ID: 1140452807

View in Genome Browser
Species Human (GRCh38)
Location 16:75084726-75084748
Sequence CTGTTCTTCTAATACATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140452800_1140452807 13 Left 1140452800 16:75084690-75084712 CCCTTGTCCTCACGGTGCCTAGA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
1140452803_1140452807 -4 Left 1140452803 16:75084707-75084729 CCTAGATGCTCTGCCCTCACTGT 0: 1
1: 1
2: 1
3: 19
4: 234
Right 1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
1140452798_1140452807 20 Left 1140452798 16:75084683-75084705 CCCGCTGCCCTTGTCCTCACGGT 0: 1
1: 0
2: 1
3: 27
4: 171
Right 1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
1140452801_1140452807 12 Left 1140452801 16:75084691-75084713 CCTTGTCCTCACGGTGCCTAGAT 0: 1
1: 0
2: 0
3: 21
4: 206
Right 1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
1140452796_1140452807 30 Left 1140452796 16:75084673-75084695 CCAGCTGTCACCCGCTGCCCTTG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
1140452799_1140452807 19 Left 1140452799 16:75084684-75084706 CCGCTGCCCTTGTCCTCACGGTG 0: 1
1: 0
2: 2
3: 22
4: 241
Right 1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
1140452802_1140452807 6 Left 1140452802 16:75084697-75084719 CCTCACGGTGCCTAGATGCTCTG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140452807 Original CRISPR CTGTTCTTCTAATACATCAA GGG Intronic
901550265 1:9990749-9990771 CTGTTCTTCCTAGACAGCAATGG - Intergenic
901828627 1:11878876-11878898 CTGTTCCTCGAATACCTCAATGG - Intergenic
903933744 1:26880182-26880204 CTGTTCTTCCAAAACATCCCGGG + Intronic
907879941 1:58539398-58539420 TTGTTCTTCTAACACATCTCAGG + Intronic
909649905 1:77962686-77962708 CGTTTATTCAAATACATCAAAGG - Intronic
910072917 1:83241690-83241712 CAGTTCTTCTAAGACATACATGG - Intergenic
911502803 1:98709512-98709534 ATGTCCTTCTGATGCATCAATGG - Intronic
914269754 1:146069571-146069593 CTGTTGCTCCAATACATAAAAGG + Exonic
914270294 1:146074299-146074321 CTGTTGCTCCAATACATAAAAGG + Exonic
914270831 1:146079035-146079057 CTGTTGCTCCAATACATAAAAGG + Exonic
914271368 1:146083765-146083787 CTGTTGCTCCAATACATAAAAGG + Exonic
914271903 1:146088492-146088514 CTGTTGCTCCAATACATAAAAGG + Exonic
914272440 1:146093210-146093232 CTGTTGCTCCAATACATAAAAGG + Exonic
914272978 1:146097932-146097954 CTGTTGCTCCAATACATAAAAGG + Exonic
914273516 1:146102654-146102676 CTGTTGCTCCAATACATAAAAGG + Exonic
914274055 1:146107372-146107394 CTGTTGCTCCAATACATAAAAGG + Exonic
914274592 1:146112082-146112104 CTGTTGCTCCAATACATAAAAGG + Intronic
914275125 1:146116800-146116822 CTGTTGCTCCAATACATAAAAGG + Intronic
914275662 1:146121526-146121548 CTGTTGCTCCAATACATAAAAGG + Exonic
914532591 1:148536252-148536274 CTGTTGCTCCAATACATAAAAGG + Exonic
914533126 1:148540978-148541000 CTGTTGCTCCAATACATAAAAGG + Exonic
914533661 1:148545692-148545714 CTGTTGCTCCAATACATAAAAGG + Exonic
914534197 1:148550400-148550422 CTGTTGCTCCAATACATAAAAGG + Exonic
914534733 1:148555108-148555130 CTGTTGCTCCAATACATAAAAGG + Exonic
914535805 1:148564567-148564589 CTGTTGCTCCAATACATAAAAGG + Exonic
914536341 1:148569283-148569305 CTGTTGCTCCAATACATAAAAGG + Exonic
914537237 1:148577211-148577233 CTGTTGCTCCAATACATAAAAGG + Exonic
916965263 1:169933339-169933361 CTGTTCTTCTAATACATTTCTGG - Intronic
922155379 1:223036834-223036856 ATGTTCTTCTAAAATATCAGAGG - Intergenic
922991687 1:229918928-229918950 CTGTTCTTTTAATTCATTTATGG - Intergenic
923518700 1:234719685-234719707 CTGTTTTGCTAATGGATCAATGG + Intergenic
1063548124 10:7001642-7001664 CTGTTGTTCTAACAAATCCAGGG + Intergenic
1066499206 10:35973704-35973726 AAGTTAATCTAATACATCAATGG + Intergenic
1066586493 10:36942279-36942301 TTGTTATTCTAAAACATGAAGGG + Intergenic
1066627044 10:37417603-37417625 AAGTTAATCTAATACATCAATGG + Intergenic
1066678720 10:37915422-37915444 TTTTTCTTCTAATACTCCAAAGG + Intergenic
1068745983 10:60530953-60530975 CTCTTCATTTAATACATTAATGG + Intronic
1068926590 10:62545922-62545944 CTCTTTTTCTAATTCAGCAATGG + Intronic
1069312575 10:67056528-67056550 CTGTACTTCTTAAGCATCAAAGG + Intronic
1070101257 10:73389255-73389277 GTGTTCTTCAAAAGCATCAAGGG + Intronic
1072558461 10:96545160-96545182 CTGTCTTTCTAATACAGCAGAGG + Intronic
1073439798 10:103545665-103545687 CTGCTGTTCTCATACAGCAAAGG - Intronic
1073686233 10:105757052-105757074 CTGTTGGTCTATTACATTAAAGG + Intergenic
1076101190 10:127780075-127780097 CTGTTTTTCTAATACATGTGTGG + Intergenic
1078984084 11:16573397-16573419 CTATTCTTTTTAAACATCAAAGG - Intronic
1080626140 11:34032441-34032463 CTGGTCTTCCATTACATCAGTGG + Intergenic
1081013537 11:37846599-37846621 TTTTTATTCTAATAAATCAATGG - Intergenic
1081656068 11:44858384-44858406 CTGTGCTTGTAATAACTCAAAGG - Intronic
1086116212 11:83253921-83253943 ATCCTCTTCTAATACATAAAAGG + Intronic
1086197657 11:84160286-84160308 CTGTTCTTTTACCACCTCAATGG - Intronic
1090480348 11:127062151-127062173 CTGTTCTTCCAATCCATGACAGG - Intergenic
1093005458 12:14046297-14046319 CTAGTCTTCCAATAGATCAAAGG - Intergenic
1094345929 12:29469248-29469270 CTATTCTTATTATATATCAAGGG - Intronic
1095535428 12:43240447-43240469 GTTTTCTTCTAATATATTAAAGG + Intergenic
1095540012 12:43298703-43298725 CTGTTTTCCTAATAAGTCAATGG + Intergenic
1095859490 12:46900764-46900786 CTGTTTTTTTAATCCATTAAGGG + Intergenic
1099303178 12:80922873-80922895 CTGTTTTTCTTATACAGTAATGG - Intronic
1099470714 12:83044374-83044396 CTGTTCCTGTAATACATCAGAGG - Intronic
1100710521 12:97251408-97251430 CTGATCTTCCAAGAAATCAAGGG + Intergenic
1105557424 13:21459592-21459614 CTGTCCCTCTCATCCATCAAGGG - Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107886658 13:44879297-44879319 CTGTTCTTCTAATGCTTCCCAGG - Intergenic
1108580139 13:51821046-51821068 CTGTTGATCTAAGACATCAAAGG - Intergenic
1109824094 13:67694624-67694646 CTGTTCTTGTACTACATCACAGG + Intergenic
1110871898 13:80462202-80462224 TTGTTCTTCTCATACTTCACTGG + Intergenic
1110875891 13:80510054-80510076 CTATTCTTAAAATCCATCAAGGG - Intergenic
1112066855 13:95802171-95802193 CTGTTGTTCCATTACATTAAGGG - Intronic
1112885553 13:104166563-104166585 CTGTTATTTTTATTCATCAAGGG - Intergenic
1115435451 14:33367225-33367247 ATGTGCTTCAAATACTTCAATGG - Exonic
1116638780 14:47434346-47434368 CTGTTTTTCAAATAAATTAAAGG - Intronic
1123689634 15:22827280-22827302 CTGTTCTGCTCATTGATCAAAGG + Exonic
1124596306 15:31094379-31094401 CTGTTCATCAAATTCATCAAAGG + Intronic
1126835423 15:52659093-52659115 CAGCTCTTCTAAAACATCATAGG + Intronic
1129147538 15:73662530-73662552 CTTTTCTTTTAATCCATAAAAGG + Intergenic
1131389487 15:92035209-92035231 CTGTTCTACAAATTCATCTAAGG - Intronic
1131802062 15:96080935-96080957 CTGTTCTACTAATATAGCTATGG - Intergenic
1132028706 15:98423183-98423205 CTGTTCTATTAATTCATAAATGG + Intergenic
1135792423 16:25409407-25409429 ATGACTTTCTAATACATCAATGG + Intergenic
1136481441 16:30544567-30544589 CTGTTGTCCTAAGACATCGAGGG + Intronic
1138862906 16:60780185-60780207 CTGTTCTTCTTATCCATCTTTGG + Intergenic
1139873233 16:70124454-70124476 CTATTGTTCTCATAGATCAATGG + Intronic
1140362548 16:74356851-74356873 CTATTGTTCTCATAGATCAATGG - Intergenic
1140452807 16:75084726-75084748 CTGTTCTTCTAATACATCAAGGG + Intronic
1144100186 17:11936031-11936053 CTGTTTTTCTTATTCAGCAAGGG + Intronic
1146591069 17:34128365-34128387 CTGTTCTTGTAATGCATCAAGGG + Intronic
1149083815 17:52690225-52690247 ATGTGCTTCTAATAAAGCAATGG + Intergenic
1149875724 17:60230920-60230942 TTGTTTTTCTAAAACATCAAAGG + Intronic
1154323433 18:13372440-13372462 CATTTCTTCTAATAGTTCAAGGG - Intronic
1155751690 18:29431377-29431399 CTGTTGTTCTAATATATAAATGG - Intergenic
1156394769 18:36689569-36689591 CCTTTCTTCTAATACTTAAAAGG - Intronic
1156409804 18:36816909-36816931 CAGTTCTACTAATACCTAAAGGG + Intronic
1158781090 18:60652802-60652824 CAGTTCTTCTAATACATGTAAGG + Intergenic
1160303979 18:77714569-77714591 CTGGGCTTCTAATGCATAAAGGG - Intergenic
1162672866 19:12272599-12272621 CTTTCCTTCTAAGACATGAAAGG - Exonic
1163089029 19:15005546-15005568 CTGTTCTTCAAATACATATCAGG + Intronic
1166533666 19:43557888-43557910 CTACTCTTCAAAAACATCAAAGG - Intronic
1166633592 19:44429674-44429696 CGGTTCTTCTTATTCATCAAGGG - Exonic
926610783 2:14944547-14944569 CTGTTCTTTTAATACCTTCATGG - Intergenic
930136596 2:47908326-47908348 CTCTCCTTCTAATATATTAATGG + Intergenic
930654839 2:53997674-53997696 CTGTGCTCCTATTACACCAAAGG - Intronic
930722702 2:54653515-54653537 CTGTTCTGCTCATACACTAAAGG - Intronic
933555616 2:83826822-83826844 CTGTTCTTGTAAAACATAGATGG + Intergenic
935014031 2:99162808-99162830 CTGTTCATATAACACATGAAAGG - Exonic
935156467 2:100487766-100487788 CTGTCCCTCGAAAACATCAAGGG + Intergenic
942204981 2:173611146-173611168 CTGTTCTTGTAATACTGCATGGG + Intergenic
945901815 2:215546688-215546710 CTTCTTTTCTAATACAACAAAGG - Intergenic
947775796 2:232708284-232708306 ATGTTCTTATAATACATTATGGG - Intronic
948107217 2:235424462-235424484 CTGTTCCACTTATACAGCAAAGG - Intergenic
1170272962 20:14548799-14548821 CTGTTCATTTAATACTTCCAGGG - Intronic
1172354540 20:34270279-34270301 CTGTTCTTGTTATAAATCCAAGG + Intergenic
1172426807 20:34861099-34861121 CTAATCTTCCAATATATCAAGGG + Intronic
1182923918 22:34105116-34105138 CAGTGCTTCTGATACATCAATGG + Intergenic
951590831 3:24262547-24262569 CTGTTCCTCAAACATATCAAGGG + Intronic
952138339 3:30449569-30449591 TTGTTGTTCTAATGTATCAAAGG + Intergenic
954004502 3:47579954-47579976 TTGGTCTTCTAAGACAGCAATGG - Exonic
956330996 3:68108304-68108326 TTATTTTTCTAATGCATCAATGG + Intronic
958050670 3:88340534-88340556 GTGTTCTTCTAAGATATCACTGG + Intergenic
958499799 3:94890591-94890613 TTCTTGTTCTAATACATTAAGGG - Intergenic
959273992 3:104254011-104254033 CTGTTTTTCAAATACTTCCAAGG + Intergenic
960029658 3:113044516-113044538 CTCTTCTTATTATACATTAAGGG + Intergenic
964059038 3:152498716-152498738 CTGTTCATTTAATAAATAAAAGG - Intergenic
965183588 3:165435399-165435421 CTGCTCTTCTTTTACATCACAGG - Intergenic
966066347 3:175826429-175826451 CTGTTCTTCTTCTATATCAGTGG - Intergenic
967732762 3:192921053-192921075 CTATTCTTCTAATTCAACAAGGG - Intergenic
967925708 3:194644896-194644918 TCCTTTTTCTAATACATCAATGG + Intronic
967937095 3:194737901-194737923 CTGTTCTACTAATAAAATAATGG - Intergenic
969407843 4:7006547-7006569 TTGTTCTTGTAAAACTTCAAAGG + Intronic
971353706 4:25875467-25875489 CTGTTCTTGTAATTGACCAAGGG - Intronic
971589050 4:28443470-28443492 ATTTTCATCTAATACATGAAAGG + Intergenic
975363544 4:73501081-73501103 ATGTACTTTTAAGACATCAATGG + Intronic
975748207 4:77495105-77495127 ATGTTCATATAATAGATCAAAGG - Intergenic
978160982 4:105547771-105547793 CTGTTTTTCTCCTACCTCAATGG + Intergenic
978233282 4:106426290-106426312 CTGTCCTTCCAATATGTCAAAGG - Intergenic
978270891 4:106889242-106889264 CTCCTCTTCAAAAACATCAACGG + Intergenic
978757376 4:112317569-112317591 CTGGGCTTCTTATACATCGATGG + Intronic
980081186 4:128345779-128345801 CTGTCCTTCTGATACAGCACAGG - Intergenic
980190815 4:129522722-129522744 CTGAGCTTTTAATACATCAATGG + Intergenic
982584571 4:157221309-157221331 CTTTTCTTCTATTGTATCAAAGG - Intronic
984208677 4:176818503-176818525 CTTTTTTTCTAAAGCATCAATGG - Intergenic
984395701 4:179196403-179196425 ATGTTATTGTAATACATCACTGG - Intergenic
985321226 4:188713628-188713650 CTGTCTTCCTAATACATCAAAGG + Intergenic
987631301 5:20476804-20476826 CTGTTCTTCAAATAGATACATGG - Intronic
988804896 5:34731053-34731075 CTTTTACTCTGATACATCAAAGG - Intronic
990200518 5:53367517-53367539 CTGGTCTTCCAAGACCTCAATGG - Intergenic
993058119 5:83006287-83006309 CTGTTTTACTAATACTTCACAGG + Intergenic
993992487 5:94676684-94676706 CTGTTGTCCTATCACATCAAGGG - Intronic
994193178 5:96891738-96891760 ATGTTCTTCTAAGACAGCAGAGG - Intronic
994694939 5:103062444-103062466 ATCTTCTGCTAAAACATCAATGG + Intergenic
995741733 5:115363122-115363144 TTGTTTTTCCAATACATCATTGG - Intergenic
998523573 5:142822042-142822064 CTGTTCTTCTAAGAGTTCATTGG + Intronic
999551747 5:152695095-152695117 CTGTTCTTCAAACACAATAATGG + Intergenic
1001227120 5:169954585-169954607 CTGTTCTTCTATTTTATGAAAGG + Intronic
1003349139 6:5299461-5299483 CTTTTCTTCTATAACAGCAATGG + Intronic
1003836966 6:10081744-10081766 CTCTTCTTCTGATCCCTCAATGG + Intronic
1004417237 6:15436209-15436231 CGATTCTTCTGATACACCAAGGG - Intronic
1004981886 6:21033432-21033454 CTTTTCTTCTATGATATCAACGG - Intronic
1008307672 6:49924644-49924666 CTTTGCATTTAATACATCAAGGG + Intergenic
1014437738 6:121438911-121438933 CTTTTTTTTTAATACATCAGTGG + Intronic
1016050535 6:139525815-139525837 CTGTGCTTTTAATATAACAAGGG - Intergenic
1016651350 6:146464596-146464618 CTTTTCTTCTGATATATTAAAGG + Intergenic
1019805022 7:3117445-3117467 CTTTTCTTCTGATAAATGAAGGG - Intergenic
1020412991 7:7913903-7913925 CTTCTCTACTAATACATGAAGGG - Intronic
1022676000 7:32499546-32499568 CTGTATTTCTAATACAAAAAAGG + Intronic
1023114520 7:36848758-36848780 CTGATCTTCTATTACAAAAAGGG - Intergenic
1023658427 7:42449235-42449257 CTGCCCTTTTAATACATTAAGGG - Intergenic
1024540923 7:50474455-50474477 CTGTTCTTCTGCTCCATCCAGGG - Intronic
1027290648 7:76706842-76706864 CAGTTCTTCTAAGACATACATGG - Intergenic
1027757342 7:82230961-82230983 CTGTACCTCTGATACATGAAGGG + Intronic
1028403712 7:90453409-90453431 CTGCTCTTCTAATATTTCAAAGG - Intronic
1028967211 7:96815776-96815798 CTGTTCTTTTTATTCCTCAATGG - Intergenic
1030899609 7:115106145-115106167 CTATTCTTATAATAAACCAATGG + Intergenic
1030938479 7:115616004-115616026 ATGTTGGTCTACTACATCAAGGG - Intergenic
1037305594 8:17500126-17500148 CTGCTCTTAAAATCCATCAATGG - Intronic
1038142613 8:24863305-24863327 GTGTTCCTGTAAGACATCAATGG + Intergenic
1039486609 8:37915163-37915185 CTCTGCTTCTAAAGCATCAAGGG + Intergenic
1040397011 8:47009887-47009909 CTGTCCTTCTACTGAATCAAGGG + Intergenic
1041210915 8:55549985-55550007 CTGTTCTTCTAAGACTGAAATGG - Intergenic
1041288360 8:56283755-56283777 TTCTTCCTCTAATGCATCAAGGG + Intergenic
1048775105 8:137936855-137936877 CTGTTCTCCTCTTACATAAAAGG - Intergenic
1050576913 9:7006443-7006465 CTGTTTTTCAAACACCTCAAAGG - Intronic
1051734121 9:20180709-20180731 CTGTGCTTTTCCTACATCAAGGG + Intergenic
1053754739 9:41293984-41294006 CTGTTCTTCAAATTCATTCAGGG - Intergenic
1054260260 9:62858287-62858309 CTGTTCTTCAAATTCATTCAGGG - Intergenic
1054331507 9:63761718-63761740 CTGTTCTTCAAATTCATTCAGGG + Intergenic
1054917085 9:70504821-70504843 TTGATCATCTTATACATCAATGG - Intergenic
1055316692 9:75041007-75041029 TTGTTCTTCCACTACACCAAAGG - Intergenic
1057031798 9:91781728-91781750 CTGTTCTTATATTCCTTCAAGGG + Intronic
1202798878 9_KI270719v1_random:154632-154654 CTGTTCTTCAAATTCATTCAGGG + Intergenic
1188170282 X:26916322-26916344 CTGTTCTCCTAAATAATCAAGGG - Intergenic
1189763756 X:44348142-44348164 GTGTCCTTCTAGTTCATCAAAGG + Intergenic
1190176440 X:48154584-48154606 TTCTTCTTCTAAAACCTCAAGGG + Intergenic
1190181851 X:48198940-48198962 ATTTTCTTCTAAAACCTCAAGGG - Intronic
1190187138 X:48245112-48245134 TTCTTCTTCTAAAACCTCAAGGG - Intronic
1190191613 X:48281229-48281251 TTCTTCTTCTAAAACCTCAAGGG - Intergenic
1190194894 X:48308427-48308449 ATTTTCTTCTAAAACCTCAAGGG - Intergenic
1190203052 X:48380762-48380784 TTCTTCTTCTAAAACTTCAAGGG + Intergenic
1190207486 X:48414651-48414673 TTCTTCTTCTAAAACTTCAAGGG - Intergenic
1190210962 X:48447524-48447546 TTCTTCTTCTAAAACCTCAAGGG + Intergenic
1190656031 X:52612892-52612914 TTCTTCTTCTAAAACCTCAAGGG - Intergenic
1190661331 X:52656626-52656648 TTCTTCTTCTAAAACCTCAAGGG - Intronic
1192364333 X:70458318-70458340 CTCTTCTTTTAATACATAAAAGG + Intronic
1197631921 X:128870844-128870866 CAGTTATTCTAAAACATCACAGG + Intergenic
1201984293 Y:19947742-19947764 CTGTGCTCCTATTACATCCAAGG - Intergenic