ID: 1140453763

View in Genome Browser
Species Human (GRCh38)
Location 16:75092589-75092611
Sequence TTGTATGGACAAATGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140453763 Original CRISPR TTGTATGGACAAATGGATCA GGG Intronic
901001213 1:6149647-6149669 ATGAATGGATAAATGGATGATGG + Intronic
901001297 1:6150140-6150162 ATGGGTGGACAAATGGATGATGG + Intronic
901001300 1:6150159-6150181 ATGGATGGACAAATGGATGATGG + Intronic
901001319 1:6150278-6150300 ATGGATGGACAAATGGATGATGG + Intronic
905382133 1:37570196-37570218 ATGAATGGACTAATGGATCTCGG + Intronic
905537395 1:38733500-38733522 TTGTATGGACAAAAGAAGGAAGG + Intergenic
905792021 1:40794875-40794897 TGGTAGGGACAGAGGGATCAGGG + Intronic
906478977 1:46188139-46188161 TTTTGTGGAGAAATGGGTCATGG - Intergenic
907115627 1:51965830-51965852 TAGTTTTGACAAATGTATCATGG + Intronic
908916866 1:69138242-69138264 TTTTATGGACCAGTGGTTCAGGG + Intergenic
910998425 1:93134859-93134881 TTTTATGGACAAAAGGATTTAGG - Intronic
911363378 1:96907221-96907243 TTGTTTTGACAATTGGATGATGG - Intergenic
916021323 1:160795139-160795161 TAATATGGACAAAGGCATCAGGG - Intergenic
918772708 1:188583396-188583418 TTGTCTGGCCAATTGGTTCATGG + Intergenic
920382222 1:205541794-205541816 TTGTAGGGACAAAAGCACCAAGG - Intergenic
924085015 1:240442092-240442114 TTGAAAAGACACATGGATCACGG - Intronic
1062872109 10:914354-914376 TTGTATGGTCAAAATGATAAGGG + Intronic
1063500447 10:6548966-6548988 ATGAATGGATAAATGGATCATGG - Intronic
1063707791 10:8447707-8447729 ATCTATGGATAAATGGATAAAGG + Intergenic
1064785280 10:18888054-18888076 TTGTATGAACAAATTGAAGATGG - Intergenic
1065988674 10:30983877-30983899 CTTTATGGACAACTGGATGAAGG - Intronic
1067244016 10:44521150-44521172 TAGTTTTGACAAATGGACCATGG - Intergenic
1068067710 10:52152606-52152628 TTCTATGGTCAAATGTAGCATGG + Intronic
1068528579 10:58159055-58159077 ATGGATGGTCAAATGAATCATGG - Intergenic
1073640049 10:105243216-105243238 TTGCATTGACAAATGGATTTAGG - Intronic
1074333626 10:112545286-112545308 TTGTAGGGACAAATGGACAGTGG + Intronic
1074367955 10:112875200-112875222 TCATTTTGACAAATGGATCATGG - Intergenic
1075337845 10:121621555-121621577 TTTTATGAACAAATGATTCAAGG + Intergenic
1076933789 10:133554240-133554262 TTCCATGGAAAAATGGAACATGG - Intronic
1080485726 11:32704716-32704738 TTGATTGGCCAAAGGGATCAAGG - Intronic
1082647141 11:55741122-55741144 TTGAATGAACTAATGGATCAAGG + Intergenic
1084785656 11:71440394-71440416 GTGGATGGACAAATAGATGACGG + Intronic
1085564574 11:77501543-77501565 TTGTATGGATCACTGGAACAGGG - Intergenic
1085676613 11:78526147-78526169 TGGTTTTGACAAATGTATCATGG + Intronic
1086666120 11:89485025-89485047 GTCTCTGGACAAATGGATCTAGG - Intronic
1088399998 11:109413052-109413074 TTTTATGGTCAGATGAATCAAGG - Intergenic
1088530231 11:110800120-110800142 TAGTAGGGAGAAATGGATGAAGG + Intergenic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1092175400 12:6401678-6401700 TAGTTTTGACAAATGTATCATGG - Intergenic
1093126825 12:15340223-15340245 TTCTGTGGTCAAATGGACCAAGG - Intronic
1094331717 12:29301390-29301412 TTATGTGCATAAATGGATCAGGG + Intronic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1098946647 12:76597197-76597219 TTCTCTGGACAAATGTAGCAGGG + Intergenic
1100000629 12:89830726-89830748 TTAAGTGGACAATTGGATCAAGG - Intergenic
1100649887 12:96573616-96573638 ATGGATGGACAAAAGGGTCAGGG - Intronic
1102452729 12:113053843-113053865 GTGTATGGATGAATGGATGATGG + Intergenic
1104926017 12:132314173-132314195 GTGGATGGATAAATGGATGATGG - Intronic
1105555589 13:21445230-21445252 TTTAATGGACAAATGTATAATGG + Intronic
1106208915 13:27622661-27622683 GTGGATGGTCAAATGGAGCAGGG + Intronic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108868616 13:54953235-54953257 TTGTATGGATATATGGACTATGG - Intergenic
1109231698 13:59765297-59765319 TTCTATTGGCAAATGTATCATGG + Intronic
1110826928 13:79981729-79981751 TGGTTTGGACAAATGTATGATGG + Intergenic
1111835696 13:93385960-93385982 TTGTATGGATAAATAAATGAAGG + Intronic
1115949416 14:38703224-38703246 TTATTTGGATAAATGGGTCAGGG - Intergenic
1116840020 14:49810499-49810521 GAGGATGGACAAATAGATCAAGG - Intronic
1117503099 14:56374040-56374062 TTGTGAGGAGGAATGGATCAGGG + Intergenic
1118278157 14:64404487-64404509 TTTTACGGACAAATGTATGAAGG + Intronic
1120433183 14:84445124-84445146 TTGCATGGCCAGATGAATCAAGG - Intergenic
1120600417 14:86498127-86498149 ATGAATGGACAAATGAATTATGG + Intergenic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1124200555 15:27675277-27675299 CAGTCTGGATAAATGGATCAAGG + Intergenic
1124986839 15:34626390-34626412 TTTTTTTGACAAATGAATCAGGG + Intergenic
1125291596 15:38154603-38154625 TTGAATGGACACAAGGATTAAGG - Intergenic
1126979547 15:54226806-54226828 GTGTCTGGACAGAGGGATCATGG + Intronic
1127709342 15:61579991-61580013 TAGTTTTGACAAATGTATCATGG - Intergenic
1130733832 15:86527932-86527954 TTGGATGGATGAATGGATGATGG - Intronic
1132106009 15:99063128-99063150 TTCTATGTAAAAATGGATCCAGG + Intergenic
1133137979 16:3725462-3725484 TTGTTTGAACACATGGCTCAAGG + Exonic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133772154 16:8873220-8873242 TTGTTTGAACAAATGTATAATGG + Intergenic
1136528995 16:30854143-30854165 TTGTTTCAACCAATGGATCATGG - Intronic
1137065945 16:35843551-35843573 TTCTATGGAAAAATAGACCATGG + Intergenic
1137630723 16:49942053-49942075 TTCAATTGAAAAATGGATCAAGG + Intergenic
1139605634 16:68016197-68016219 TGGGATGGACAAAGGGATCATGG + Intronic
1140453763 16:75092589-75092611 TTGTATGGACAAATGGATCAGGG + Intronic
1141155310 16:81593090-81593112 TTTTATGGCCACATGGCTCAAGG - Intronic
1141289118 16:82701305-82701327 TTGGATGGAAAAAGAGATCATGG - Intronic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1142550937 17:739070-739092 TTTTATGGGGAAATGGATCTGGG - Intronic
1148236049 17:45969896-45969918 ATGTATGATCAAATGGATAATGG - Intronic
1150688184 17:67337586-67337608 GTGTTTGGACAAATGTATAATGG - Intergenic
1150848128 17:68679939-68679961 GTGGATGGACAAATGGGTAATGG - Intergenic
1155910968 18:31504069-31504091 TTGAGTGGACGAATGTATCAAGG - Intronic
1156763383 18:40620811-40620833 TTTTATGGAGAAATGGATATTGG + Intergenic
1156921666 18:42529764-42529786 TTGTATGGAGGAATAGATAAGGG + Intergenic
1157584947 18:48794924-48794946 TTGCATGGATAGATGGGTCAGGG + Intronic
1161090418 19:2357377-2357399 ATGGATGGACAAATGGATGGTGG - Intergenic
1161934503 19:7363323-7363345 GTGAATGGATAAATGGATGATGG + Intronic
1163005553 19:14394873-14394895 TTGGATGGGGAAATGGATGAGGG - Intronic
1165190324 19:34057493-34057515 GTATATGGATAAATGGATGATGG + Intergenic
1166762229 19:45232144-45232166 CTGTCTGGTGAAATGGATCATGG - Intronic
925833754 2:7922782-7922804 TAGTTTTGACAAATGGACCACGG + Intergenic
925925624 2:8668101-8668123 ATGGATGGAAAAATGGATGAAGG + Intergenic
926730930 2:16034846-16034868 CTGTTTGGACACATTGATCAAGG + Intergenic
928885320 2:36141982-36142004 TTGTATGGAGAAATAGATATGGG - Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929368127 2:41186628-41186650 TGGTATGGAAAAATAGATCAAGG - Intergenic
930187257 2:48422295-48422317 TTGTATGGTCATTTAGATCAGGG - Intergenic
931596036 2:63944717-63944739 TTTAATGTACAAATGGAACATGG - Intronic
931934748 2:67184931-67184953 TTGTAGTGATAAATGGAACAGGG - Intergenic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936809439 2:116379420-116379442 TTGTATGGATAAATAAATCAAGG + Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939715129 2:145574447-145574469 TAGTTTGGACCAATGGATTATGG + Intergenic
940343931 2:152610093-152610115 TTATATGGAAAGATGGGTCAAGG + Intronic
941541855 2:166795899-166795921 TAGTATGGAGAAATGTATAAGGG - Intergenic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
943758118 2:191579102-191579124 TTGTATGGATAAAGCAATCAAGG + Intergenic
943952031 2:194142625-194142647 TTGTTTTGACAAATGTATAATGG + Intergenic
945586197 2:211666760-211666782 TTTTAGGGAGAAATGGGTCAGGG - Intronic
945804611 2:214475225-214475247 TTTTATGCCCAAATGGACCAGGG + Intronic
948085870 2:235247163-235247185 TAGAATGGACAACTGGATGAGGG + Intergenic
1168919493 20:1519390-1519412 ATGTATGTTTAAATGGATCATGG + Intergenic
1170348610 20:15415770-15415792 TTGCATGGATATATGGATGATGG - Intronic
1170757744 20:19219373-19219395 TTGAATGAACAAATGGGTGAAGG - Intronic
1172057687 20:32165766-32165788 TTGTTTTAACAAATGGATCCAGG + Exonic
1172331413 20:34078425-34078447 TTTTCTGGACAAATGGCTCAGGG + Intronic
1172395745 20:34603432-34603454 TTGTATTGAAAACTGGATAAAGG - Intronic
1172793047 20:37519459-37519481 TTATTTGGGAAAATGGATCATGG + Intronic
1174310914 20:49653607-49653629 TTGTAGGGATAAAAGGAACAAGG - Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1175817390 20:61890444-61890466 ATGGATGGATAAATGGATGATGG + Intronic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1177761971 21:25412281-25412303 CTGTGTGGACAGATGGCTCAAGG + Intergenic
1177825388 21:26077167-26077189 TGTTATGGAGAAATCGATCAAGG - Intronic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1180025117 21:45156428-45156450 ATGGATGGACGAATGGATGATGG - Intronic
1184659055 22:45957232-45957254 ATGTATGTAAAAATGCATCAAGG + Intronic
949588120 3:5463493-5463515 TTGTTTGGAGAAATGGTTCTGGG + Intergenic
950686813 3:14624373-14624395 TTGTAGGGACAACTGGAAGAGGG + Intergenic
951713105 3:25606318-25606340 TGGTATGTGCACATGGATCATGG - Intronic
954883761 3:53854294-53854316 TAGTTTTGACAAATGTATCATGG - Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957993532 3:87658180-87658202 TTGTAGGGAGAAATGAACCATGG + Intergenic
961341807 3:126228602-126228624 TTTTAGGGAGAAATGGATGAAGG - Intergenic
962735632 3:138322937-138322959 TTGTCTGGGCAACTGGAACATGG - Intronic
964820370 3:160762224-160762246 TAGTATGGACAAATGCCTTATGG + Intronic
965755749 3:172025437-172025459 TTGTGTGGTCAAAAGGATAAGGG - Intergenic
966257107 3:177929687-177929709 TTGTATGCACAATGGGTTCAAGG - Intergenic
967190323 3:186979126-186979148 TTGTGTGAACAAATGAATGAGGG + Intronic
968793490 4:2686185-2686207 TTGTAGGGACAAAAGTAACAGGG - Intronic
969510318 4:7614034-7614056 GTGGATGGATAAATGGATTATGG - Intronic
970356511 4:15258994-15259016 CTGTATGCACAAATGCATGAAGG - Intergenic
970677365 4:18466448-18466470 ATTTATGGCCAAATGGCTCAGGG - Intergenic
971174175 4:24264830-24264852 TTTTGTGGCCAAATGGATCTGGG + Intergenic
971682032 4:29712401-29712423 TTCAGTGGACAAATGGATAAAGG - Intergenic
974090720 4:57307958-57307980 TTGGATGGATAAATGGTTGATGG - Intergenic
976192990 4:82506644-82506666 TTGTATGAACTAGTGGTTCATGG + Intronic
978107680 4:104923987-104924009 GTGAATGGAAAAATGCATCAAGG - Intergenic
978834447 4:113131907-113131929 ATGTATAGACAAAAGGATTAAGG + Intronic
978998729 4:115189597-115189619 GGGTATGGACAAATGTATAATGG + Intergenic
982352880 4:154435079-154435101 TTGTTTTGACAAATGCACCATGG + Intronic
983611308 4:169648241-169648263 TAGTTTTGACAAATGTATCATGG + Intronic
985709249 5:1419062-1419084 TAGGATGGACAGATGGATAATGG - Intronic
985907864 5:2855258-2855280 TTGTATAGAAAAATTGATTAGGG - Intergenic
987963002 5:24834760-24834782 TTGTATTGACAAGTGCATGATGG + Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
991132109 5:63134296-63134318 TTGTTTTGACAAATGTATCATGG + Intergenic
992149168 5:73885112-73885134 TTTTATGGAGGAAGGGATCAAGG + Intronic
992713682 5:79487344-79487366 TTGTATGTTCAAGTTGATCATGG - Intronic
996278961 5:121704222-121704244 TTGTATAGAACAATCGATCATGG - Intergenic
997602905 5:135152510-135152532 TAGGATGGACAGAGGGATCATGG - Intronic
998602586 5:143600272-143600294 TTGAATGAATAAATGGATTAAGG + Intergenic
999405020 5:151299173-151299195 TTGGTTGAACAAATGGATGAAGG - Intronic
999960588 5:156752038-156752060 TAGAATGGACAAATAAATCATGG + Intronic
1002993619 6:2261363-2261385 GGGTATGGACAAATGTATAATGG + Intergenic
1004786079 6:18968680-18968702 TTGTATAGGCAAATGTATAATGG - Intergenic
1004842054 6:19598638-19598660 TTGTATTGGCATCTGGATCATGG + Intergenic
1005031042 6:21509490-21509512 TTGAATGGATAAATGAATTAGGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006324024 6:33339697-33339719 TTGTATTGAAAAAGAGATCATGG + Intergenic
1008674110 6:53801124-53801146 TTGTATGAACAAAGGTTTCATGG + Intronic
1010347870 6:74833931-74833953 TAGTATGGACAAAAGCACCATGG + Intergenic
1010651240 6:78457631-78457653 TTGGATGAATAAATGGAGCAGGG - Intergenic
1011761359 6:90569402-90569424 CTGTATGGATCATTGGATCAGGG - Intronic
1012623445 6:101377314-101377336 TTGTCTGGCGGAATGGATCATGG + Intergenic
1014469023 6:121792142-121792164 TTGTTTAGACAAATGCCTCAGGG - Intergenic
1015094451 6:129398142-129398164 TTGTTTGAATTAATGGATCAAGG - Intronic
1017233479 6:152096566-152096588 ATGGATGAACAAATGGCTCATGG + Intronic
1018143876 6:160864999-160865021 TTGAAGGGACAAATGAAACATGG - Intergenic
1021981474 7:26059578-26059600 TTGAATGGACACAGGGATGAGGG - Intergenic
1022604534 7:31797140-31797162 TTTCATGGACAAATGGCTAAGGG + Intronic
1030121656 7:106115897-106115919 TTGTTTTGACAAATGTATGATGG - Intergenic
1032250778 7:130255519-130255541 TTGTTTTGACAAATGTACCAAGG - Intergenic
1033918382 7:146356716-146356738 TTGGATGGAGAAGTGGATCATGG + Intronic
1033957742 7:146872744-146872766 CTGTATGCACAAATTGTTCAAGG + Intronic
1036561472 8:9903422-9903444 TTGTATGGACATTTAAATCAAGG + Intergenic
1036719231 8:11157351-11157373 TAGTTTGGACAAATGTACCATGG + Intronic
1038402226 8:27293310-27293332 TTGTAAGGACCACTGGCTCATGG + Intronic
1039225985 8:35388570-35388592 TTATATGGTCAAACAGATCACGG + Intronic
1039616898 8:38962462-38962484 GTGTCTTGGCAAATGGATCATGG + Intronic
1041003416 8:53474563-53474585 TTGTATGGTCAAAATGATGAGGG + Intergenic
1041218720 8:55627794-55627816 TGGTATGGAGAAGTAGATCAAGG - Intergenic
1045229171 8:100284509-100284531 ATGTATGGCCAAATTAATCACGG + Intronic
1046510904 8:115201176-115201198 TAGTATGGACAAAGTGAACACGG - Intergenic
1046772039 8:118126023-118126045 GTGAATGAACAAATGAATCAAGG + Intergenic
1047359566 8:124155704-124155726 TTGTCTGGATAAATGAATCTAGG + Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048715712 8:137266294-137266316 TTGAATTGACAAATGGCTTAAGG + Intergenic
1050111427 9:2220603-2220625 ATGTATGGATAAATAAATCATGG - Intergenic
1050661986 9:7892614-7892636 TTGGATGGCCAAATGGATTTAGG + Intergenic
1051493495 9:17693225-17693247 ATGTTTGGACACATGGATCAGGG + Intronic
1051729124 9:20120817-20120839 TTGTATGGTGACAGGGATCAAGG + Intergenic
1052287883 9:26807252-26807274 TTGTCTGCAGAAATGGATAAGGG + Intergenic
1052524697 9:29600398-29600420 ATGTAAGGATAATTGGATCAGGG - Intergenic
1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG + Intronic
1055361370 9:75494222-75494244 TTGTCTGGTCAAATGGGTCAAGG + Intergenic
1056948779 9:91025227-91025249 TTTTAGGGACAGAGGGATCAGGG + Intergenic
1058216601 9:102241645-102241667 TTGTATGGTCAAAATGATGAGGG + Intergenic
1058806365 9:108595901-108595923 CACTATGAACAAATGGATCAGGG + Intergenic
1059060667 9:111032565-111032587 TTGGAGGGAGAAATGGTTCAGGG - Intronic
1189393978 X:40603563-40603585 CTGTAGGGACAAATAGATCTCGG + Intronic
1191768239 X:64725464-64725486 TGGTATAGACAAATGAATGAGGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic