAGATGGGATGCTGGATGG - Exonic
951173292 3:19568465-19568487 AACTGAGAGGTGAAGCTGGCTGG - Intergenic
951375317 3:21907817-21907839 ATCTCAGAGCTTAATCTGGAGGG - Intronic
952741556 3:36739015-36739037 ATCACAGAGCGGAAGCTGCAAGG - Exonic
954257912 3:49419078-49419100 AACCCAGAGGTGAAGCTGGCAGG - Exonic
954674745 3:52309535-52309557 CTCTGAGAGGTGAAGCTGGTCGG - Intergenic
956040584 3:65140992-65141014 ATCTCATGGTGGAAGATGGAAGG - Intergenic
956251506 3:67239065-67239087 ATCTCACACTGGAACCTGGAGGG - Intergenic
956255971 3:67283632-67283654 ATCCCAGTGTGGAAGGTGGAAGG + Intergenic
957290195 3:78269138-78269160 ATCCCAGAGGGCAAGCCTGAAGG - Intergenic
958529533 3:95309135-95309157 ACCTCAGAGGGACAGCTTGATGG + Intergenic
958548561 3:95588623-95588645 AGCCCACAGGGGAAGCTGGGGGG + Intergenic
959530374 3:107429565-107429587 ATCTCGGAAGGGAAACTGGGAGG - Intergenic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960820717 3:121728044-121728066 ATAGCTGAGGAGAAGCTGGAGGG + Intronic
961417934 3:126774921-126774943 ATCTCAGACTGGGTGCTGGAGGG - Intronic
963410581 3:144922166-144922188 ACCTCAGAGGGACAGCTTGATGG - Intergenic
966298877 3:178456185-178456207 ACCTCAGTGGGCAAGCTGGCTGG + Intronic
967099047 3:186200917-186200939 CTTTGAGAGGGGCAGCTGGAAGG + Intronic
968039621 3:195578359-195578381 ACCTCTGAGGGGACGCTGGGTGG - Intronic
968835587 4:2962404-2962426 ATCACAGTGTGCAAGCTGGATGG - Intronic
968980470 4:3846349-3846371 ATATCAGAGAGCACGCTGGAAGG + Intergenic
969264213 4:6054600-6054622 AGCTCTGTGGGGAAGCAGGAGGG - Intronic
969354695 4:6618573-6618595 AGCCAAGAGGGGAACCTGGAAGG - Intronic
969563216 4:7962558-7962580 AACCCAGAGGGGAGGCAGGATGG + Intergenic
969565291 4:7973792-7973814 ATCTCAGAACGCAAGGTGGATGG - Intronic
969707849 4:8821470-8821492 ACCTCAGAGGGAAGGCTGGATGG + Intergenic
970966977 4:21939353-21939375 ATCTAAACTGGGAAGCTGGAAGG - Intronic
971054557 4:22897799-22897821 ACCACAGTGGGGAAGCCGGAGGG + Intergenic
971076091 4:23151568-23151590 ATGTCAGAGGGGCAGCTTGACGG + Intergenic
971344307 4:25797987-25798009 AAGTCAGAGGGGAAGTGGGAGGG + Intronic
973833887 4:54789922-54789944 TTCTCAGAGGGGAAGCTGCTGGG - Intergenic
975201630 4:71597091-71597113 ATCTCATGGTGGAAGGTGGAAGG - Intergenic
976393918 4:84535327-84535349 ACCTGAGAGTGGAAGGTGGAGGG + Intergenic
976790318 4:88870891-88870913 ATCTCAGAGGGGCACCTGGCTGG - Intronic
977263099 4:94822130-94822152 ATCTCATGGTGGAAGGTGGATGG + Intronic
978622566 4:110648305-110648327 GTAACAGAGGGGAACCTGGAGGG - Intergenic
978629833 4:110731793-110731815 ATCTTAGAGGGAAATCTGTAGGG + Intergenic
979782501 4:124670733-124670755 ATCACAGAGATGATGCTGGATGG - Exonic
979953303 4:126922385-126922407 AACTGAGAGGTGAAGCTGGCTGG + Intergenic
980688511 4:136260992-136261014 ATCCCAGAGTGGATGCTGGAGGG + Intergenic
981554735 4:145980564-145980586 ATGACAGAGGGGAAGGTGGGGGG + Intergenic
983967627 4:173832263-173832285 ATATAAGTGGGGAAGCTGGGAGG + Intergenic
986680820 5:10231479-10231501 AGGTCAGAGAGGAAGCAGGATGG - Intronic
989444157 5:41509200-41509222 AGCTGAGAGGGGGCGCTGGATGG + Intronic
990283737 5:54278806-54278828 ACCTCAGTGGGAAAGGTGGACGG + Intronic
990706408 5:58534841-58534863 ATCTCAGAGGGGAGACATGAGGG - Intergenic
993852279 5:93025123-93025145 TCCTCAGAGGGGAAGCTGTTTGG + Intergenic
995460619 5:112399385-112399407 AACTTAGTGGGGAACCTGGATGG - Intronic
998974599 5:147630688-147630710 AGCTCAGAGTGGGAGCAGGAAGG + Intronic
1000211036 5:159105990-159106012 TTCTCAGAGGGGAGACTGGGAGG + Intergenic
1001266216 5:170276390-170276412 GTCTGGGAGGGGAAGATGGAAGG - Intronic
1001524343 5:172418113-172418135 AGCTCAGATTGGAAGCTGGCAGG - Intronic
1002048031 5:176553024-176553046 ATCTCACAGGGCAGGATGGAGGG - Intronic
1002461500 5:179376015-179376037 ATCTCAGTGGGGGAGGGGGAAGG + Intergenic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1004191579 6:13468766-13468788 ATCTCAGATGGGAGGCTGTGGGG - Intronic
1006264168 6:32903348-32903370 ATCACACAGAGGAAGGTGGAAGG - Intergenic
1006382170 6:33705451-33705473 ACCTCAGACGGGAAACTGGATGG - Intronic
1006383938 6:33718435-33718457 ATCACACAGGGGACACTGGAGGG + Intergenic
1006457353 6:34139446-34139468 TTCACAGAGAGGAGGCTGGAGGG - Intronic
1008000204 6:46352404-46352426 TCCTCAGAGGGGAAGGAGGACGG - Intronic
1008047123 6:46862860-46862882 AGCTCAGAGTGGAAGCTTTAAGG + Intronic
1008711649 6:54234940-54234962 ATCTCAGTGGAGAAGCAGAATGG - Intronic
1010179189 6:73065461-73065483 ATGTCAGAGAGGAAGCTGGAAGG - Intronic
1010923360 6:81712362-81712384 ATCTGAGAGTGGAAGGTGGGAGG + Intronic
1011779774 6:90774608-90774630 ATCTCATGGTGGAAGGTGGAAGG + Intergenic
1011863114 6:91785612-91785634 AACTGAGAGGTGAAGCTGGCTGG - Intergenic
1012267879 6:97168805-97168827 AACTCAGAGGGAAAGCAGAAAGG - Intronic
1013330701 6:109096938-109096960 AGCTGAGAGGTGAAGCTGAATGG - Intronic
1013424431 6:109998223-109998245 ATCTCAGAGGGAGAGAGGGAGGG + Intergenic
1014570071 6:122997038-122997060 ATCTCAGAGGGGTGGTGGGAAGG + Intronic
1014625449 6:123719361-123719383 ATCTCAGAGGGCCAGCATGATGG + Intergenic
1015731228 6:136350235-136350257 TTCACAGTGGGCAAGCTGGAGGG + Intronic
1016155910 6:140808557-140808579 AGGTTAGATGGGAAGCTGGAAGG + Intergenic
1016606802 6:145938292-145938314 ATCTCATGGTGGAAGGTGGAAGG - Intronic
1017622059 6:156309223-156309245 AGCACAGAGCAGAAGCTGGAGGG + Intergenic
1018955835 6:168410190-168410212 GGCTCAGAGCGGAAGCTGGGGGG + Intergenic
1019898780 7:4003358-4003380 GTGTCACAGGGGAAGCTGGGTGG - Intronic
1022239931 7:28500731-28500753 ATTTTAAGGGGGAAGCTGGAGGG + Intronic
1022272805 7:28826622-28826644 ACCTCAGTTGGGAAGTTGGATGG - Intergenic
1022335922 7:29421862-29421884 TTCTCAGAGGGGAAGATTTAAGG + Intronic
1022606957 7:31824846-31824868 AGGTCAGTGGGGAAGCTTGAGGG - Exonic
1022645159 7:32223012-32223034 ATTTCAGGGGAGAAGCTGGAAGG - Intronic
1024604827 7:51014641-51014663 ATATCCGAGGGGAAGCAGCAGGG - Intergenic
1024865040 7:53895970-53895992 ATCACAGATGGGAAGATGGATGG - Intergenic
1026931593 7:74225771-74225793 ATCTCAGCGAGCAGGCTGGAGGG + Intronic
1026944741 7:74308305-74308327 GCCTCAGAGGGGATGCTGGCTGG + Intronic
1026955099 7:74372096-74372118 ATCTTGGAAGGGAAGCTGGGAGG - Intronic
1028180469 7:87715824-87715846 ATTACTGAAGGGAAGCTGGAGGG + Intronic
1028761125 7:94497428-94497450 ATATCAAAGAGGCAGCTGGACGG - Intergenic
1029272759 7:99386666-99386688 ATCTCTGAAGGGGAGATGGAGGG - Exonic
1029600015 7:101558038-101558060 CTCGAAGAGGGGAAGCTGGCAGG - Exonic
1030089967 7:105849765-105849787 AGTTCAGATGGGAAGCAGGAGGG - Intronic
1030209983 7:106986627-106986649 ATCTGAGATGGGAAGCAGTAAGG - Intergenic
1031258938 7:119491789-119491811 ATTACTGAGGGGAAGCTGGAGGG + Intergenic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1032784241 7:135187939-135187961 GCCTCAGAGGGGGAGCTGGCAGG - Intronic
1033435400 7:141329157-141329179 ATCTCAGGTTGGACGCTGGAGGG - Intronic
1034028767 7:147737389-147737411 ATCTCAGAGGGGTACCCGGCCGG + Intronic
1034110075 7:148528279-148528301 TTTCCAGAGGAGAAGCTGGACGG - Intergenic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1035288762 7:157823867-157823889 GTCTCTAAGGGGAATCTGGAGGG + Intronic
1035437487 7:158870034-158870056 AACTCAGAGGTGAAGGTGTACGG + Intronic
1036748552 8:11428243-11428265 ATCTCTGTGGGGTAGCAGGAAGG + Intronic
1037764444 8:21763670-21763692 ATTCCAGAGAGGGAGCTGGAAGG - Intronic
1039385618 8:37133388-37133410 ATATCAGAGTGGAAAGTGGATGG - Intergenic
1039518269 8:38150920-38150942 GACTCAGAGGCGAAGCTTGAGGG - Exonic
1039519180 8:38156053-38156075 ATCTGGGAGGCTAAGCTGGAAGG - Intergenic
1040683477 8:49842138-49842160 ATTTCAGAGGGACAGCTTGACGG + Intergenic
1042831384 8:73033010-73033032 ATCTCAGGGGGGAGGGGGGAGGG - Intronic
1043572296 8:81618639-81618661 ATCGCAGAAGTGAAGCTGGGAGG - Intergenic
1043597825 8:81904518-81904540 AACTGAGAGGTGAAGCTGGCTGG + Intergenic
1044346620 8:91111725-91111747 ATCAGAGAGTGGAAGCTGGGAGG + Intronic
1044550563 8:93507507-93507529 GTCTCAAGGGAGAAGCTGGATGG + Intergenic
1044659187 8:94578724-94578746 TTCTCTGAGGGCAACCTGGAGGG + Intergenic
1046555402 8:115768053-115768075 ATCTCGGGGGGGAGGCTGGGAGG + Intronic
1048064331 8:130952043-130952065 GTCTCAGATGGGAGGGTGGAGGG + Intronic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1051532318 9:18118538-18118560 ATCTCAGACTGAAAGCTGGTTGG - Intergenic
1052851459 9:33380856-33380878 TTCCCTGAGGGGGAGCTGGAGGG - Intergenic
1055230881 9:74064016-74064038 ATCTCAGAGGTGAAAATGAAAGG - Intergenic
1057024987 9:91727955-91727977 CTTTCAGAGGGGAAGCTGCTAGG - Intronic
1057030765 9:91773637-91773659 ATCTCAATAGGGCAGCTGGAAGG - Intronic
1057201799 9:93144479-93144501 AACTCACAGGGGAACATGGACGG - Intergenic
1058737632 9:107908629-107908651 ATGTCAGAGGAGAAACGGGAGGG - Intergenic
1060015504 9:120083090-120083112 AGCTAAGAGGGGAAGGTGGGGGG - Intergenic
1060172874 9:121476152-121476174 ATCTGAGAGGGGAATCTTGATGG + Intergenic
1060397873 9:123328766-123328788 ATTGCAGAGAAGAAGCTGGAAGG - Intergenic
1060600891 9:124876613-124876635 ATCTCAAAAGGGAAGCTCGAGGG + Intronic
1061442292 9:130614068-130614090 GTCCCACAGGGGAAGCTAGAAGG - Intronic
1062018839 9:134306626-134306648 GGCTCAGAGGGGGAGCTGCAAGG - Intergenic
1062060981 9:134494878-134494900 ATCTCAGGTGTGACGCTGGAAGG - Intergenic
1062101638 9:134731598-134731620 ATCTCCGACGGGGAGCTGGTGGG - Exonic
1062645184 9:137544189-137544211 AGGTCAGAGGGGAAGTTGGGGGG - Intronic
1186360707 X:8837919-8837941 ATCACAAAGAGAAAGCTGGAGGG - Intergenic
1190233128 X:48597645-48597667 ATCTGAGAAGGGAAGGCGGAGGG + Intronic
1191641696 X:63433966-63433988 ATCTGAGAGGGGTGTCTGGAGGG + Intergenic
1191664620 X:63687199-63687221 AGCTCTGTGGGAAAGCTGGATGG - Intronic
1191966892 X:66768535-66768557 ATCTAATGGGGGATGCTGGAAGG + Intergenic
1192033879 X:67544015-67544037 ATCTCGGAGGGGGCGCTGGGAGG - Intronic
1192265627 X:69535733-69535755 AGCTCAGAGAGGCAGCTGCAGGG - Intergenic
1192576251 X:72245594-72245616 ATCTCCCAGGGGAAGCAGGAAGG + Intronic
1195033464 X:100948872-100948894 ACCCCAGTGGGGAAACTGGAGGG - Intergenic
1195672782 X:107483727-107483749 ATTACAGAGGGGCAGCTGGGAGG - Intergenic
1198613256 X:138425415-138425437 ACTTCAGAGGGAAAGCTTGATGG + Intergenic
1200035936 X:153330496-153330518 ATGGCAGAGGGAAAGCAGGAGGG - Intergenic
1200066499 X:153506606-153506628 ATCTCAGAGGCCAAGCTGACTGG + Exonic
1200958968 Y:8979968-8979990 TTCTGAGAGGTGAAGCTGGCTGG + Intergenic
1201731626 Y:17210763-17210785 ACCTCAGAGGGATAGCTTGATGG + Intergenic