ID: 1140451927

View in Genome Browser
Species Human (GRCh38)
Location 16:75077777-75077799
Sequence CCTGGAGGCCACGCTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140451922_1140451927 -6 Left 1140451922 16:75077760-75077782 CCTTGTCTTTCCCAGCTCCTGGA 0: 1
1: 3
2: 25
3: 234
4: 1049
Right 1140451927 16:75077777-75077799 CCTGGAGGCCACGCTTTCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 178
1140451920_1140451927 0 Left 1140451920 16:75077754-75077776 CCATTTCCTTGTCTTTCCCAGCT 0: 3
1: 17
2: 141
3: 354
4: 1374
Right 1140451927 16:75077777-75077799 CCTGGAGGCCACGCTTTCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140451927 Original CRISPR CCTGGAGGCCACGCTTTCCT TGG Intronic