ID: 1140461717

View in Genome Browser
Species Human (GRCh38)
Location 16:75145538-75145560
Sequence CCTGGGATTTGGGGTTCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140461717_1140461726 4 Left 1140461717 16:75145538-75145560 CCATAAGAACCCCAAATCCCAGG No data
Right 1140461726 16:75145565-75145587 ACAAACAGAAGAGCAGCAGAGGG No data
1140461717_1140461725 3 Left 1140461717 16:75145538-75145560 CCATAAGAACCCCAAATCCCAGG No data
Right 1140461725 16:75145564-75145586 CACAAACAGAAGAGCAGCAGAGG No data
1140461717_1140461729 12 Left 1140461717 16:75145538-75145560 CCATAAGAACCCCAAATCCCAGG No data
Right 1140461729 16:75145573-75145595 AAGAGCAGCAGAGGGGCAGAGGG No data
1140461717_1140461730 13 Left 1140461717 16:75145538-75145560 CCATAAGAACCCCAAATCCCAGG No data
Right 1140461730 16:75145574-75145596 AGAGCAGCAGAGGGGCAGAGGGG No data
1140461717_1140461728 11 Left 1140461717 16:75145538-75145560 CCATAAGAACCCCAAATCCCAGG No data
Right 1140461728 16:75145572-75145594 GAAGAGCAGCAGAGGGGCAGAGG No data
1140461717_1140461727 5 Left 1140461717 16:75145538-75145560 CCATAAGAACCCCAAATCCCAGG No data
Right 1140461727 16:75145566-75145588 CAAACAGAAGAGCAGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140461717 Original CRISPR CCTGGGATTTGGGGTTCTTA TGG (reversed) Intergenic