ID: 1140462848

View in Genome Browser
Species Human (GRCh38)
Location 16:75154951-75154973
Sequence TACAAAAATTAGCTGGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4617
Summary {0: 2, 1: 53, 2: 740, 3: 1420, 4: 2402}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140462848_1140462854 9 Left 1140462848 16:75154951-75154973 CCATAGCCCAGCTAATTTTTGTA 0: 2
1: 53
2: 740
3: 1420
4: 2402
Right 1140462854 16:75154983-75155005 GAGATGGGGTTTCACCATGTTGG 0: 39926
1: 95780
2: 131152
3: 108291
4: 62548
1140462848_1140462853 -5 Left 1140462848 16:75154951-75154973 CCATAGCCCAGCTAATTTTTGTA 0: 2
1: 53
2: 740
3: 1420
4: 2402
Right 1140462853 16:75154969-75154991 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1140462848_1140462855 14 Left 1140462848 16:75154951-75154973 CCATAGCCCAGCTAATTTTTGTA 0: 2
1: 53
2: 740
3: 1420
4: 2402
Right 1140462855 16:75154988-75155010 GGGGTTTCACCATGTTGGTCAGG 0: 12248
1: 99170
2: 173655
3: 184431
4: 138245
1140462848_1140462851 -7 Left 1140462848 16:75154951-75154973 CCATAGCCCAGCTAATTTTTGTA 0: 2
1: 53
2: 740
3: 1420
4: 2402
Right 1140462851 16:75154967-75154989 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1140462848_1140462856 18 Left 1140462848 16:75154951-75154973 CCATAGCCCAGCTAATTTTTGTA 0: 2
1: 53
2: 740
3: 1420
4: 2402
Right 1140462856 16:75154992-75155014 TTTCACCATGTTGGTCAGGCTGG 0: 18554
1: 129811
2: 169790
3: 147924
4: 143504
1140462848_1140462852 -6 Left 1140462848 16:75154951-75154973 CCATAGCCCAGCTAATTTTTGTA 0: 2
1: 53
2: 740
3: 1420
4: 2402
Right 1140462852 16:75154968-75154990 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140462848 Original CRISPR TACAAAAATTAGCTGGGCTA TGG (reversed) Intronic
Too many off-targets to display for this crispr