ID: 1140462210

View in Genome Browser
Species Human (GRCh38)
Location 16:75148820-75148842
Sequence GGCACGCCTGGCCGAACGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140462197_1140462210 17 Left 1140462197 16:75148780-75148802 CCGGGGTTGCCCGGCGCTCGCCT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1140462210 16:75148820-75148842 GGCACGCCTGGCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 140
1140462199_1140462210 8 Left 1140462199 16:75148789-75148811 CCCGGCGCTCGCCTCTGAACGGG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1140462210 16:75148820-75148842 GGCACGCCTGGCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 140
1140462207_1140462210 -3 Left 1140462207 16:75148800-75148822 CCTCTGAACGGGGCCGGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1140462210 16:75148820-75148842 GGCACGCCTGGCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 140
1140462201_1140462210 7 Left 1140462201 16:75148790-75148812 CCGGCGCTCGCCTCTGAACGGGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1140462210 16:75148820-75148842 GGCACGCCTGGCCGAACGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140462210 Original CRISPR GGCACGCCTGGCCGAACGTG CGG Intronic