ID: 1140462211

View in Genome Browser
Species Human (GRCh38)
Location 16:75148821-75148843
Sequence GCACGCCTGGCCGAACGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140462199_1140462211 9 Left 1140462199 16:75148789-75148811 CCCGGCGCTCGCCTCTGAACGGG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1140462211 16:75148821-75148843 GCACGCCTGGCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 39
1140462197_1140462211 18 Left 1140462197 16:75148780-75148802 CCGGGGTTGCCCGGCGCTCGCCT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1140462211 16:75148821-75148843 GCACGCCTGGCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 39
1140462201_1140462211 8 Left 1140462201 16:75148790-75148812 CCGGCGCTCGCCTCTGAACGGGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1140462211 16:75148821-75148843 GCACGCCTGGCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 39
1140462207_1140462211 -2 Left 1140462207 16:75148800-75148822 CCTCTGAACGGGGCCGGCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1140462211 16:75148821-75148843 GCACGCCTGGCCGAACGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140462211 Original CRISPR GCACGCCTGGCCGAACGTGC GGG Intronic
905186866 1:36203378-36203400 CCTCGCCTGGCAGAACGTGGTGG - Intergenic
912844846 1:113069423-113069445 GCACGGCTGGCCGGGCGTGGGGG - Intergenic
1074843093 10:117374726-117374748 GCACGACTGGCCGCACGAGCCGG + Exonic
1076662457 10:132064692-132064714 ACACGTCTGGCCAAACGTCCAGG - Intergenic
1095145310 12:38720434-38720456 GCACCGCTGACCGAACGTACTGG + Intronic
1114614285 14:24060048-24060070 GGACGTCTGGCAGAAGGTGCAGG + Exonic
1122231211 14:100307013-100307035 GGACTCCTGGCCGAACCCGCCGG + Intergenic
1123719850 15:23050257-23050279 CCACGCCTGGCCAGAGGTGCCGG + Intergenic
1123719861 15:23050293-23050315 CCACGCCTGGCCATAGGTGCCGG + Intergenic
1125420519 15:39499958-39499980 GCACGCCTGGGCCATGGTGCTGG + Intergenic
1132586275 16:706896-706918 GGAAGCCTGGCCGAAGGGGCCGG + Intronic
1133924324 16:10181597-10181619 GCACGCGTGCACGACCGTGCTGG - Intronic
1140462211 16:75148821-75148843 GCACGCCTGGCCGAACGTGCGGG + Intronic
1154959294 18:21291806-21291828 ACGCCCCTGGCCGTACGTGCAGG + Intronic
1155160089 18:23188658-23188680 GCACGCCAGGCCCATCTTGCTGG - Intronic
1159704531 18:71670279-71670301 CCATGCCTGGCCGAAAATGCTGG + Intergenic
1159803461 18:72927413-72927435 ACCCGCCTGGGCGAAAGTGCCGG - Intergenic
1161383062 19:3976704-3976726 GAACGCCTGGCCGCCCGTGTTGG + Exonic
1163905902 19:20150070-20150092 GCACGGCTGGCCGGGCGTGGGGG + Intergenic
937808183 2:126169917-126169939 GCACACCTGCCCAAACGTGAGGG - Intergenic
942082437 2:172413321-172413343 GAACACCTGACCCAACGTGCTGG - Intergenic
1168916970 20:1497532-1497554 CCACGCCTGGCCAAAAGTGCTGG + Intergenic
1180714081 22:17859685-17859707 GCACGCCTGGCAGAGCCTCCAGG + Intronic
1181460909 22:23085474-23085496 TCAGGCCTGGGCGCACGTGCTGG + Intronic
1183948081 22:41338156-41338178 CCACGCCTGGCCGCATGTGAGGG + Intronic
1184839626 22:47044943-47044965 ACACGCCTGCCCAAAGGTGCTGG - Intronic
954582248 3:51709208-51709230 GCACGCCAGGCAGCAGGTGCGGG - Exonic
966050668 3:175614336-175614358 GCACGCCAGGCCGAGGGTGGTGG - Intronic
997297687 5:132777799-132777821 GGCCGCCTGGCCGGACGCGCGGG - Intronic
1012522631 6:100138824-100138846 GCAGGCCTGGCAGCAGGTGCAGG + Intergenic
1013700778 6:112767114-112767136 GCAGGCCTGGCCGGGCGTGGTGG + Intergenic
1015029768 6:128580630-128580652 GGAGGCCTGGCTGAACATGCCGG - Intergenic
1023965063 7:44959772-44959794 GCACTTGTGGCCGCACGTGCAGG - Intergenic
1035293755 7:157855933-157855955 GGAGGCCTGGCCGGAAGTGCAGG + Intronic
1035350362 7:158241223-158241245 CCACGCCCGGCCGAAAGTGAAGG - Intronic
1036749033 8:11431699-11431721 GCAAGCGTGGCCGCAGGTGCTGG + Intronic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1049617263 8:143581098-143581120 GGAGGCCCGGCTGAACGTGCTGG - Exonic
1056581735 9:87891978-87892000 GCAGGCCTGGCAGAAACTGCTGG - Intergenic
1057155724 9:92837323-92837345 GGAGGCCCGGCTGAACGTGCTGG - Intergenic
1057904146 9:98971515-98971537 TCACGCCTGCCCGCACCTGCTGG + Intronic
1061538137 9:131261937-131261959 GCACTCCTGGCCGGGCGTGGTGG + Intronic
1185608827 X:1382237-1382259 CCGCGCCTGGCCCAAAGTGCTGG + Intronic