ID: 1140464535

View in Genome Browser
Species Human (GRCh38)
Location 16:75169629-75169651
Sequence ACATCAGAAAATAAAAAACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1300
Summary {0: 1, 1: 1, 2: 4, 3: 97, 4: 1197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140464533_1140464535 -2 Left 1140464533 16:75169608-75169630 CCATAAAGCAGCCATTTTTAAAC 0: 1
1: 0
2: 0
3: 28
4: 356
Right 1140464535 16:75169629-75169651 ACATCAGAAAATAAAAAACTTGG 0: 1
1: 1
2: 4
3: 97
4: 1197
1140464532_1140464535 4 Left 1140464532 16:75169602-75169624 CCTCAGCCATAAAGCAGCCATTT 0: 1
1: 0
2: 4
3: 16
4: 190
Right 1140464535 16:75169629-75169651 ACATCAGAAAATAAAAAACTTGG 0: 1
1: 1
2: 4
3: 97
4: 1197
1140464531_1140464535 5 Left 1140464531 16:75169601-75169623 CCCTCAGCCATAAAGCAGCCATT 0: 1
1: 0
2: 4
3: 12
4: 174
Right 1140464535 16:75169629-75169651 ACATCAGAAAATAAAAAACTTGG 0: 1
1: 1
2: 4
3: 97
4: 1197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140464535 Original CRISPR ACATCAGAAAATAAAAAACT TGG Exonic
900701571 1:4051814-4051836 ATAAAATAAAATAAAAAACTGGG - Intergenic
900817499 1:4859759-4859781 AAATAAGAAAAAAAAAAACTAGG - Intergenic
900877611 1:5356059-5356081 AGATCAGAAAATAAAAATTGGGG - Intergenic
901383179 1:8888703-8888725 ATCTCAAAAAATAAAAAAATAGG + Intergenic
901797224 1:11687052-11687074 AAATAAAAAAATAAAAAAATTGG - Intronic
901814462 1:11786031-11786053 CAATAAGAAAAAAAAAAACTTGG - Exonic
902177003 1:14657873-14657895 ACAAAATAAAACAAAAAACTAGG - Intronic
902349586 1:15844208-15844230 ACATCAGAGAATAACAGAGTGGG + Intergenic
902980631 1:20120255-20120277 ATATCAGCAAATGAAAAAATAGG - Intergenic
903114146 1:21164559-21164581 TCTACCGAAAATAAAAAACTAGG + Intronic
903185890 1:21628883-21628905 ACCTCAGAAAAAAAAAAAGGAGG + Intronic
903433985 1:23332400-23332422 ATATTAAAAAAAAAAAAACTTGG + Intronic
903819471 1:26090588-26090610 ACAAGAGAAAAAAAAAAACATGG + Intergenic
905293132 1:36936808-36936830 CCATCAGAAAAAAAAAAATGAGG - Intronic
905513608 1:38544182-38544204 ACATCAGAGAAAAAAGAAATAGG + Intergenic
905621292 1:39450301-39450323 ACCTCATAAAAAAAAAAAATTGG - Intronic
906025399 1:42669190-42669212 ACATCAAAAAAAAAAAAAAAAGG + Intronic
906039371 1:42775904-42775926 ACAACAAAAAAAAAAACACTTGG + Intronic
906101559 1:43267234-43267256 ACATAAGGAAATAAAACACAAGG + Intronic
907045391 1:51297213-51297235 ACATCAAAAAAAAAAAAAGATGG - Intronic
907068352 1:51510018-51510040 ACAAAACAAAATAAAAAACTGGG - Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
907434808 1:54438333-54438355 TCTACAGAAAATAAAAAACAAGG + Intergenic
907503698 1:54902231-54902253 ACAGAAGAAAATAAGACACTTGG + Intergenic
907880473 1:58545503-58545525 ACATAAGAAAAAAAAAAATCAGG + Intronic
908302950 1:62780169-62780191 AAATTAGAAAAAAGAAAACTTGG - Intergenic
908317486 1:62947392-62947414 ACTTCAGAAAATAAAAATGAAGG - Intergenic
908329529 1:63057040-63057062 AAATCAGAGAATAATAAATTGGG + Intergenic
908954243 1:69601712-69601734 ACATGGGAAAATAAAAATATTGG + Intronic
909054016 1:70802007-70802029 ACTTAATAAAATAAAAAAATTGG - Intergenic
909221390 1:72966004-72966026 TCATGAGAAAATAAAGAAATTGG + Intergenic
909371523 1:74888363-74888385 ACATCAAAAAATAACAGACGTGG + Intergenic
909444007 1:75727856-75727878 ACAGCAGAAAATACAGAACATGG + Intronic
909861849 1:80616294-80616316 ACAACAGAAAATAAAACTATAGG + Intergenic
909936703 1:81559445-81559467 ACATTAAAAAAAAAAAAACATGG - Intronic
910073107 1:83243411-83243433 ACAGGGGAAAATAAAAAAGTAGG + Intergenic
910518553 1:88090392-88090414 ACAAAAGAAAACAAAAAACTTGG - Intergenic
910681840 1:89874181-89874203 ACATCATAAAGGGAAAAACTAGG + Intronic
910911702 1:92241490-92241512 ACCTCAAAAAACAAACAACTTGG - Intronic
910997608 1:93125110-93125132 TCGTCAGAAAGTAAAAAAGTGGG + Intronic
911025594 1:93433243-93433265 CCATCTCAAAATAAAAAACTGGG + Intergenic
911077565 1:93892746-93892768 ATATGTGAAAATAAAACACTAGG + Intronic
911344934 1:96684888-96684910 ACATCAATATAAAAAAAACTTGG - Intergenic
911794170 1:102055230-102055252 AAACCAGTAAATAAAATACTGGG + Intergenic
911819709 1:102401818-102401840 ATAACAAAAAATAAAAAACAAGG - Intergenic
911895880 1:103434415-103434437 AGATCACAAAACCAAAAACTTGG + Intergenic
911937565 1:103998278-103998300 GCCTCGGAAAATGAAAAACTCGG + Intergenic
912026043 1:105174369-105174391 AAAAGAGAAAATAATAAACTTGG + Intergenic
912142708 1:106750769-106750791 AGATCAGAAATAAAAACACTGGG + Intergenic
912203581 1:107485130-107485152 AAAAAACAAAATAAAAAACTTGG - Intergenic
912291671 1:108430148-108430170 AAAGCAGAAAAAAAAAAACAGGG - Intronic
912368423 1:109153886-109153908 AAAAAAGAAAATAAAAATCTGGG - Intronic
913177781 1:116290912-116290934 ACATGAATAAATAAAAATCTGGG - Intergenic
913389497 1:118294813-118294835 CTATCAGCAAATAAAGAACTAGG - Intergenic
913406523 1:118499089-118499111 ATTTCAAAAAATAAAATACTTGG + Intergenic
913446241 1:118953695-118953717 ACTTAAAAAAAGAAAAAACTTGG - Intronic
913502606 1:119484920-119484942 ACATGAGGAAATAAAGAAATAGG - Intergenic
913682930 1:121204201-121204223 ACATTAGAAGATAGAAAAGTAGG + Intronic
914034773 1:143991827-143991849 ACATTAGAAGATAGAAAAGTAGG + Intergenic
914154680 1:145076142-145076164 ACATTAGAAGATAGAAAAGTAGG - Intronic
914786861 1:150841107-150841129 AAATAAAAAAAAAAAAAACTGGG - Intronic
914964264 1:152239716-152239738 ACATCAAAAAGTCAAAAAATGGG - Intergenic
915294892 1:154913071-154913093 ACATCAGAGAAAAGAAAACTGGG + Intergenic
915645241 1:157266262-157266284 AGATTAGAAAGAAAAAAACTGGG - Intergenic
916237947 1:162609196-162609218 GCATCAGATAATAGAAAACCAGG - Intergenic
916463721 1:165051280-165051302 ACAGAAGTCAATAAAAAACTGGG - Intergenic
916551639 1:165855494-165855516 AAAAAAGAAAAGAAAAAACTGGG - Intronic
916868804 1:168889152-168889174 AAACCAGTAAATAAAATACTGGG + Intergenic
916878520 1:168996741-168996763 AAATAAGGAAATAAAAAACTTGG - Intergenic
917067621 1:171113891-171113913 GCCTCAGAAAAAAAAAATCTTGG + Intronic
917216673 1:172686088-172686110 AAATTAGAAAATAAAATATTGGG - Intergenic
917896792 1:179498462-179498484 ACATCAAACTATAAAAATCTGGG + Intronic
917937712 1:179884426-179884448 ACTTCAGAAAATCAAAAAGATGG - Intronic
918023494 1:180718589-180718611 ACATTAAAAAACAAAAATCTTGG + Intronic
918559056 1:185842562-185842584 TCAACAAAAAATAAAAAAATTGG + Intronic
918580067 1:186116082-186116104 ACATCAGGAAATATAAAACTAGG + Intronic
918742583 1:188153954-188153976 AAAAAATAAAATAAAAAACTTGG - Intergenic
918803342 1:189002398-189002420 TCATCTGAAAAAAAAAAAATAGG + Intergenic
918845424 1:189603074-189603096 ACATGAGAATATAAAATAGTAGG + Intergenic
919127895 1:193418270-193418292 GCATCAGAAAAAGAAAAAGTTGG - Intergenic
919242091 1:194926785-194926807 AAATCAGAAAATAAAACATCAGG - Intergenic
919600258 1:199613586-199613608 GCATCAGAAAACAAAAAATGAGG - Intergenic
919692635 1:200541376-200541398 ACATCAACAAATCTAAAACTAGG + Intergenic
919771543 1:201163287-201163309 AAATAAAAAAATAAAAAACAAGG + Intronic
919909106 1:202099323-202099345 TCTACAGAAAATAAAAAAATTGG - Intergenic
920470242 1:206222715-206222737 ACATTAGAAGATAGAAAAGTAGG + Intronic
920608942 1:207418652-207418674 ACATCAGATAATGAAGGACTGGG + Intergenic
921079915 1:211730908-211730930 ACAACAAAAAACAAAAAACTTGG + Intergenic
921472827 1:215568296-215568318 AATTCTGAAAATAAATAACTAGG - Intronic
921588852 1:216980083-216980105 ACATCATGAAATAAAAGAATTGG - Intronic
921848335 1:219907463-219907485 AAACCAGAAAAGAAATAACTTGG + Intronic
922672694 1:227523871-227523893 ACATAATAAAATAACATACTGGG + Intergenic
922680826 1:227593864-227593886 ACATCAAAAAAAAAAAAAAGGGG - Intronic
922889267 1:229047710-229047732 GCATCAGAAAACAAAAGACATGG + Intergenic
922924727 1:229339073-229339095 ACTTCAGAAAAAAAAGAAATGGG + Intronic
923121921 1:230999914-230999936 ACATGAGATAATAAAAAACAGGG - Intronic
923964907 1:239126699-239126721 AACACAGAAAATAAAATACTTGG + Intergenic
924193155 1:241577689-241577711 AACTCAGTAAATAAAATACTGGG - Intronic
924237696 1:242013053-242013075 ACAACAGAAAAGTAAAAACTAGG + Intergenic
924433534 1:244018444-244018466 ACAACAGAAAATAAAAGTGTTGG + Intergenic
924501238 1:244639902-244639924 AAATCAGAAAAAAAAAAAAAAGG - Intronic
924863420 1:247951719-247951741 ATATCAGAAAAGAAAAAGCCAGG - Intronic
1063070136 10:2653458-2653480 AAATCAGAAAAGAAAAAAAAAGG - Intergenic
1063413260 10:5853028-5853050 ACAAAAGAAAACAAAAAAGTAGG + Intergenic
1063446197 10:6119075-6119097 ACATTAAAAAAAAAAAAACCAGG - Intergenic
1063453318 10:6165788-6165810 AAAAAAGAAAATAAAATACTGGG - Intronic
1063767987 10:9164292-9164314 ACACCAGAAAATACAAAACACGG - Intergenic
1063991742 10:11573214-11573236 ACATCAGAAGAGAACAAGCTAGG - Intronic
1064005282 10:11694358-11694380 ACATTAGAAAAAAAAAAAGATGG - Intergenic
1064231415 10:13531687-13531709 ACATAAAACAATAAAAAACACGG - Intergenic
1064626974 10:17271420-17271442 AAAAAAGAAAAGAAAAAACTTGG + Intergenic
1065032800 10:21604859-21604881 TCATAAGAAAAAAAAAAAATGGG - Intronic
1065049187 10:21773433-21773455 ATATCAGGAAAAAAAAATCTGGG - Intronic
1065232040 10:23608269-23608291 CTATCAAAAAATAAAAAATTAGG + Intergenic
1065294014 10:24257870-24257892 TTACCAGAAAATAAAACACTGGG - Intronic
1065352906 10:24811560-24811582 TCATCAGAACATGAAACACTTGG - Intergenic
1065403368 10:25332466-25332488 TTATCAGAAAATAAAGAGCTAGG - Intronic
1065713389 10:28539029-28539051 AAATCTTAAAATGAAAAACTGGG - Intronic
1066307932 10:34165216-34165238 AGCTCAGAAAAGAGAAAACTGGG - Intronic
1066324697 10:34346086-34346108 ACATCACAAAACACAGAACTGGG + Intronic
1066418496 10:35242801-35242823 ACATCAGAAAAAAAAAACAATGG + Intergenic
1066420976 10:35264641-35264663 ACAAAACAAAACAAAAAACTGGG - Intronic
1066450685 10:35526665-35526687 ACAAAAAAAAAAAAAAAACTTGG - Intronic
1066700021 10:38117556-38117578 GCATCAGAAAATTAAAAATTGGG + Exonic
1066991715 10:42520940-42520962 GCATCAGAAGATTAAAAATTGGG - Intergenic
1067355525 10:45521590-45521612 ACATAAGATAACAAAAAATTTGG + Intronic
1068113870 10:52714243-52714265 ACATCACAAAAAAAAAAAACAGG - Intergenic
1068502665 10:57859901-57859923 ACATCAGAAAATAAAAGTATTGG + Intergenic
1069127730 10:64658572-64658594 ATCTCAGCAAATAAAAAACCTGG - Intergenic
1069430117 10:68327058-68327080 ACAACAATAAAAAAAAAACTGGG + Intronic
1069476037 10:68733421-68733443 AAAAGAGAAAATGAAAAACTTGG + Intronic
1070052097 10:72899294-72899316 ACATTAGAAAATGAAACATTGGG + Intronic
1070281697 10:75053688-75053710 AGATCAAAAAAAAAAAAACATGG - Intronic
1070836929 10:79453816-79453838 ATTTCATAAAATAAAAAAGTGGG - Intergenic
1070974263 10:80592874-80592896 AAATACGAAAAAAAAAAACTAGG - Intronic
1071558220 10:86623241-86623263 ACAACAAAACATAATAAACTGGG - Intergenic
1071693491 10:87847688-87847710 ACAACATAAAAGCAAAAACTAGG - Intergenic
1072136959 10:92556321-92556343 GCATCAAAAAATAAAATACTGGG + Intronic
1073619060 10:105028223-105028245 ACAGCAGAGAATAAGAATCTGGG - Intronic
1073720178 10:106159635-106159657 ATACCAGTAAATAAAAAGCTAGG + Intergenic
1074167591 10:110897948-110897970 ATATAAAAAAATTAAAAACTTGG - Intronic
1074582836 10:114736844-114736866 TCAGCAGGAAATAAAAAACAGGG + Intergenic
1074591106 10:114814021-114814043 AAATCAAAAAATAAAAAATAGGG + Intergenic
1074647354 10:115473766-115473788 TCATGTGAAAATAGAAAACTTGG - Intronic
1075218563 10:120562226-120562248 ACACCAGAAAATAATTAGCTAGG - Intronic
1075226434 10:120633754-120633776 ACATTTGAAAATAAAATATTCGG + Intergenic
1075429780 10:122370593-122370615 AAAACAAAAAACAAAAAACTGGG - Intergenic
1075430064 10:122372915-122372937 ACATTTAAAAATAAAAATCTAGG - Intergenic
1075639408 10:124053988-124054010 ACATCAGAAAATAACACACCAGG + Intronic
1075915579 10:126163372-126163394 AAATCAGAAAATACAGTACTCGG - Intronic
1076007795 10:126961969-126961991 AAAACAGAAAATAACAACCTTGG - Intronic
1076577780 10:131481957-131481979 ACATGAGAAGATAAAAAAGGAGG + Intergenic
1076942800 10:133621050-133621072 TGATCACAAGATAAAAAACTTGG + Intergenic
1077923886 11:6661623-6661645 AGATAAAAAAATAAAACACTAGG - Intergenic
1078376394 11:10796931-10796953 ACAGCAGAAAAACAAAAATTGGG + Intergenic
1078535976 11:12174591-12174613 AAAGCAGAAAAAAAAAAACAAGG - Intronic
1078769741 11:14337941-14337963 ACATCAGAAAGGAAAAAACATGG + Intronic
1078829519 11:14966239-14966261 ACCTCACAGAATAAAAAAGTTGG + Intronic
1078924675 11:15863750-15863772 ACATCAAAAAATAGAAAAATAGG - Intergenic
1078940457 11:15998335-15998357 GCATCAGATAATAAAATACTTGG + Intronic
1079147800 11:17869284-17869306 AAAACAGAAGATAAAAAGCTGGG + Intronic
1079291241 11:19189776-19189798 AAATCAGTAAATAAAATAATTGG + Intronic
1079699672 11:23528960-23528982 ACAGAGGAAAATAAAAAAATTGG + Intergenic
1079788377 11:24704438-24704460 AAATCAGAAAAAAAAAAAACAGG + Intronic
1080081586 11:28225537-28225559 AAAAAAGAAAAAAAAAAACTGGG - Intronic
1080533310 11:33197818-33197840 ACAAAAGAAAACAAAAAAATAGG - Intergenic
1080629726 11:34062866-34062888 ACATCTGAAAAAAACTAACTTGG - Intronic
1080974880 11:37326802-37326824 TCAACAGAAAATAAAATACGAGG - Intergenic
1081211167 11:40336259-40336281 ACATCACCATAGAAAAAACTGGG - Intronic
1081295591 11:41383395-41383417 ATATCACAAACTAAAAAACTTGG + Intronic
1081797650 11:45832549-45832571 CAATCAGAAAATAAAAATCTTGG - Intergenic
1081858989 11:46321219-46321241 ACTTCATAAAATATAAAACAAGG - Exonic
1081995461 11:47360819-47360841 GCCTCAAAAAAAAAAAAACTCGG + Intronic
1082264073 11:50100712-50100734 TTAACAGAAAATAAATAACTTGG - Intergenic
1082307394 11:50597237-50597259 ATATCTCACAATAAAAAACTGGG + Intergenic
1082721112 11:56678083-56678105 ACATCAGAAAAAAAATACTTAGG + Intergenic
1082758456 11:57102146-57102168 AGAACATAAAATAAAAATCTAGG + Intergenic
1082912543 11:58393005-58393027 ACTTCAGAAAGTGAAACACTGGG + Intergenic
1083081494 11:60098855-60098877 ACATCTGAAAATGAGAAATTTGG + Intergenic
1083404928 11:62450070-62450092 ACAAAATAAAATAAAAAACAGGG - Intronic
1083442618 11:62687296-62687318 ACAAAACAAAATAAAAAACAAGG + Exonic
1083451393 11:62748077-62748099 AAAACAGAAAAAAAAAAACCTGG - Intergenic
1083942704 11:65905694-65905716 ACATTAAAAAAAAAAAAAATTGG - Intergenic
1084075526 11:66772466-66772488 ATCTCAAAAAATAAAAATCTTGG + Intronic
1085220148 11:74866854-74866876 ACATCAAAAAAGAAAATATTAGG + Intronic
1085778479 11:79387702-79387724 ACATTAGAAAATAAACAAACAGG + Intronic
1085838399 11:79981371-79981393 AAAGCAGAAAATATAAAATTAGG + Intergenic
1085947999 11:81295572-81295594 CCATGAGAAAAAAAATAACTGGG + Intergenic
1086504502 11:87490703-87490725 AAATCACAAAATAAAAGTCTTGG - Intergenic
1086756324 11:90567486-90567508 ACATCAAAAAACAAAAGAATAGG - Intergenic
1087027768 11:93667723-93667745 AACTCAGAAAATACAGAACTTGG + Exonic
1087818047 11:102680526-102680548 AGATAAGAAAAAAAAATACTGGG - Intergenic
1088413963 11:109568777-109568799 AACTCAGTAAATAAAATACTGGG - Intergenic
1088432308 11:109772193-109772215 TGATGAGAAAATTAAAAACTGGG + Intergenic
1088587151 11:111369323-111369345 ACTTCAGAAATGAAAAACCTTGG + Intronic
1088613073 11:111597774-111597796 ACAAAACAAAACAAAAAACTAGG - Intergenic
1088978556 11:114839777-114839799 AAATAAAAAAATAAAAAGCTGGG - Intergenic
1089918969 11:122188952-122188974 TCATTAGAAAAAAAAAAACTAGG + Intergenic
1090099203 11:123776268-123776290 AAATAAGAAAAAAATAAACTAGG + Intergenic
1090527941 11:127557537-127557559 AGACCAAAGAATAAAAAACTTGG - Intergenic
1090532526 11:127605803-127605825 AGAGCAGCAAATTAAAAACTTGG + Intergenic
1090563027 11:127953745-127953767 CCATGAGAAAAGACAAAACTAGG + Intergenic
1090725215 11:129518971-129518993 ACATCAGGAAAGAAAAAACATGG - Intergenic
1091098084 11:132842553-132842575 ACACCAGAATTTAAGAAACTTGG + Intronic
1091509623 12:1108670-1108692 ACATGAGTAAATAAAAATCCTGG + Intronic
1091542609 12:1475828-1475850 ATATCGGAAATGAAAAAACTAGG + Intronic
1091638834 12:2218751-2218773 ACAACAGAAAATACAAAACAGGG + Intronic
1092092340 12:5813180-5813202 ATATTAGAAAAATAAAAACTAGG + Intronic
1092175544 12:6403056-6403078 ACTTCAGAAAATAAAATACCTGG - Intergenic
1092202546 12:6595120-6595142 TCATCAGAAAAAAAAAAAGGAGG - Intronic
1092363613 12:7858831-7858853 GCATGAGCAAATGAAAAACTGGG - Intronic
1092573042 12:9746013-9746035 ACAACACGAAATAAATAACTGGG + Intergenic
1093031248 12:14290989-14291011 ACATCAGAAACTAGAACATTAGG + Intergenic
1093121922 12:15280792-15280814 ACATCATAAAATGAAAAGCATGG + Intronic
1093394433 12:18664109-18664131 ACACCAGAAAATAACAAGCGAGG + Intergenic
1093558612 12:20509622-20509644 ACATTATAAAACAAAAAAGTAGG - Intronic
1093601588 12:21031921-21031943 ACATAAAAAATTAAATAACTGGG - Intronic
1093620413 12:21282113-21282135 ACATAAGAAAAAAAAAAAAAAGG + Intronic
1093990808 12:25587851-25587873 AGATCAGAAACAAAAAAGCTAGG + Intronic
1094109833 12:26849997-26850019 AAAACAGATAATAAAAAAATTGG - Intergenic
1094625527 12:32119874-32119896 ACAAAACAAAACAAAAAACTGGG + Intronic
1095088117 12:38080338-38080360 ACAAAACAAAACAAAAAACTGGG - Intergenic
1095129833 12:38527427-38527449 ACATCCTAAAATAATAAAATGGG + Intergenic
1095129987 12:38529579-38529601 ACATCCTAAAATAATAAAATGGG + Intergenic
1095321384 12:40832641-40832663 AATTCAGAAAATAAAAGACATGG - Intronic
1096026073 12:48362647-48362669 AAAACAGAAAAAAACAAACTAGG - Intergenic
1096126872 12:49126120-49126142 AAAACAAAAAACAAAAAACTGGG + Intergenic
1096376891 12:51119882-51119904 ACAGCATAAAAGCAAAAACTAGG + Intronic
1096593029 12:52675033-52675055 ACAGCAGAAAAGAAAGAGCTGGG + Exonic
1096820070 12:54227036-54227058 ACACATGAAAATAAAAAACAGGG + Intergenic
1097325647 12:58273396-58273418 AAAAAATAAAATAAAAAACTAGG - Intergenic
1097505038 12:60456125-60456147 ACTTAAGAAAAAAAAAAAATTGG + Intergenic
1097618602 12:61913179-61913201 ACAACAGAAAATAAATACATAGG + Intronic
1098130999 12:67349622-67349644 ATTTCAAAAAAAAAAAAACTTGG - Intergenic
1098457329 12:70689608-70689630 AGATCACAAAATAACAAACAAGG + Intronic
1098557121 12:71831630-71831652 GCATCAAAAAATAAAATACTTGG - Intergenic
1098704489 12:73671072-73671094 AGAGCATAAAATAAAAAGCTAGG + Intergenic
1098723575 12:73932617-73932639 ACATGAGAAAACATAAAACCTGG - Intergenic
1098734789 12:74086287-74086309 ACATCTGAAAATCACAAAATTGG + Intergenic
1099045035 12:77706891-77706913 AAACCAAAAAAAAAAAAACTAGG + Intergenic
1099075754 12:78105883-78105905 ATATCATAAAATATAAAATTAGG - Intronic
1099142014 12:78989776-78989798 CCATCATCAAAGAAAAAACTAGG + Intronic
1099353070 12:81597478-81597500 ACATAAGAAAATTAAATAATGGG + Intronic
1099611245 12:84873730-84873752 ACAGCAGAAAACACAAAACATGG - Intronic
1099821434 12:87716161-87716183 AAATCCTAAAATAAAAACCTAGG + Intergenic
1099882445 12:88482726-88482748 ACAACAAAAATTAAAAAGCTCGG + Intergenic
1100190467 12:92185695-92185717 ATATGAGAAAACAAAATACTAGG + Intergenic
1100246861 12:92766858-92766880 AAATCAGAAAATAAAAAAGGTGG - Intronic
1100495487 12:95121004-95121026 ACATCAGAAAATATACCTCTAGG - Intronic
1100528972 12:95446968-95446990 AGATAAGAAAAAAAAAAACCAGG - Intergenic
1100622023 12:96286024-96286046 ACATAAGAAAAAAAAATACCTGG + Exonic
1100781748 12:98034251-98034273 AGATATGAAAATAAAAAAATGGG - Intergenic
1100861102 12:98808306-98808328 AGATAAGAAAATAAAAATATCGG - Intronic
1100865017 12:98848299-98848321 ACAACATACAATAAAAAAATTGG + Intronic
1100920948 12:99486501-99486523 AAACCAGCAAATAAAATACTGGG - Intronic
1101055787 12:100912091-100912113 ACATAAGAAATTAAATACCTGGG - Intronic
1101384099 12:104241034-104241056 AAAAAAGAAAAAAAAAAACTGGG - Intronic
1101474398 12:105030580-105030602 ACATTAAAAAATAAGAACCTGGG - Intronic
1102274289 12:111568272-111568294 ACAAAACAAAAAAAAAAACTGGG + Intronic
1104217357 12:126747288-126747310 ACTTCTGCAAATAAAAATCTTGG - Intergenic
1105398221 13:20061575-20061597 ACAAAACAAAACAAAAAACTAGG - Intronic
1105786212 13:23751920-23751942 ACATTAAAAAAAAAAAAACTTGG + Intronic
1106089075 13:26571211-26571233 AAATCAGAAAAGTCAAAACTAGG - Intronic
1106262773 13:28082456-28082478 AAAACAAAAAATAAAAGACTAGG - Intronic
1106630099 13:31462530-31462552 AGATAAAAAAAAAAAAAACTTGG - Intergenic
1107204138 13:37761514-37761536 AAATGAGAAAATAAAAAAGTGGG - Intronic
1107303453 13:38992276-38992298 ACATCAGAAAATTAGAAAATTGG - Intergenic
1107362146 13:39630832-39630854 ACATCAAAAAATAAAACAGATGG - Intergenic
1107562484 13:41570992-41571014 ATATAAGAAAATATAAAACTTGG + Intronic
1107708924 13:43133534-43133556 ACATCAGAAAAAAAAAAACTAGG + Intergenic
1108016501 13:46082154-46082176 ACAACAGAAATTAAAGAATTGGG - Intronic
1108065479 13:46573185-46573207 ACATGAGAAAAGAGAAAACAAGG - Intronic
1108163305 13:47665713-47665735 ACAGAAGAAAATAAAAAGATGGG - Intergenic
1108402004 13:50054789-50054811 ACACCAGAAAAGAACAAAGTTGG - Intergenic
1108599354 13:51978185-51978207 AAGTCAAAAGATAAAAAACTGGG + Intronic
1108756828 13:53513089-53513111 AAATCAAAAAACAAAAAACAGGG + Intergenic
1108831179 13:54480550-54480572 AAATTAAAAAATAAAAAATTTGG + Intergenic
1108838110 13:54576613-54576635 ACATAAAAAAATAGAAATCTTGG + Intergenic
1109001682 13:56812617-56812639 AAACCAGTAAATAAAATACTGGG + Intergenic
1109357632 13:61251625-61251647 CCATCAGACAATAGAAAAGTGGG - Intergenic
1109463497 13:62695384-62695406 AAATAAAAAAATAAAAAACAAGG - Intergenic
1109553858 13:63943326-63943348 ACTTCAGAAATGAAAAAACAGGG - Intergenic
1109575914 13:64258394-64258416 ACATAATAAAATAATAAAATTGG + Intergenic
1109803981 13:67413446-67413468 AAATCTGAAAATAAAAAATAGGG + Intergenic
1110052914 13:70926593-70926615 ACATAAGAATATTAAAAACTTGG + Intergenic
1110471219 13:75862290-75862312 ACATCCCAAAACAAAGAACTTGG - Intergenic
1110518297 13:76443143-76443165 CTATCAAAAAATAAAAATCTAGG + Intergenic
1110731866 13:78887819-78887841 ACAACAGAAGATAAAGAAATGGG + Intergenic
1110852991 13:80265964-80265986 CTATCAGAAAATAAAAAAAGAGG - Intergenic
1111117599 13:83801323-83801345 AGAACACAAAATAAAAGACTGGG + Intergenic
1111188138 13:84770713-84770735 AAAACAGAAAATGAATAACTGGG + Intergenic
1111239240 13:85453179-85453201 GCAACAGAAAATAAGAAAATGGG - Intergenic
1111321163 13:86631411-86631433 AAATGAGAAAATAGAAAACAGGG - Intergenic
1111587530 13:90301615-90301637 ACAGCAGAAAGTAAAACAATAGG + Intergenic
1111612977 13:90628446-90628468 ACATCAGAAAGCAAAAATATGGG - Intergenic
1111621318 13:90728903-90728925 ACATCATGAAATAAAAAAGGAGG - Intergenic
1111836066 13:93389786-93389808 CCATCAGAAAAAAAAACAGTTGG + Intronic
1112068803 13:95825206-95825228 AACTCAGTAAATAAAATACTGGG - Intronic
1112234390 13:97622311-97622333 ACAAAGGTAAATAAAAAACTAGG + Intergenic
1112782449 13:102916035-102916057 ACAAGAGAAAATAAATAAATTGG + Intergenic
1112933186 13:104767063-104767085 ACATCAGAAAATAATCTAATTGG - Intergenic
1112947295 13:104945477-104945499 ACTGCTGAAAATAAAAAAGTAGG + Intergenic
1113216101 13:108042396-108042418 TCCTCAGAATATAAAGAACTTGG - Intergenic
1113734746 13:112670559-112670581 AAAAAAGAAAAGAAAAAACTTGG - Intronic
1114054019 14:18950637-18950659 ACATCAAAAAATAATAAATGTGG - Intergenic
1114108538 14:19451295-19451317 ACATCAAAAAATAATAAATGTGG + Intergenic
1114215100 14:20651805-20651827 ACTTCAGAAAATAACAAAAATGG + Intergenic
1114319232 14:21533191-21533213 AGATAAGAAAACAGAAAACTTGG - Intronic
1114882409 14:26802861-26802883 ATTTCAGTAAATTAAAAACTTGG - Intergenic
1114933375 14:27504002-27504024 ACATCACAAATAAAAGAACTAGG - Intergenic
1115111753 14:29831667-29831689 GAATGAGAAAATAAAAAACATGG - Intronic
1115170786 14:30503775-30503797 ATATCAGAAAAAGAAGAACTTGG + Intergenic
1115206863 14:30916728-30916750 CCATCATTAAATTAAAAACTAGG - Intronic
1115228285 14:31128068-31128090 TCTTTAAAAAATAAAAAACTTGG - Intronic
1115663236 14:35518459-35518481 AAATAAGTAAATAAGAAACTAGG - Intergenic
1116084221 14:40215186-40215208 AAATAAAAAAACAAAAAACTTGG - Intergenic
1116174321 14:41447666-41447688 ACAACAGCTAATAAAAATCTTGG + Intergenic
1116377029 14:44216072-44216094 ACATTAGAAAATAATATACCAGG + Intergenic
1116451645 14:45073268-45073290 ACATAAAAATATAAAAAACAGGG - Intronic
1116567625 14:46469933-46469955 ATATGAGAAAATATAAAATTTGG + Intergenic
1116798634 14:49418662-49418684 TCAGCAGGAAATAAAAATCTTGG + Intergenic
1116822617 14:49640209-49640231 ACATCATATAGTAAGAAACTTGG - Intergenic
1117050581 14:51855890-51855912 CAATCAAAAAATAAAGAACTAGG + Intronic
1117308034 14:54495591-54495613 ACAAAACAAAACAAAAAACTTGG + Intergenic
1117312056 14:54536119-54536141 AAAAGAGAAAATAAAAAACAGGG - Intronic
1117330731 14:54709304-54709326 ACAGAAGAAAAGAAAAAAATAGG + Intronic
1117575832 14:57096251-57096273 ACATCAGAAGAAAAGGAACTGGG - Intergenic
1117629542 14:57675951-57675973 ACAACAAAAAATAAATAAATGGG + Intronic
1117724234 14:58656693-58656715 GCATCAGAAAAAAAAAAAATGGG + Intergenic
1117725689 14:58671039-58671061 ACAGAAGAAAATAATAACCTTGG - Intergenic
1117877648 14:60272040-60272062 ACATCAAAAAAAAAAAAAAATGG - Intronic
1118048462 14:61999316-61999338 ACTTAAGAAAAAAACAAACTAGG - Intronic
1119166025 14:72493762-72493784 ATACCAGAAAAAAAAAAACATGG + Intronic
1119193238 14:72698679-72698701 AAAACATAAAATAAAAAAGTAGG + Intronic
1119380492 14:74225146-74225168 ACATCAAAAAAAAAAAAAAAAGG + Intergenic
1119815237 14:77560447-77560469 AAAACAAAAAACAAAAAACTTGG + Intronic
1119965654 14:78912847-78912869 AATTCAAAAAACAAAAAACTTGG - Intronic
1120021383 14:79534836-79534858 ACACCAGAAGATGAAAAACCTGG + Intronic
1120100324 14:80437355-80437377 ACAACAAAAAGTTAAAAACTGGG + Intergenic
1120270480 14:82307808-82307830 ACTTCATAAAATAATAAAGTTGG - Intergenic
1120318940 14:82934210-82934232 ATATCATAAAATTAGAAACTTGG + Intergenic
1120662529 14:87267330-87267352 ACAGCTGAAAATAAAATAGTTGG - Intergenic
1120664797 14:87293023-87293045 ACAACAAAAAAAAAACAACTGGG + Intergenic
1120771429 14:88384639-88384661 ACATTAGAAAAGAGAAAACTGGG + Intergenic
1121161654 14:91747896-91747918 ACATCTGAAAAAAAAAAAGTTGG - Intronic
1121450910 14:94007564-94007586 ACCTCAGAAAAGAACAAAGTTGG - Intergenic
1122214913 14:100196721-100196743 AAATTAAAAAATAAGAAACTGGG - Intergenic
1122622147 14:103065417-103065439 TCAACAGAAAATGAAAAAGTGGG + Intergenic
1123203252 14:106687468-106687490 CAAACAGAAAATAAAAAACATGG + Intergenic
1123217517 14:106825356-106825378 TGAACAGAAAATAAGAAACTTGG + Intergenic
1123702631 15:22927177-22927199 AAACCAAAAAACAAAAAACTAGG + Intronic
1123703742 15:22935782-22935804 TCATCACAAAATAAAAAAAATGG + Intronic
1124041401 15:26108825-26108847 AGATCAGAAGACAAATAACTGGG + Intergenic
1124378367 15:29143242-29143264 AGATCAGTAAACACAAAACTGGG + Intronic
1124690866 15:31821442-31821464 ACATAAAGAAATGAAAAACTGGG - Intronic
1124809360 15:32919209-32919231 ACTTCACAAAATAAACAAGTTGG + Intronic
1125255014 15:37753268-37753290 ACAGCAGAATATCACAAACTGGG + Intergenic
1125619949 15:41051651-41051673 AAATTAAAAAATAAAAAATTAGG + Intronic
1126015316 15:44345109-44345131 ATCTCAAAAAATAAAAAAATAGG - Intronic
1126244686 15:46490469-46490491 AACTCAGTAAATAAAACACTGGG - Intergenic
1126261218 15:46694486-46694508 ACTTCAGAGAGTAAAAATCTGGG - Intergenic
1126269387 15:46796213-46796235 AGATCAGAACATAAGAAGCTTGG + Intergenic
1126503683 15:49378449-49378471 ACATCAAAAAATAGAAATATTGG - Intronic
1126539644 15:49807830-49807852 AAATGGGAAAATAAAAAAGTGGG + Intergenic
1126545345 15:49867174-49867196 TCTTCAGAGAATAAAAAAGTAGG + Intronic
1126547352 15:49887657-49887679 AGATCAGAAAAAAAAAAAACAGG + Intronic
1126644400 15:50860438-50860460 ACATAAGAAAATAAAATATTTGG - Intergenic
1126745511 15:51822273-51822295 CCATCTCAAAAAAAAAAACTGGG + Intergenic
1126839578 15:52704093-52704115 ATATCAGAAAATAAAGAAATTGG + Intronic
1127011648 15:54636984-54637006 ACATAAAAAAAAAAAAAACAAGG + Intergenic
1127152437 15:56090658-56090680 ACAACAGACAACAAAACACTGGG + Exonic
1127159060 15:56161465-56161487 ACATTATAAAAGAAAAAAGTAGG + Intronic
1127160004 15:56172434-56172456 AAATAAGAAAATAAAGAAGTAGG + Intronic
1127173885 15:56332719-56332741 ACATCAAAAAAACAAAAAATTGG + Intronic
1127304696 15:57693809-57693831 GCCTCAGAAAATAAAAGAGTTGG + Intronic
1128423821 15:67520280-67520302 ACAAAACAAAACAAAAAACTGGG + Intergenic
1128848435 15:70924377-70924399 ACAGAAGAAAATAAAAACATAGG - Intronic
1128952635 15:71902794-71902816 ACATAATTAAATAAAAACCTGGG + Intronic
1129031433 15:72620811-72620833 ACATCAAAAAATGAGAAAATAGG + Intergenic
1129201137 15:74001120-74001142 ACATCAGAAATAAAAAAAGGGGG - Intronic
1129218506 15:74116626-74116648 ACATCAAAAAATAAGAAAATAGG - Intronic
1129478684 15:75806065-75806087 GCATCTGAAAATAAAATAGTAGG - Intergenic
1130240451 15:82183317-82183339 ACATGAGATAAAAATAAACTTGG + Intronic
1130401499 15:83559160-83559182 AAAACAGAAACAAAAAAACTTGG - Intronic
1130951846 15:88597411-88597433 GCATCAAAATATAAAAAACAAGG - Intergenic
1131008789 15:89000362-89000384 TGATCAGAAAATAAAAACTTGGG - Intergenic
1131650493 15:94392837-94392859 ACAAAAAAAAACAAAAAACTTGG + Intronic
1132306669 15:100819911-100819933 ACATCAGAAAATACAGCAGTTGG + Intergenic
1132420460 15:101661486-101661508 AGATCAGAAAATAAAAACTAAGG - Intronic
1132439002 15:101840369-101840391 ACAACAAAAAGTTAAAAACTGGG - Intergenic
1133092548 16:3415530-3415552 ACATCAGAAAATATAGGACCAGG - Intronic
1133550011 16:6845276-6845298 ACACTAGAAAAAAAAAACCTAGG - Intronic
1133646324 16:7768129-7768151 GAATCAGAAAAAAATAAACTTGG + Intergenic
1133714096 16:8430479-8430501 AAAGCAGAAAATAAAAAACAGGG + Intergenic
1133759960 16:8790661-8790683 AAATAAGAAAAGTAAAAACTGGG - Intronic
1133798356 16:9064868-9064890 AAAACAAAAAACAAAAAACTGGG + Intergenic
1134426747 16:14156180-14156202 CCATAAGAAACTAGAAAACTGGG - Intronic
1135934679 16:26769733-26769755 AAATCTGAAAATGAAAAATTTGG - Intergenic
1136594598 16:31239420-31239442 ACATTAAAAAAAAAAATACTGGG - Intergenic
1136987845 16:35127863-35127885 AAACCAGAAAAAAAAAAACCTGG - Intergenic
1137298342 16:47120243-47120265 AAATTTGAAAATACAAAACTAGG - Intronic
1137425288 16:48374302-48374324 ACATCAGAAAACAAGAACTTTGG + Intronic
1138033007 16:53575754-53575776 AAATTAAAAAATAAAAAACAAGG - Intergenic
1138384564 16:56627359-56627381 AAATCAGAAAATAAAAAGGAGGG - Intergenic
1138385651 16:56634226-56634248 AAATCAGAAAATAAAAATAAGGG - Intergenic
1138524791 16:57597886-57597908 AAATCAATAAAAAAAAAACTAGG - Intergenic
1138862768 16:60778089-60778111 CCATTAGAAAATAAAAACATTGG - Intergenic
1139115425 16:63945944-63945966 TCATCAGTAAAAAAAAAACATGG + Intergenic
1139204725 16:65016272-65016294 ACATCTGAAAAGAAAGAAATAGG - Intronic
1140164359 16:72534073-72534095 ACATCCCCAAATAAAAAAATAGG + Intergenic
1140315550 16:73893166-73893188 ACACCAATAAATAAAGAACTTGG + Intergenic
1140464535 16:75169629-75169651 ACATCAGAAAATAAAAAACTTGG + Exonic
1141061860 16:80880773-80880795 ACAGAAGAAAATCAATAACTTGG + Intergenic
1141200646 16:81895228-81895250 AAGTCAGAAAATAAAACACGTGG + Intronic
1141312784 16:82931510-82931532 ACATCAAAAAAAAAAAAAAGGGG - Intronic
1141371290 16:83488603-83488625 AAATAAAAAAATAAAAAAATAGG - Intronic
1141938592 16:87258952-87258974 AGACCAAAAAACAAAAAACTGGG - Intronic
1143277765 17:5725394-5725416 AGAGCAAAAAATAAAAAAATGGG + Intergenic
1143434870 17:6915862-6915884 AAACCAGTAAATAAAATACTGGG + Intronic
1143555903 17:7660109-7660131 ACAACTGAAAAAATAAAACTGGG - Intergenic
1144235054 17:13252333-13252355 AAATCAGAAAAGAAGAAAGTTGG + Intergenic
1145357554 17:22175557-22175579 AAATAAATAAATAAAAAACTTGG - Intergenic
1145940209 17:28739447-28739469 TCAAAATAAAATAAAAAACTAGG - Intronic
1146410246 17:32577288-32577310 AAAACACAAAATAAAAAATTAGG - Intronic
1146554688 17:33813421-33813443 AAATCAAAAACAAAAAAACTTGG - Intronic
1146614326 17:34341102-34341124 AAAACAGAAAATAAAAAAGCGGG - Intergenic
1146615284 17:34351535-34351557 ACAACAGAAAGTTAAAAAGTGGG + Intergenic
1146661627 17:34668715-34668737 ACATCAGAAAATAAAGGCTTGGG - Intergenic
1146965061 17:37019996-37020018 ACACCAGAAAAAAAAAATCTAGG - Intronic
1147368561 17:39975442-39975464 CCATCAAAAAAAAAAAAAATTGG + Intronic
1147412334 17:40262673-40262695 ACATCAGAAATTAACACACCAGG - Intronic
1148118802 17:45195162-45195184 ACAACAAAAAAAAAAAAACAGGG - Intergenic
1148254045 17:46112694-46112716 ACAAAACAAAACAAAAAACTGGG + Intronic
1148254519 17:46117727-46117749 ACATAAATAAATAAAAAGCTAGG + Intronic
1149261048 17:54879758-54879780 AAAGCAAAAAATAAACAACTTGG + Intergenic
1149631200 17:58125601-58125623 ACTTCAGGAAGTAAAAAAGTTGG - Intergenic
1149717231 17:58803916-58803938 ACAAAATAAAATAAAAAATTAGG - Intronic
1150152169 17:62819127-62819149 GCATCAGAAAAAAAAAAATCAGG - Intergenic
1150636844 17:66918981-66919003 AGATCAGAAAAGAAGAGACTGGG + Intergenic
1151040061 17:70849098-70849120 ACCTCAGAAAAAAAAAAAATAGG - Intergenic
1151273155 17:73012525-73012547 AAAAAAGAAAAAAAAAAACTGGG - Intronic
1151359010 17:73577325-73577347 AAATAAGAAAATGAATAACTGGG - Intronic
1151409353 17:73911293-73911315 ACATCTGTGAAAAAAAAACTTGG + Intergenic
1151503536 17:74510387-74510409 ACAACAAAAAATTAAAAAGTGGG - Intergenic
1151826593 17:76527404-76527426 ACATCAGAAACTAGAAAAGGAGG + Exonic
1151920571 17:77151880-77151902 ACACCAGGAAAGAAAAAAGTGGG - Intronic
1152837374 17:82542465-82542487 ATAAAATAAAATAAAAAACTGGG - Intronic
1152972491 18:176615-176637 ACATTTGAAAACAATAAACTAGG - Intronic
1153376201 18:4382443-4382465 TCATGAGAAAAAAAATAACTGGG + Intronic
1153570057 18:6461964-6461986 ACATGAGAAAATAGAGAACATGG - Intergenic
1153639325 18:7142081-7142103 ACATCAGAAAAGAGAAAACGAGG - Intergenic
1153864862 18:9256838-9256860 AGATCAGAAAATGAAAAGCCGGG + Exonic
1153973932 18:10250107-10250129 ACAACAGAAAATAATAAAAGAGG - Intergenic
1154386803 18:13900087-13900109 ACAACAGAAAGTTAAAAAGTGGG + Intronic
1155037662 18:22038926-22038948 ACATCATAAAACAATTAACTTGG - Intergenic
1155389037 18:25313703-25313725 AAAACAGAAATTAAAAAATTAGG - Intronic
1155647443 18:28095972-28095994 ACATCAGAAAACAAACTATTTGG + Intronic
1155802031 18:30117682-30117704 ACATCAGAAAAGAAAAACAATGG + Intergenic
1156111559 18:33733219-33733241 GCATTTGAAAATAAAACACTGGG - Intronic
1156167640 18:34442209-34442231 TCCTCAGAAAATAAAATACCTGG - Intergenic
1156179424 18:34585714-34585736 ACATTTGAAAATCAAAAAGTAGG + Intronic
1156293331 18:35769214-35769236 GCATCAAAAAATAAAATAGTGGG - Intergenic
1156693799 18:39741755-39741777 ACATTAGAAAATAAAGATCCTGG + Intergenic
1156747520 18:40410447-40410469 ACATAAGAAGTTAAAAAAGTGGG + Intergenic
1157094043 18:44670657-44670679 ACACCAGGAAAAAGAAAACTAGG - Intergenic
1157351331 18:46889215-46889237 ACAACAAAAAATAAACAAATTGG + Intronic
1157418894 18:47528358-47528380 ATTTCAGAAAATAAAAAAAGTGG - Intergenic
1157445294 18:47741222-47741244 ACACCAGAAAATAGAAATCCAGG - Intergenic
1157453720 18:47807777-47807799 ACATCAGAAAAACCAAATCTGGG - Intergenic
1157515782 18:48310225-48310247 ACCTCAAAAAAAAAAAAAATTGG + Intronic
1158528853 18:58240169-58240191 ACATCTGAAAAAAAAATACAAGG - Intronic
1158845964 18:61443234-61443256 ACAGCATAAATGAAAAAACTGGG + Intronic
1159233636 18:65642269-65642291 ACATTTGGAAATCAAAAACTTGG - Intergenic
1159479351 18:68967324-68967346 ACCTCAAAAAATAACTAACTTGG + Intronic
1159730862 18:72025745-72025767 ACATCACTAAATAAAAGACAAGG - Intergenic
1160009340 18:75092147-75092169 ACATTAAAAAATAAAATACCAGG - Intergenic
1160265082 18:77335281-77335303 ATATCAGAACACAAAACACTGGG + Intergenic
1160610229 18:80078686-80078708 ACACCAGAAAATAAAAACAATGG + Intronic
1161361923 19:3855194-3855216 ACATTAAAAAAAGAAAAACTTGG - Intronic
1161993895 19:7700811-7700833 ATCTCAAAAAATAAAAAAATAGG - Intronic
1162190539 19:8942386-8942408 ACATAAATAAATAAAAATCTGGG - Intronic
1162693515 19:12453085-12453107 ACAGTAGAAAAAAAAAAAATAGG + Intronic
1162843410 19:13372743-13372765 AAATAAGAAAACAAAAAAATGGG + Intronic
1164247343 19:23443242-23443264 ACATTAGAAAAAAAAAAGCATGG + Intergenic
1164494491 19:28746905-28746927 AAAACAGAAAATAAATAAATAGG - Intergenic
1164731369 19:30507364-30507386 AAAACAAAAAACAAAAAACTGGG + Intronic
1165251671 19:34542386-34542408 ACATCAGAAAAAATTATACTGGG - Intergenic
1165414663 19:35685138-35685160 ACAAAACAAAACAAAAAACTGGG - Intergenic
1165677956 19:37744573-37744595 ACAAAAAAAAATTAAAAACTTGG + Intronic
1166552006 19:43671968-43671990 ACTTAAAAAAAAAAAAAACTTGG - Intergenic
1166820459 19:45576233-45576255 ACAAAACAAAACAAAAAACTGGG + Intronic
1167724882 19:51204228-51204250 ATAAAATAAAATAAAAAACTAGG + Intergenic
1168138125 19:54365250-54365272 AGATCACAATATTAAAAACTTGG - Intronic
1168159767 19:54502500-54502522 AGATCACAATATTAAAAACTTGG + Intronic
1168395074 19:56040581-56040603 AAATAAGAAAATAAATAAATTGG + Intronic
925209386 2:2033608-2033630 ACATTAAAAAAAAAAAATCTGGG + Intronic
925411008 2:3640259-3640281 TCACCTGAAAATAAAAAACAAGG - Exonic
925660819 2:6200264-6200286 ACATCAGAAAATCTAAATCGAGG - Intergenic
925850352 2:8075586-8075608 ATTTCAGAAAAAAAAAAAATGGG + Intergenic
926167957 2:10533342-10533364 AAATAAATAAATAAAAAACTTGG - Intergenic
926472590 2:13279732-13279754 AAAGCAAAAAACAAAAAACTGGG - Intergenic
926938541 2:18111914-18111936 ACATCGGTAAACAAAAAAATTGG + Intronic
927221784 2:20717676-20717698 ACATCAGAAATTCAAAATGTAGG + Intronic
927600012 2:24432479-24432501 AGAAAAGAAAAGAAAAAACTTGG - Intergenic
927622897 2:24681060-24681082 ACATAAAAAAAAAAAAAAATAGG + Intronic
927800390 2:26093874-26093896 ACATGAGAAAAACAAAAACAAGG - Intronic
927803598 2:26124296-26124318 CTATAAGAAAAAAAAAAACTAGG - Intronic
927953153 2:27187791-27187813 ATAAAAGAAAATAAAATACTGGG + Intergenic
928160093 2:28914923-28914945 ATCTCAAAAAATAAAAAATTTGG + Intronic
928271819 2:29862818-29862840 TCTTGAGAAAAAAAAAAACTGGG + Intronic
928556232 2:32428122-32428144 ACAACAGAAAATAAAAGCCAGGG - Intronic
928659648 2:33488951-33488973 AAACCAGAAAAAAAAAAAATCGG - Intronic
928783797 2:34856681-34856703 ACAACAAAAAATAAAAAAGCTGG + Intergenic
928823028 2:35386039-35386061 ACATAAGTAAATGTAAAACTAGG + Intergenic
928857818 2:35821477-35821499 AAATCAGAAAAAAAAAATTTTGG + Intergenic
929194379 2:39170432-39170454 ACAACAAAAAACTAAAAACTGGG - Intergenic
929643669 2:43606804-43606826 ACATTAAAAAAAAAAAATCTGGG - Intergenic
930793107 2:55355977-55355999 AAATAAATAAATAAAAAACTAGG - Intronic
930813349 2:55566242-55566264 AAATCAGAAATTAGAAACCTAGG + Intronic
930904040 2:56544306-56544328 ACATCAGAACATAAATTAATGGG + Intergenic
930909273 2:56611183-56611205 ACAGAAAAAAAAAAAAAACTGGG - Intergenic
931146534 2:59525800-59525822 TCATTAGAAAAAAAAGAACTAGG - Intergenic
931359959 2:61569893-61569915 ACATTAAAAAAGAAAAAATTGGG - Intergenic
931568637 2:63644146-63644168 ACATCAAAAAATAAAACTATAGG - Intronic
931829999 2:66040836-66040858 ACATTAGAAAAAATAAAACTCGG + Intergenic
931989476 2:67775775-67775797 ACAAATGAAAATACAAAACTCGG + Intergenic
933017131 2:77141683-77141705 ATTTCAGAAAATAAAAACTTAGG - Intronic
933074109 2:77901282-77901304 ACAACAGAAAAATAAAAAATGGG - Intergenic
933081765 2:77997688-77997710 ACAACAGAAAATAAAAACTAAGG + Intergenic
933357424 2:81229972-81229994 ACACCAGAAAATTAAAGAATAGG - Intergenic
933569458 2:83992269-83992291 ACATCAGACAAGAAGAATCTTGG - Intergenic
934959911 2:98663616-98663638 ACATCAGAAAAATCCAAACTGGG + Intronic
935161249 2:100531423-100531445 AAAACAAAAAATAAAAAAATAGG + Intergenic
935257432 2:101323774-101323796 GCATCAAAGAATAAAAAACAAGG - Intergenic
935339729 2:102049020-102049042 ACAAAACAAAAAAAAAAACTAGG - Intergenic
935442337 2:103115092-103115114 ACATCCAAAAAAAAAAAAATAGG + Intergenic
935764534 2:106352811-106352833 AAAACAAAAAAAAAAAAACTGGG - Intergenic
935799288 2:106677134-106677156 ACATCATAACAAAAATAACTAGG - Intergenic
936157764 2:110059921-110059943 CCATCATAAAATAGAAATCTGGG - Intergenic
936186928 2:110311523-110311545 CCATCATAAAATAGAAATCTGGG + Intergenic
936413403 2:112281046-112281068 ACAGCAATAAAGAAAAAACTTGG + Intronic
936925407 2:117731417-117731439 ACAGCATAAAATAAACTACTAGG + Intergenic
937659680 2:124416356-124416378 TCATCAGAAAAAAAAAAAAGAGG - Intronic
937775592 2:125771827-125771849 TCATCAAAAAAGAAAAAATTAGG + Intergenic
937962476 2:127471078-127471100 AGATCAGAAAATAAAAGCCAAGG + Intronic
938472019 2:131573390-131573412 ACATCAAAAAATAATAAATGTGG - Intergenic
938630849 2:133165580-133165602 ACTGCAGAAAATCAAAAGCTGGG + Intronic
938863769 2:135397281-135397303 AAAACTAAAAATAAAAAACTAGG + Intronic
939008903 2:136821957-136821979 ACATCAGGATATGAATAACTAGG + Intronic
939055028 2:137354550-137354572 AAATTATAAAATAAAATACTTGG - Intronic
939159693 2:138573111-138573133 ACATCAGCTAATTAAAAACGAGG - Exonic
939198183 2:138999530-138999552 AGATTATAAAATAAAAAACCAGG + Intergenic
939426266 2:142041106-142041128 AAATCAGAAAAGAAAAAAAAAGG - Intronic
939476554 2:142694572-142694594 AAATCAGCAAATAAAATACTGGG + Intergenic
939624702 2:144462418-144462440 ACAAAAGAAAACAAAAAACCAGG + Intronic
939697890 2:145350373-145350395 ACTTCATGAAGTAAAAAACTTGG - Intergenic
939731656 2:145792503-145792525 ACTTCAGTATATAAAAAACTTGG - Intergenic
939747586 2:145994801-145994823 ACATCAAAAAAAAAAAAAAAAGG + Intergenic
940094898 2:149963037-149963059 ACACTAGAAAATAAAAAACATGG - Intergenic
940773992 2:157867675-157867697 ACATTAAAAAAAAAAAAACATGG - Intronic
941009284 2:160280634-160280656 ACATGAGAAAATCACAAATTTGG - Intronic
941046356 2:160680003-160680025 ACATCTATAAATAAAAAACTGGG + Intergenic
941411899 2:165168054-165168076 ACATTAGAAAAGAATCAACTGGG + Intronic
941459603 2:165753398-165753420 ACATTAAAAAAAAAAAAAGTAGG - Intronic
941637992 2:167956558-167956580 ACCTCAGAAAAAAAAAAAAAAGG + Intronic
941897671 2:170645833-170645855 ACAGAAGAAAATTCAAAACTTGG - Intronic
942258496 2:174132512-174132534 ACATTAGAAAACAACAAATTTGG + Intronic
942324396 2:174763742-174763764 ACATCTTAAAAAAAAAAAGTAGG + Intronic
942510294 2:176691560-176691582 ACATCAGAAAATAGAGATTTAGG + Intergenic
942808453 2:179965313-179965335 ACATCAGAACATAAATAAACTGG - Intronic
943035269 2:182737048-182737070 ACATTAGAAAATAAACAATTAGG - Intronic
943222429 2:185127527-185127549 ACTTCAGGAAATAAGAATCTAGG + Intergenic
943365713 2:186965925-186965947 ACATCCAAGAATAAATAACTGGG - Intergenic
943384611 2:187185804-187185826 ACATAAGAAAATTAAAACTTGGG + Intergenic
943744973 2:191452694-191452716 ACATCAAAAATTACAAAACTTGG - Intergenic
943817883 2:192278860-192278882 TCATCAAAAAATCAGAAACTGGG - Intergenic
943926492 2:193789631-193789653 AAATTAGAAAATAAGAAAATTGG - Intergenic
944091351 2:195915470-195915492 ATATCAGAACTTAAAAAATTGGG + Intronic
944376519 2:199050894-199050916 AGATATGAAAATAAAAAATTTGG - Intergenic
944874987 2:203954282-203954304 ATTTCAGAAAATGAAAAAGTGGG + Intronic
945165859 2:206943598-206943620 TCTTCAGGAAAAAAAAAACTGGG + Intronic
945528156 2:210914806-210914828 ACAAAACAAAACAAAAAACTAGG + Intergenic
945564547 2:211380941-211380963 AAATCAGAAAAAAAAAATCAAGG + Exonic
945657454 2:212642822-212642844 AAAACAAAAAATAAAATACTTGG - Intergenic
945764545 2:213958580-213958602 ACATCAGCAACTGAAAAAGTTGG - Intronic
945828749 2:214757287-214757309 ACATTAGAAAAAAAAAAAACTGG - Intronic
945964375 2:216170269-216170291 GCATGAGAAAACAAAACACTGGG - Intronic
945965833 2:216185507-216185529 CCATCAGCAAATAAAAGTCTAGG - Intronic
945971092 2:216232773-216232795 ACATCAAAAATTCAAAAATTTGG + Intergenic
946592869 2:221270861-221270883 ACAGCAAAAAAAAACAAACTTGG + Intergenic
946674290 2:222142037-222142059 CCATCTGAAAATGAAAAACAAGG + Intergenic
946819155 2:223612673-223612695 ACAGCAGAAGGTAGAAAACTGGG + Intergenic
946858279 2:223975039-223975061 ACATCAGGAAATTCAAAGCTCGG - Intergenic
946985661 2:225269820-225269842 ATATCAGAAAATAAACACTTTGG + Intergenic
947037989 2:225881797-225881819 AGATTAGCACATAAAAAACTGGG + Intergenic
947089468 2:226493959-226493981 ACATCAGAAAAGAAATAACAGGG - Intergenic
947567515 2:231204010-231204032 AAACCAGAAAACAAAAGACTTGG + Intronic
947757311 2:232576196-232576218 CCATCTCAAAAAAAAAAACTGGG + Intronic
947829811 2:233131119-233131141 ACATCAGAAAATTAAAGTTTTGG - Intronic
947876744 2:233472697-233472719 ACACCAGAAAAAAAAAAACGGGG - Intergenic
948435534 2:237951173-237951195 AAAACAAAAAAAAAAAAACTGGG + Intergenic
948966771 2:241388129-241388151 ATCTCAGAAAAGAAAAAAGTTGG + Intronic
1168730594 20:76249-76271 ACATCAGAAACATAAAAAATGGG + Intergenic
1168811680 20:708911-708933 ACTTCAGAAAACAAAAAGTTGGG - Intergenic
1169430964 20:5535797-5535819 ACATCAAAAAAAAAAATAATAGG - Intergenic
1169503710 20:6185821-6185843 ACATGAGAAAATAAAGTTCTAGG - Intergenic
1169607932 20:7343995-7344017 ACCTCTGAAAATAAAACAATAGG - Intergenic
1170266093 20:14468367-14468389 AGATCAGAAAATAAAAAGAAGGG - Intronic
1170615923 20:17950868-17950890 TCATCAGAAATTAGGAAACTCGG - Intronic
1170974084 20:21144485-21144507 AAATGATAAAATAATAAACTAGG - Intronic
1171145197 20:22775122-22775144 ACATCAAGAAATAAGATACTGGG + Intergenic
1172084970 20:32374291-32374313 GTATCTAAAAATAAAAAACTGGG - Intronic
1174016478 20:47492633-47492655 ACAAAACAAAACAAAAAACTGGG + Intergenic
1174344458 20:49919724-49919746 TCTTCAGAAAATAATTAACTGGG - Intergenic
1174390946 20:50217936-50217958 ACATGGGAAAGCAAAAAACTGGG + Intergenic
1174667698 20:52275280-52275302 ACATCATAAATTTATAAACTTGG - Intergenic
1174897065 20:54461174-54461196 AAATTAGAAAATAAAAACCAAGG + Intergenic
1174942498 20:54945802-54945824 AAATAAGAAAATTAAAAACTTGG - Intergenic
1174943715 20:54961281-54961303 ACATTAAAAAATAAGAAAATGGG - Intergenic
1175125406 20:56747701-56747723 ACAACAAAAAAAAAAAAAATGGG + Intergenic
1175588943 20:60171726-60171748 AAATCAGAAAACAAATAAATGGG + Intergenic
1175833864 20:61981403-61981425 AAATCAGAACCTCAAAAACTAGG + Intronic
1175835592 20:61992261-61992283 ACAGCACAAAATACAAAACGGGG + Intronic
1176176576 20:63729497-63729519 ACAAGAGAAAATTAAAAACTGGG - Intronic
1176333612 21:5575111-5575133 ACATCACAATTAAAAAAACTAGG - Intergenic
1176394145 21:6245841-6245863 ACATCACAATTAAAAAAACTAGG + Intergenic
1176419941 21:6505972-6505994 ATATAAAAAAAGAAAAAACTTGG - Intergenic
1176467274 21:7070333-7070355 ACATCACAATTAAAAAAACTAGG - Intronic
1176490835 21:7452111-7452133 ACATCACAATTAAAAAAACTAGG - Intergenic
1176509807 21:7686272-7686294 ACATCACAATTAAAAAAACTAGG + Intergenic
1176673217 21:9753011-9753033 ACATAAAAAGTTAAAAAACTTGG + Intergenic
1177203737 21:17986968-17986990 ACATCACAAAATGACAAAATTGG + Intronic
1177374177 21:20247668-20247690 ACATATGATATTAAAAAACTTGG + Intergenic
1177444654 21:21177259-21177281 ACAAAAGAAAATAACAAACAGGG - Intronic
1177753362 21:25314912-25314934 GCATCAGAAAATAAAAGAAATGG - Intergenic
1177765735 21:25454943-25454965 TCATCAGACAGGAAAAAACTTGG + Intergenic
1177833396 21:26164895-26164917 AAAAAAGAAAAAAAAAAACTAGG + Intronic
1177927584 21:27237669-27237691 ACAAAAAAAAACAAAAAACTGGG + Intergenic
1178109847 21:29358868-29358890 AAATTAGAAAATAAAAAATGAGG + Intronic
1178260043 21:31090366-31090388 ACAACAAAAAACTAAAAACTGGG - Intergenic
1178331563 21:31699353-31699375 ACAACATAAAACAAAAAACTAGG + Intronic
1178510247 21:33199154-33199176 ACAATAGAGAATCAAAAACTAGG + Intergenic
1178687878 21:34725603-34725625 TCATCTGAAAACTAAAAACTTGG + Intergenic
1178712908 21:34935364-34935386 AAATCAGAAACTAAGAAACCAGG - Intronic
1178922924 21:36751015-36751037 ACGTCAAAAAAAAAAACACTTGG + Intronic
1178997353 21:37415627-37415649 ACCCCAAAAAATAAAAAACTTGG - Intronic
1179433836 21:41345667-41345689 ACATCTGAAAATAAAAGAAATGG - Exonic
1179506049 21:41841994-41842016 ACATGAGAAAATAAAACAGCTGG + Intronic
1179671106 21:42949214-42949236 ACACCACAAAACAAAAAAATGGG + Intergenic
1179695432 21:43114292-43114314 ATATAAAAAAAGAAAAAACTTGG - Intergenic
1179873823 21:44257380-44257402 AAATAAAAAAATAAAAAACAAGG + Intronic
1180034623 21:45238337-45238359 ACATCAAAACATTAAAAAGTGGG + Intergenic
1180133415 21:45843360-45843382 AGATCAGTAAATATAAAATTTGG - Intronic
1180472490 22:15673018-15673040 ACATCAAAAAATAATAAATGTGG - Intergenic
1180502171 22:15940163-15940185 ACATCACAATTTAAAGAACTAGG + Intergenic
1180929696 22:19580807-19580829 ACAACAGAAAATAAAAGCATTGG + Intergenic
1181065115 22:20302014-20302036 AAATTAAAAAAAAAAAAACTTGG - Intergenic
1181237894 22:21458909-21458931 AAATAAAAAAATAAAAAGCTGGG - Intergenic
1182114444 22:27747496-27747518 ACTTAAGAAACAAAAAAACTGGG + Intergenic
1182316416 22:29450234-29450256 AGAACAGAAAAGAAAAAAGTAGG + Intergenic
1182596052 22:31421420-31421442 AGCTCAGGAAATAAAAAACATGG - Intronic
1182938256 22:34247577-34247599 ACATCAGAGATTAAAGAAATAGG - Intergenic
1182951922 22:34384198-34384220 AGATCAGGAAATAAAAATCCAGG + Intergenic
1183204344 22:36408329-36408351 ACAACAAAAAAAAAAAAACAGGG - Intergenic
1184797742 22:46741600-46741622 ACATCAGAAACTAGAATGCTGGG + Intergenic
1203241167 22_KI270733v1_random:21165-21187 ACAAAACAAAACAAAAAACTTGG - Intergenic
1203289632 22_KI270735v1_random:22501-22523 ACAACAAAAAATGAAAAACAAGG + Intergenic
949217702 3:1589642-1589664 AAATCTGAAAAGAAAAAAATTGG + Intergenic
949595602 3:5542975-5542997 ACATCAAAAAAAAAAAAAAAAGG - Intergenic
949651772 3:6168199-6168221 ACATGAGAAAATACAAATTTGGG - Intergenic
949709323 3:6856211-6856233 ACCTCAGAAGAAAGAAAACTGGG + Intronic
950063752 3:10094186-10094208 AAATAAGAAAATAAAACCCTTGG + Intronic
950295304 3:11824606-11824628 ACATTAGAAAATACAAAAGTAGG + Intronic
950315390 3:11997443-11997465 ACCTCAGAAAAAAAAAAAAGAGG - Intergenic
950487931 3:13283652-13283674 AAATAATAAAATAAAACACTGGG + Intergenic
950782158 3:15401337-15401359 TCTACAGAAAATACAAAACTGGG - Intronic
951070204 3:18319602-18319624 TGTTCAGAAAATAAAACACTGGG - Intronic
951230662 3:20175183-20175205 AAATCTGTAAATAAAAACCTGGG + Intronic
951607169 3:24448668-24448690 ACATATAAAAATATAAAACTTGG + Intronic
951641286 3:24838923-24838945 ACATTAAAAAAAAAAAAACCTGG - Intergenic
951858971 3:27229058-27229080 AACTCAGTAAATAAAATACTAGG + Intronic
951873716 3:27396357-27396379 ATATCAGTAAATAAATAACAAGG + Intronic
952061962 3:29522186-29522208 ACAAAACAAAACAAAAAACTAGG - Intronic
952964707 3:38614040-38614062 GTATCAGAAAATATAAAACTAGG - Exonic
952993800 3:38856692-38856714 AAGTCAGTAAATAAAACACTGGG + Intronic
953057289 3:39398256-39398278 ATATCAGAAAAAAAAAAATCAGG + Intergenic
953269917 3:41431545-41431567 ACATCAAAAAAAAAAAAAAAGGG - Intronic
953302196 3:41788780-41788802 ACATTAGCATATTAAAAACTGGG + Intronic
953396764 3:42579291-42579313 ACAAAACAAAACAAAAAACTAGG + Intronic
953591172 3:44256213-44256235 ACCTCTGAAAATGAAACACTGGG + Exonic
953630649 3:44613750-44613772 ACAACAAAATATAAAAAAATTGG + Intronic
953675337 3:44997058-44997080 AAAACAGAAACAAAAAAACTGGG - Intronic
953692205 3:45129015-45129037 ACTTTAGAAAATAAATAACTTGG - Intronic
954083173 3:48224306-48224328 AAATCAGAAAATACAAGAATGGG + Intronic
954255450 3:49402388-49402410 ATTTCTTAAAATAAAAAACTAGG + Intronic
954255952 3:49406475-49406497 GCTTCAGAAATTAAAAATCTTGG + Intronic
955021557 3:55126606-55126628 AAATAAGAAAAAAAGAAACTGGG + Intergenic
955161004 3:56465700-56465722 ACATAATAAAATAAAAATTTTGG - Intronic
955634041 3:61006103-61006125 ACATTTGAAAATAAAGAGCTTGG + Intronic
955727223 3:61946095-61946117 ACAGCACAAAATTAAAAACTTGG + Intronic
955792731 3:62605246-62605268 AAAACAAAAAAAAAAAAACTGGG + Intronic
956076184 3:65508753-65508775 AAATAACAAAAGAAAAAACTGGG + Intronic
956184342 3:66548073-66548095 ACAAAACAAAACAAAAAACTTGG + Intergenic
956935276 3:74093921-74093943 GCCTCACAAAATATAAAACTTGG + Intergenic
957198499 3:77101735-77101757 ACATTAAAAAATAATAAAATTGG + Intronic
957281512 3:78155890-78155912 AAACCAGTAAATAAAATACTGGG + Intergenic
957324148 3:78670741-78670763 ACAACAGAAAAAAAGAAACAAGG + Intronic
957610519 3:82459683-82459705 AAATCAGAAAAAAAAAAGGTTGG - Intergenic
957842507 3:85689913-85689935 ACAACAGAAAGGAAAAAACAGGG + Intronic
957962504 3:87276049-87276071 ACATAAGAAAAGAATGAACTTGG - Intronic
958059178 3:88456656-88456678 ACATCTGAAAAAAAAAAAAAAGG - Intergenic
958835639 3:99141431-99141453 AAAACAGAAAATAAAAACATAGG - Intergenic
958940574 3:100308669-100308691 AAAGCAGAAAATAAAATTCTAGG - Intronic
959081540 3:101806897-101806919 CCAACACAAAATAATAAACTGGG - Intronic
959113606 3:102150266-102150288 ACAACAGAAAGTTAAAAAGTGGG + Intronic
959720910 3:109487740-109487762 AAAACAGAAAAAAAAAAAGTTGG - Intergenic
959803296 3:110521798-110521820 ACATCAGAGACTAAAACATTAGG + Intergenic
960099585 3:113726483-113726505 ACATAAAAAAAAAAAAAAATTGG + Intronic
960200410 3:114827872-114827894 ACACAGGAAAATAAAAAACCAGG - Intronic
960238385 3:115311942-115311964 GCATCAAAAAATAAAATACTTGG - Intergenic
960499126 3:118414020-118414042 ACAACAGAAAGTTAAAAAGTGGG + Intergenic
960578148 3:119247005-119247027 AACTCAGTAAATAAAATACTGGG + Intergenic
960761938 3:121081641-121081663 AATTCAGTAAATAAAATACTAGG - Intronic
960878598 3:122321855-122321877 AAATAAAAAAATAAAAAAGTGGG - Intergenic
960958779 3:123054403-123054425 ACACCTGCAAATTAAAAACTGGG + Intergenic
961531130 3:127541113-127541135 ACCTCAAAAAACAAAAAACAGGG + Intergenic
962183049 3:133228235-133228257 TCATGAGAAAACAAAAAACCTGG + Intronic
962229030 3:133644128-133644150 ACATCATAAAAGAAAATGCTGGG - Exonic
962296025 3:134188027-134188049 ACATCAATAAATTAAAAATTAGG + Intronic
962895298 3:139708572-139708594 ACATCAGCAGATAGAAATCTGGG - Intergenic
962898560 3:139737259-139737281 ACATCAGATAAGGAAAAAATTGG + Intergenic
963214908 3:142734287-142734309 ACATAAGAAAATAAGAGAGTTGG + Intronic
964229292 3:154444731-154444753 CCATCAAAATATACAAAACTGGG + Intergenic
964379613 3:156085065-156085087 ACATCATAAATTATAAAAATAGG - Intronic
964493462 3:157262393-157262415 AAATCAGAAAAAATAACACTTGG + Intronic
964518857 3:157542537-157542559 ACTGCATACAATAAAAAACTAGG - Intergenic
964855015 3:161137483-161137505 ACATTACAAAATAAAGCACTTGG - Intronic
964876610 3:161374336-161374358 ACAGCAGAAAATAATAAAGTAGG + Intergenic
965133350 3:164729649-164729671 ACTTCAAAAAAAAAAAAACCTGG - Intergenic
965236690 3:166134066-166134088 ACAACAAAAACTTAAAAACTTGG - Intergenic
965384296 3:168027472-168027494 TCATCAGAAAAAAAAAATCCTGG + Intronic
965424241 3:168501415-168501437 ACAGCAGAAAATAAAAGTCTAGG - Intergenic
965442426 3:168730857-168730879 AAATCAGAAGATAAAATACTTGG + Intergenic
965456827 3:168911826-168911848 CCAGCAGAAAGGAAAAAACTGGG + Intergenic
965779978 3:172274981-172275003 ACAACAGAAAAGAAAAAAAATGG - Intronic
966484034 3:180447727-180447749 TGATTAGAAAATAAAAAAATAGG + Intergenic
966553200 3:181229345-181229367 AACTCAGTAAATAAAACACTAGG - Intergenic
966589145 3:181660772-181660794 ACATGAGCAAATAAAAAACAAGG - Intergenic
966944962 3:184771296-184771318 ACATCGGAAAATAAACAAACTGG + Intergenic
966981061 3:185136218-185136240 ACATCAGATAATGAAAAAAAGGG + Intronic
967058970 3:185854614-185854636 ACATCAGAAAATAAGTTAATTGG + Intergenic
967246601 3:187492652-187492674 AAATCAGTAAATAAAACACTGGG + Intergenic
967472768 3:189881947-189881969 ACATAAGTAAAAAAAAAAATTGG - Intronic
967536416 3:190608805-190608827 ACATCACAGAATAAAAAAACAGG - Intronic
969147684 4:5138602-5138624 ACAACAGAAAAAAATAAACATGG + Intronic
969382010 4:6807771-6807793 AGATCAGAAAATAACAGACAAGG + Intronic
970129896 4:12856736-12856758 AAATAAAAAATTAAAAAACTGGG - Intergenic
970273325 4:14369650-14369672 CCATCTGAAAATAAAAATATTGG + Intergenic
970379041 4:15487962-15487984 ACAACAAAAAATAAAAAAGCAGG - Intronic
970753931 4:19400969-19400991 ACTTCAGAAAAAAAAAAAAAAGG - Intergenic
970784303 4:19777695-19777717 ACATAAGAAAATAAAAGAGGAGG + Intergenic
970894805 4:21089616-21089638 ATATCAAAAAGTAAAAAACTGGG + Intronic
970953592 4:21785288-21785310 ACTTCGAAAAAAAAAAAACTTGG + Intronic
971198875 4:24493914-24493936 ACAACAGCCATTAAAAAACTGGG - Intergenic
971422144 4:26482981-26483003 AGATAAGAAAATGAAATACTGGG + Intronic
971517654 4:27508871-27508893 AAAACAAAAAAAAAAAAACTGGG + Intergenic
971721127 4:30246640-30246662 AAGTCAGTAAATAAAATACTGGG - Intergenic
971838325 4:31798976-31798998 ACAACAGAAAGTTAAAAAGTGGG - Intergenic
971921111 4:32940675-32940697 ACATTAGAAAATAAAAATCAAGG + Intergenic
971925238 4:33001318-33001340 ACTACAAAAAAAAAAAAACTAGG - Intergenic
972034018 4:34497572-34497594 ACATCACAAAATAGAAGAGTTGG + Intergenic
972242876 4:37212962-37212984 AGATCAATAAGTAAAAAACTTGG - Intergenic
972423827 4:38914262-38914284 ACTTTAGAAAATAAGAAATTTGG + Intronic
972891018 4:43556111-43556133 ACATCAAAAAATCAAAATGTTGG - Intergenic
973091710 4:46146101-46146123 AACTCAGTAAATAAAATACTGGG - Intergenic
973871756 4:55173425-55173447 AGCTCAGGAAATAAAAAACCTGG + Intergenic
973896113 4:55414809-55414831 ACATCAGACAAACAAAAAATGGG - Intronic
974370513 4:61011452-61011474 ACAACAGAAAATATAAAAAATGG - Intergenic
974475887 4:62379247-62379269 ACTTCAAAAAAGAAAAAACCAGG + Intergenic
974553366 4:63410133-63410155 ACATTAGAAAAAAAGAAAATAGG + Intergenic
974563682 4:63555161-63555183 ATTTCAGAAAAGAAAAAACAAGG - Intergenic
974599599 4:64060290-64060312 ACATCAGAAAATCAAGAATATGG + Intergenic
974788574 4:66655292-66655314 ACATCAGAAAAGAGAAAACTAGG + Intergenic
974848389 4:67379138-67379160 AACTCAGTAAATAAAATACTGGG + Intergenic
975105374 4:70562448-70562470 ACTTCAGAAAAGGAAATACTTGG + Intergenic
975231630 4:71941395-71941417 ACTGCAGAAAATAATAAATTTGG + Intergenic
975763717 4:77643916-77643938 ACAACAAAAAATTAAAAATTGGG + Intergenic
975954626 4:79822673-79822695 ACATCAGAAAGTGGAAATCTTGG + Intergenic
975970526 4:80029332-80029354 AAAGCAGAAAAAAAAAATCTTGG - Intronic
975977783 4:80118642-80118664 ACATCATAAATAAAAGAACTAGG + Intronic
976041303 4:80887978-80888000 ATATAAAAAAATAAAAAAATAGG + Intronic
976057995 4:81091581-81091603 ACATTTTAAAATAAAACACTAGG - Intronic
976065373 4:81181522-81181544 ACAGCAGAAAATAATAAAACAGG + Intronic
976128997 4:81864377-81864399 ACCTCAGATAATCAAATACTTGG - Intronic
976723921 4:88197193-88197215 ACAACAAAAAAAAAAAAACAAGG + Intronic
977045937 4:92069666-92069688 ATCTCAGAAAAAAAAAAACAAGG + Intergenic
977397191 4:96485378-96485400 TCATCAGAAAGTTAGAAACTAGG - Intergenic
977490589 4:97704964-97704986 ATATTAAAAAATAAAACACTGGG + Intronic
977784308 4:101015281-101015303 ACCTCAGAAAAAAAAAAAAAAGG - Intergenic
977860737 4:101956900-101956922 ACATCAGATAATTTAAAAATAGG + Intronic
977898495 4:102392141-102392163 AAAACAAAAAACAAAAAACTAGG - Intronic
978334853 4:107655956-107655978 AAGTCACAAAACAAAAAACTTGG + Intronic
978410682 4:108421914-108421936 ACTTCTGAAAAAAAAAAACATGG + Intergenic
978443522 4:108759098-108759120 ACATAAGAAAAGAAAAAAGAAGG - Intronic
978451385 4:108837935-108837957 ACATCAGAGAAAACAAAACTGGG + Intronic
978576109 4:110191582-110191604 ATTTCAGAAAATAAAATACTTGG + Intronic
978649972 4:110990422-110990444 ACATGATTAAAAAAAAAACTTGG - Intergenic
978813718 4:112879122-112879144 AAAACAAAAAACAAAAAACTAGG + Intronic
978959187 4:114655048-114655070 AAAACAAAAAACAAAAAACTAGG - Intronic
979138254 4:117138325-117138347 AAATCAGAAAAAAAAAAAAAAGG + Intergenic
979202288 4:117993046-117993068 ATTTCAGATAATAACAAACTGGG + Intergenic
979388324 4:120096876-120096898 ACTTCAGCAAATAAAAACATGGG + Intergenic
979434811 4:120675008-120675030 AACTCAGTAAATAAAATACTGGG + Intergenic
979566756 4:122162728-122162750 ACAACAACAAAAAAAAAACTGGG + Intronic
979701326 4:123670989-123671011 AAAACAAAAAATAAGAAACTAGG - Intergenic
980029520 4:127810846-127810868 AAATCAGGTAGTAAAAAACTTGG - Intronic
980889200 4:138796208-138796230 TCATTAGAAAAAAAAAAACAAGG - Intergenic
980945927 4:139320505-139320527 AAATAAGTAAATAAAAAACCCGG - Intronic
980980737 4:139652698-139652720 ACAAAACAAAACAAAAAACTGGG - Intergenic
981139597 4:141253402-141253424 AACCCAGAAAATAAAATACTAGG - Intergenic
981976410 4:150735132-150735154 TCATCAAAAAATTAAAATCTAGG - Intronic
982308956 4:153963972-153963994 AAAAAAGAAAAAAAAAAACTTGG + Intergenic
982363252 4:154546747-154546769 CCACCAGATAATAAATAACTAGG + Intronic
982825340 4:159997178-159997200 ATTTCAGAAAATAAAATACAAGG - Intergenic
982886237 4:160786321-160786343 ACAGCAGAAAATGAAACACAGGG - Intergenic
982895880 4:160924795-160924817 ACAACTAAAAATAAAAAAATAGG - Intergenic
983126091 4:163951962-163951984 ATATCACAAAATGAAAAACAAGG - Intronic
983280000 4:165668505-165668527 AAATCTGAAAAAAAAAAACCTGG - Intergenic
983311996 4:166076371-166076393 AAAACAAAAAATAAAAACCTGGG - Intronic
983376395 4:166934188-166934210 ACATAAGAAAATAAAAGTCACGG + Intronic
983411955 4:167410857-167410879 ACATCCGAAAAGAAAAGCCTAGG + Intergenic
983676627 4:170302215-170302237 ACATGCAAAAAAAAAAAACTGGG - Intergenic
984123029 4:175770023-175770045 ACAAAACAAAACAAAAAACTGGG - Intronic
984879854 4:184401204-184401226 ACTTCAGAAAATAAAATACTTGG - Intronic
985131932 4:186747270-186747292 AAATAATAAAATAAAAAATTAGG - Intergenic
985267511 4:188163784-188163806 ACATGAGAAAGAAAAAAATTGGG - Intergenic
985288011 4:188356856-188356878 ACAAAAGAAAAAAAAAACCTCGG - Intergenic
985331355 4:188839916-188839938 CCATCATAAAATAAAGTACTTGG - Intergenic
985570657 5:643051-643073 ACTCCAAAAAATAAAAAATTAGG + Intronic
986085317 5:4438814-4438836 ACCTCAAAAAACAAAAAATTGGG + Intergenic
986520423 5:8611114-8611136 TAATCAGATTATAAAAAACTGGG + Intergenic
986657363 5:10028542-10028564 ACAACAGAAAATTAAAAAGCAGG - Intergenic
986746643 5:10750703-10750725 ACTTCAGAAAATCAAATAATTGG - Intronic
986817068 5:11424485-11424507 ACATCAGTGCATATAAAACTGGG + Intronic
986973391 5:13364643-13364665 ACATAAGAAAATACAAAAACAGG + Intergenic
987212430 5:15696438-15696460 ACATTAAAAAATAAAAAAACAGG - Intronic
987269350 5:16290161-16290183 ACAGCAAAAAAAGAAAAACTGGG + Intergenic
987383167 5:17304745-17304767 ACAGCAGAAAGTAAAAATATGGG + Intergenic
987429124 5:17810248-17810270 TCACTAGAAAATAAGAAACTAGG - Intergenic
987521439 5:18990174-18990196 AAATCAGCAAATGAAAGACTTGG + Intergenic
987872484 5:23638761-23638783 ACATCAATAAATAAATAAATAGG - Intergenic
987977351 5:25031713-25031735 ACAACAAAAAATAGAAAAGTGGG - Intergenic
988088584 5:26504675-26504697 ATATCAGAACATAAAAACTTTGG - Intergenic
988177650 5:27747560-27747582 ACAACAGAAAATAAAACTATAGG + Intergenic
988340481 5:29963526-29963548 ACATAATAAAATAAAATAATGGG + Intergenic
988408479 5:30855325-30855347 ATTTCAGAAAATAAAAAAATAGG - Intergenic
989157111 5:38354742-38354764 CCATAAAAACATAAAAAACTGGG - Intronic
989769248 5:45122858-45122880 ACAAAACAAAACAAAAAACTTGG - Intergenic
990062425 5:51668530-51668552 ACCTCAGAGAATAAGAAACATGG - Intergenic
990247585 5:53878825-53878847 AAATTAAAAAATAAAAAATTTGG + Intergenic
990782518 5:59381906-59381928 ATAGGAGAAAACAAAAAACTAGG + Intronic
990856900 5:60278592-60278614 ACAACAGAAAAAAAATAAATGGG - Intronic
991078166 5:62565578-62565600 ACATCAAAAAATCAAAATGTGGG - Intronic
991174793 5:63674856-63674878 ATATGAGACATTAAAAAACTTGG + Intergenic
991277368 5:64865119-64865141 GCATTAAAAAAAAAAAAACTTGG + Intronic
991454353 5:66786268-66786290 AGATTAAAAAAAAAAAAACTTGG - Intronic
991733224 5:69608794-69608816 AAATTATAAAGTAAAAAACTGGG - Intergenic
991809659 5:70463940-70463962 AAATTATAAAGTAAAAAACTGGG - Intergenic
991861729 5:71019057-71019079 AAATTATAAAGTAAAAAACTGGG + Intronic
991912164 5:71572926-71572948 CCAGCTGAAAATAAAAAACAGGG + Intergenic
991914341 5:71591022-71591044 AATCCAGAAAATAAAAAACAAGG - Intronic
991944523 5:71887031-71887053 ATATCAAAACATAAAAAACAGGG - Intergenic
992424583 5:76643597-76643619 ACATCAGAAAAAAATGAAATAGG + Intronic
992842353 5:80708696-80708718 ATATAAGAACATAAAAATCTAGG - Intronic
993043347 5:82840007-82840029 AAATCAAAAAAAAAAAAACAAGG + Intergenic
993074831 5:83216114-83216136 TAATAAGAAAATAAACAACTGGG + Intronic
993278342 5:85891413-85891435 AAAACAGAAAAAAAAAATCTCGG - Intergenic
993642246 5:90419283-90419305 AAAACAGAAAATAATAAATTGGG + Intergenic
993642248 5:90419316-90419338 AAAACAGAAAATAAATAAATTGG + Intergenic
993642250 5:90419350-90419372 AAACCAGAAAATAAATAAATTGG + Intergenic
993772597 5:91949059-91949081 CCATCAAAAAAAAAAAAAATAGG + Intergenic
993849507 5:92989312-92989334 AAATGAGTAAATAAAAAAATGGG + Intergenic
993928740 5:93908188-93908210 GCATAAGAAAATAGAAAATTAGG + Intronic
993931351 5:93945067-93945089 ACACCAGAAAACCAAAAACCAGG + Intronic
994051132 5:95364051-95364073 ACAAAACAAAATAAAAAACAAGG - Intergenic
994290321 5:98022438-98022460 ATTTTAGAAATTAAAAAACTGGG + Intergenic
994436865 5:99747109-99747131 ACATCAGAAATTCAAAATTTGGG - Intergenic
994580617 5:101637071-101637093 TCATCAAATAATAAAATACTAGG + Intergenic
994632501 5:102303235-102303257 ACATCAGCAAATTAAAACATAGG + Intergenic
994634209 5:102323927-102323949 ATCTCAAAAAATAAAAAAATTGG - Intergenic
994726352 5:103440895-103440917 CCATTAGAAAATAAAACACAAGG + Intergenic
994823904 5:104687923-104687945 ACATCAAAATCTTAAAAACTGGG + Intergenic
994887962 5:105591013-105591035 ACATAAGAAAATAGTAAAATGGG - Intergenic
995202010 5:109435771-109435793 GCTTCAGAAAATAAAAAAAATGG + Intergenic
995319439 5:110815870-110815892 ACATAAGGAAATAAACAAGTGGG + Intergenic
995435634 5:112132164-112132186 ACAAAACAAAACAAAAAACTGGG - Intergenic
995640573 5:114252177-114252199 ACATAAGAAACAGAAAAACTAGG - Intergenic
995919082 5:117289012-117289034 ACAAAACAAAATAAAAAATTGGG + Intergenic
995991306 5:118243167-118243189 ACATTAGAAAAAGAAAAACAAGG + Intergenic
996110226 5:119556631-119556653 AACTCAGTAAATAAAATACTGGG + Intronic
996295000 5:121902337-121902359 ACATGAGAAAATAATAAAAATGG + Intergenic
996498823 5:124193138-124193160 ACATAAAATAAGAAAAAACTGGG + Intergenic
997132644 5:131292572-131292594 AAAACAAAAAACAAAAAACTTGG + Intronic
997219030 5:132143101-132143123 AAATCAGAAATATAAAAACTCGG + Intergenic
997276061 5:132591893-132591915 AAATCAGAAAAATAAAATCTAGG + Exonic
997740836 5:136252346-136252368 ACAAAACAAAACAAAAAACTGGG - Intronic
997756588 5:136405467-136405489 ACATAAAAAAAGAAAAAAGTAGG - Intergenic
998326515 5:141285410-141285432 ACATCAAAAAATAAAACCCTGGG + Intergenic
998532020 5:142894151-142894173 AGGTCAGAAAAAAAAAATCTCGG - Intronic
998544290 5:143012952-143012974 ACTTTAGAAAAGAAAAAAATCGG - Intronic
998565378 5:143211848-143211870 ACGTTAAAAAATAACAAACTAGG - Intronic
998689874 5:144575627-144575649 ACATCAGACCACAAAAAATTGGG - Intergenic
998992129 5:147829183-147829205 ATGACAGAAAATAATAAACTAGG - Intronic
999085772 5:148888277-148888299 ACTTCAAAAAATAAAAATGTGGG + Intergenic
999646362 5:153720866-153720888 ACATCATAAAAGGAAAGACTTGG - Intronic
999911190 5:156201717-156201739 AGATTAAAAAAAAAAAAACTAGG - Intronic
1000237740 5:159377844-159377866 AACTCAGTAAATAAAATACTGGG + Intergenic
1000435315 5:161200722-161200744 AAAATAAAAAATAAAAAACTAGG + Intergenic
1000671398 5:164067529-164067551 ACATAAAAAAAAAAAAATCTTGG + Intergenic
1001464701 5:171953132-171953154 ACAAAACAAAATAAAAAATTAGG - Intronic
1001582920 5:172811931-172811953 ACTTTAGAAAATAGAACACTCGG + Intergenic
1002258039 5:177973754-177973776 ACACCAGAAAAAAAAAAAAGAGG - Intergenic
1002625859 5:180528613-180528635 AAATTAGAAAATAAAAGAATCGG - Intronic
1002651051 5:180694588-180694610 TCAGCAAAAAATAGAAAACTAGG + Intergenic
1002692822 5:181062321-181062343 ACACCAGAAAATAAGGAAGTAGG + Intergenic
1002918831 6:1551240-1551262 ATCTCAGAAAAAAAAAAAGTGGG + Intergenic
1003134181 6:3420469-3420491 AAATAAGAACATAAAAAAATTGG + Intronic
1003253317 6:4452287-4452309 AGATCAGAAATCCAAAAACTGGG + Intergenic
1003292881 6:4795254-4795276 ACATCAGAAAATAAAAATAAGGG - Intronic
1003669458 6:8142753-8142775 AAATAAAAAAATAAAAAAATAGG + Intergenic
1003908355 6:10722298-10722320 ACATAAAAAAAAAAAAAACTTGG + Intergenic
1004002540 6:11608354-11608376 ACAGCAAAAAAGAAGAAACTGGG + Intergenic
1004383227 6:15150160-15150182 AAAACAAAAAACAAAAAACTGGG - Intergenic
1004530734 6:16453087-16453109 ACGTGAGAAAATAAAAAAACTGG + Intronic
1004795162 6:19074224-19074246 ACAACAAAAAGTCAAAAACTAGG + Intergenic
1004915014 6:20323360-20323382 ACATCACAAAAGGAAAAAATAGG + Intergenic
1005740281 6:28784728-28784750 ACATTAGAAAAGAAAAAAGTCGG + Intergenic
1005758985 6:28950425-28950447 ACTCCAGAAAAAAAAAAAATAGG - Intergenic
1005890451 6:30133193-30133215 ACATTAAAAAAAAAAAAGCTTGG - Intergenic
1006036212 6:31214777-31214799 ACATGATAACATAACAAACTAGG + Intergenic
1006088371 6:31613171-31613193 AAAACAAAAAACAAAAAACTGGG + Intergenic
1006091091 6:31629471-31629493 GAATCAGCAAAGAAAAAACTTGG - Intronic
1006115015 6:31771030-31771052 AGAAAAGAAAAAAAAAAACTGGG + Intronic
1006261041 6:32870700-32870722 AGAGCAGAAAAGAAAAAAATAGG + Intergenic
1007678140 6:43615259-43615281 ATCTCAGAAAATAAAAAATAGGG + Exonic
1008268231 6:49459012-49459034 CCCCCAAAAAATAAAAAACTAGG + Intronic
1008336667 6:50314029-50314051 AGATTTGAAAATAAAAAATTAGG - Intergenic
1008410850 6:51177501-51177523 AAAAAAGAAAATAAAAAAATTGG - Intergenic
1008475819 6:51934648-51934670 AATTAAGAAAAAAAAAAACTGGG + Intronic
1008826499 6:55701116-55701138 AAAACAGAAAACAAAAAAGTGGG - Intergenic
1008854740 6:56069573-56069595 ACATAACAAAATAAAAATATTGG - Intronic
1008905681 6:56675551-56675573 TAATAAGAAAACAAAAAACTTGG + Intronic
1008913124 6:56758049-56758071 ACAGCACAAAGTAAAGAACTTGG + Intronic
1009230370 6:61054065-61054087 ACATCAGAGAGCAAAACACTAGG + Intergenic
1009569346 6:65362136-65362158 AAATGAGAAAATCAAATACTTGG - Intronic
1009815786 6:68732945-68732967 ACATTAGAAATAAAAAATCTTGG - Intronic
1009873232 6:69474046-69474068 TCAGCAGAAAAAAAAAAACTGGG + Intergenic
1009920185 6:70048906-70048928 CCATCAGAAAATTATAAAATGGG - Intronic
1009947532 6:70356897-70356919 ACAAAAAAAAAAAAAAAACTGGG + Intergenic
1010021385 6:71163710-71163732 ACATGAGTACACAAAAAACTGGG - Intergenic
1010405312 6:75498203-75498225 ATACCAGAAAAGAAAAAAATTGG + Intergenic
1010431738 6:75785432-75785454 ACAAAACAAAACAAAAAACTAGG - Intronic
1010614704 6:77998152-77998174 AAATCAGAAAAAAAATAACATGG - Intergenic
1010786899 6:80013682-80013704 ACATAACAAAAAACAAAACTTGG - Intronic
1011052078 6:83163202-83163224 AAAAAAGAAAATAAAAACCTTGG + Intronic
1011105619 6:83777116-83777138 AAATAAGAAAATGAACAACTGGG + Intergenic
1011147481 6:84234486-84234508 ACATCAGAATCTGAAAAACCTGG + Intergenic
1011266745 6:85529046-85529068 ACCTCAGAAAAAAAAAAAAAAGG + Intronic
1011914421 6:92486125-92486147 ACAATAAAAAGTAAAAAACTTGG - Intergenic
1011983239 6:93412294-93412316 AGATGAGAAAATAAAAATCATGG + Intronic
1011989372 6:93494112-93494134 ACATTAGAAAAGAATAATCTTGG - Intergenic
1012077585 6:94711254-94711276 TTATAATAAAATAAAAAACTAGG + Intergenic
1012262166 6:97100229-97100251 TCATCATAGTATAAAAAACTAGG - Intronic
1012440735 6:99260108-99260130 ACATCAGGAAACAACAGACTAGG + Intergenic
1012491645 6:99788824-99788846 AAAGCAAAAAAAAAAAAACTAGG - Intergenic
1012867018 6:104630740-104630762 GCATAAGAAAAAAAAACACTTGG - Intergenic
1012920405 6:105216622-105216644 AAAACAAAAAACAAAAAACTTGG + Intergenic
1013012201 6:106131078-106131100 TCAACAGAAAAGTAAAAACTAGG - Intergenic
1013371525 6:109474877-109474899 AAATTAAAAAATAAAAAATTAGG + Intronic
1013672382 6:112419195-112419217 ACAAAAGAAAATAAAATACCTGG - Intergenic
1013675752 6:112460338-112460360 AAATTATAAAATAAGAAACTAGG + Intergenic
1013744057 6:113323532-113323554 AGCTCTTAAAATAAAAAACTTGG + Intergenic
1013762902 6:113538815-113538837 TCCTCAGAAAATAAAAAATATGG - Intergenic
1013984788 6:116177803-116177825 TCAGCAGAAAATAAACAAATGGG - Intronic
1014595847 6:123337647-123337669 AAATTAGAAAAGAAAAATCTGGG - Intronic
1014596973 6:123357066-123357088 TCATCAGAAAAGAAAAAAGGCGG - Intronic
1014654380 6:124081270-124081292 ACTGCAGAAAATATAAAACATGG + Intronic
1015051487 6:128846042-128846064 ACAACAACAAAAAAAAAACTAGG - Intergenic
1015504513 6:133968662-133968684 ACAAAACAAAACAAAAAACTTGG - Intronic
1015545832 6:134360377-134360399 GCAGCAAAAAATAAAAAGCTTGG + Intergenic
1015592504 6:134835706-134835728 ATATCAGAAAAAGAAAAACATGG + Intergenic
1015827964 6:137335897-137335919 ACATGTGAAAAAAAAAAACAGGG + Intergenic
1016193604 6:141303098-141303120 ACCTCAGAAAATAAAGAGCCAGG + Intergenic
1016313822 6:142763667-142763689 AGATAAGAAAATAAAAACTTTGG - Intronic
1016406118 6:143732873-143732895 AAATCAGAAAAGAAAAGACAAGG - Intronic
1016435508 6:144033104-144033126 ACATCAGCAAATAAACAAAATGG + Intronic
1016961211 6:149674376-149674398 ATCTCAAAAAATAAAAAATTTGG - Intronic
1017071752 6:150581280-150581302 ACCTCAAAAAAAAAAAAATTGGG - Intergenic
1017105714 6:150885609-150885631 GAATCAGAAAATAAAGAAGTAGG - Intronic
1017205263 6:151798189-151798211 ACAGCAGAAAAAAAAACACCTGG - Intronic
1017242944 6:152191232-152191254 ACATCAAAAAAAAAAAAAAAAGG - Intronic
1017341006 6:153321692-153321714 AAATAAGAAAAAAAAAAACAAGG - Intergenic
1017466768 6:154701389-154701411 AGAAGAGAAAACAAAAAACTTGG - Intergenic
1017480374 6:154847800-154847822 ACATCTGAAAAAAATTAACTGGG - Intronic
1017654603 6:156615392-156615414 TAATCAGAAAAAAAAAAAATAGG + Intergenic
1018093931 6:160368194-160368216 CCCTGAGAAAATAGAAAACTTGG + Intronic
1018410075 6:163535932-163535954 AAAAAAGAAAAGAAAAAACTAGG + Intronic
1018447570 6:163871674-163871696 ATTTTAGAAAAAAAAAAACTTGG - Intergenic
1018464041 6:164026523-164026545 ACATTAAAGAATAAAAACCTAGG - Intergenic
1019200991 6:170315089-170315111 ACAGCAGAAAGGAAAAAACAAGG - Intronic
1019641973 7:2108136-2108158 CCATCAGAAGAGAACAAACTTGG + Intronic
1019798244 7:3068000-3068022 AAAGCAGAAAATAAAACACAAGG - Intergenic
1020268375 7:6577083-6577105 ACATAAGTAAATAAGAAAATAGG + Intergenic
1020744124 7:12059590-12059612 AAATCAGAGAACAAAAAAATGGG + Intergenic
1020795050 7:12668780-12668802 ACATAAGAAAATAAATAGATAGG + Intergenic
1020971147 7:14940880-14940902 TCTTCATAAAATAAAATACTTGG - Intronic
1020975564 7:15001993-15002015 AAACAAGAAAACAAAAAACTGGG - Intergenic
1021048202 7:15949644-15949666 ATGCCAGAAAATAAGAAACTGGG + Intergenic
1021152288 7:17166328-17166350 ACAGGAGTAAAGAAAAAACTGGG - Intergenic
1021243494 7:18233914-18233936 ACTTAAGAAAAAAAAAAACTTGG - Intronic
1021353936 7:19630319-19630341 ACAACAAAAAGTAAAAATCTGGG + Intergenic
1021358376 7:19682629-19682651 AAATCATAAATTAAAAAACATGG - Intergenic
1021440912 7:20674688-20674710 AAATAAGAAAAAAAAAAAGTAGG + Intronic
1021534602 7:21689107-21689129 ACACCTGAACACAAAAAACTGGG - Intronic
1022301938 7:29110022-29110044 ACCTGAGAAAGAAAAAAACTGGG + Intronic
1022728273 7:32999960-32999982 ACATCAGACAAAAACAAATTGGG - Intronic
1022774078 7:33506306-33506328 ACAAAAGAAAATACAAATCTCGG + Intronic
1023193094 7:37604177-37604199 TCCTCAGAAAATAAAAAAGGAGG - Intergenic
1023366947 7:39474208-39474230 GAATCAGAAAATAAAGGACTTGG - Intronic
1023450189 7:40276022-40276044 ACATGGGAAAATAGTAAACTTGG + Intronic
1023462052 7:40409118-40409140 TCAACAAAAAATACAAAACTTGG - Intronic
1023467098 7:40468332-40468354 ACATGAGAAAATAAAAAATAAGG - Intronic
1023886857 7:44363825-44363847 ACAATACAAAACAAAAAACTCGG + Intergenic
1023977090 7:45038620-45038642 ACTACAGAAAAAAATAAACTGGG - Intronic
1024411031 7:49041341-49041363 ACAACAAAAAGTTAAAAACTGGG + Intergenic
1024791302 7:52967697-52967719 CCATCACAAAATAACAGACTGGG + Intergenic
1025045378 7:55688057-55688079 ACATCAGACAAAAACAAATTGGG + Intergenic
1025723834 7:64039639-64039661 ACAACAAAAAAAACAAAACTTGG + Intronic
1025768160 7:64477611-64477633 TAATCAAAAAATAAAAAAATAGG - Intergenic
1025771012 7:64506486-64506508 ACAAAAGAAACTAAAAGACTAGG - Intergenic
1025779617 7:64588621-64588643 ACATCAAAAAGTTAAAAAGTGGG - Intergenic
1026373853 7:69730181-69730203 AAATAAAAAAAGAAAAAACTTGG - Intronic
1026571479 7:71535057-71535079 ACAAAAGAAAATACAAAACTAGG - Intronic
1027290782 7:76708290-76708312 ACAGGGGAAAATAAAAAAGTAGG + Intergenic
1027444087 7:78252638-78252660 ATATAAGAAAAAAAAAAACTTGG + Intronic
1027879616 7:83817775-83817797 ACATCAGATCATCAAAAAATTGG - Intergenic
1027994042 7:85400838-85400860 TCATAAGCAAATAAAAAACTTGG + Intergenic
1028063772 7:86355104-86355126 AGATTAAAAAATAAAAAACAAGG + Intergenic
1028303810 7:89235756-89235778 TCCTCAGAAAAAAAAAAAATTGG - Intronic
1028351242 7:89852166-89852188 TCATCAAAAAAAAAAAAACCTGG + Intergenic
1028680117 7:93518242-93518264 ACATAAAAAAATCAAGAACTGGG + Intronic
1028789034 7:94832592-94832614 AAAACAAAAAATAAAAAAATAGG - Intergenic
1029281167 7:99436627-99436649 ACAACAACAAACAAAAAACTAGG + Intronic
1029499091 7:100916779-100916801 AAATAAAAAAATAAAAAAATTGG - Intergenic
1029556261 7:101271609-101271631 ACATCATAAAAGCAAAAACATGG - Intergenic
1030238806 7:107296243-107296265 AAAGCAGAAAATACAAAATTAGG + Intronic
1030334030 7:108304384-108304406 ACATCAAAAAAAAAAAAGCATGG - Intronic
1030390668 7:108923959-108923981 ACAACAAAAACTAAAAAACAGGG - Intergenic
1030419172 7:109286363-109286385 GCATCCAAAAAAAAAAAACTAGG + Intergenic
1030446848 7:109656371-109656393 ACATCGAAAAATGAAAAATTAGG - Intergenic
1030522579 7:110616845-110616867 ACATAAGCAAATCAAAAAATGGG - Intergenic
1030528971 7:110688583-110688605 ACATAAGTTAAAAAAAAACTAGG + Intronic
1030607183 7:111650197-111650219 ACCACAGAAAATAAAAGCCTGGG - Intergenic
1030640159 7:111995855-111995877 ACAGCTGAAAATGTAAAACTGGG + Intronic
1030863591 7:114669928-114669950 ACATTTGAAAATATAAAAATGGG - Intronic
1031004309 7:116454855-116454877 ACATAACAAAATCAAATACTTGG + Intronic
1031237324 7:119192746-119192768 ATACCAGAAAAAAAAAAATTAGG + Intergenic
1031298042 7:120028878-120028900 ACTTCACAAAATAAATATCTAGG - Intergenic
1031332528 7:120483495-120483517 AAATCAGAAGCTAAAAAACAAGG + Intronic
1031333799 7:120500386-120500408 ACATAAGAAAAGAAAAGAATAGG - Intronic
1031414774 7:121482946-121482968 CCATCAGAAAAGAAAAAAAATGG + Intergenic
1031684832 7:124720693-124720715 ACATACTAAAATAAAACACTTGG + Intergenic
1031774800 7:125894607-125894629 AAATCTGAAAATAAAAAAAAAGG + Intergenic
1032412127 7:131703245-131703267 AGAGAAGAAAATAAAAAATTGGG + Intergenic
1032421146 7:131780896-131780918 ACATAAAAACATAAAATACTAGG - Intergenic
1032442756 7:131954743-131954765 AAATGAGAAGAGAAAAAACTGGG + Intergenic
1032677029 7:134140492-134140514 AGATCAGAAAATTATAAACAAGG - Intronic
1032678249 7:134153303-134153325 GCATAACAAAATAAAAAAATTGG - Intronic
1032734203 7:134675263-134675285 ACACAAGAAAAAAATAAACTGGG - Intronic
1032805463 7:135349773-135349795 ACATTAGAAAAAAAAAGACTTGG - Intergenic
1033516670 7:142113521-142113543 ACATTATAAAAAAAAAACCTAGG - Intronic
1033812911 7:145037908-145037930 GTATTAGAAAATAAAAAATTTGG + Intergenic
1034483985 7:151345431-151345453 ACAGATGAAAATAAAAAAGTTGG + Exonic
1034684818 7:152960754-152960776 AAATTAAAAAATAAAAAAATTGG + Intergenic
1034783834 7:153906751-153906773 ACAACAAAAAGTTAAAAACTGGG - Intronic
1034867306 7:154652867-154652889 GCTTCAGAAAGTAAAAAACATGG + Intronic
1035896517 8:3408692-3408714 ACATGAATAAATAAATAACTTGG + Intronic
1036540237 8:9700607-9700629 ACAACAGAAAAAAAAAAAGAAGG - Intronic
1036584387 8:10109635-10109657 ACATCATAAGAAAAAAGACTGGG - Intronic
1036827431 8:11988068-11988090 AAATTAGTAAATAAAATACTGGG + Intergenic
1037087811 8:14874804-14874826 ACCTCAGAAAGTGAAAATCTTGG - Intronic
1037114520 8:15207490-15207512 AAATCAGGAAATAAAAGAGTCGG + Intronic
1037126048 8:15351072-15351094 ACAAAAGAAGATAAAAAATTAGG + Intergenic
1037337620 8:17807040-17807062 AAATAAGAAAATAAAAAAGAAGG - Intergenic
1037366517 8:18128314-18128336 TCATAAGAACAAAAAAAACTGGG + Intergenic
1037386506 8:18348035-18348057 ACAACACAAAATCAAAAAGTGGG + Intergenic
1037488035 8:19367428-19367450 ATAACCAAAAATAAAAAACTGGG + Intronic
1037793821 8:21974182-21974204 AAATAAAAAAATAAAAAAATCGG - Intronic
1037934350 8:22904667-22904689 GCATGCAAAAATAAAAAACTAGG - Intronic
1037968341 8:23151456-23151478 CCATGCGAAAATATAAAACTAGG + Intronic
1038156180 8:24992561-24992583 AAATTAAAAAAAAAAAAACTGGG + Intergenic
1038504263 8:28070992-28071014 AAATAAAAAAATAAAAAAATAGG + Intronic
1038758530 8:30364695-30364717 AAATAAAAAAATAAAAAATTAGG + Intergenic
1038838116 8:31151229-31151251 ACATTAGAAAATAGAAGACATGG + Intronic
1038873428 8:31520960-31520982 ACAACAGAAAACAAAAAAAAAGG - Intergenic
1038898586 8:31815816-31815838 AACTCAGAAAAAAAAATACTAGG - Intronic
1038917647 8:32042290-32042312 AAATAAAAAAATAAAAAGCTGGG + Intronic
1039209630 8:35198422-35198444 ACATAAGAAACAAAAAAATTAGG - Intergenic
1039347572 8:36724760-36724782 AGATCAGAAAATAGGAAAATGGG + Intergenic
1039691365 8:39868165-39868187 ACAAAATAAAATAAAAAACCTGG + Intergenic
1039726757 8:40226261-40226283 AATCCAGAAAAAAAAAAACTGGG - Intergenic
1039795615 8:40910937-40910959 ACACCAGAAATTAATAAATTTGG + Intergenic
1040066588 8:43149800-43149822 AAACCAGATAATAAAAATCTGGG + Intronic
1040841425 8:51789193-51789215 ACAGCAAAAAAAAAAAAAATGGG - Intronic
1041218412 8:55624696-55624718 GCAACAGAAAAAAAAAAATTGGG + Intergenic
1041360894 8:57053012-57053034 ATATCAAAGAATAAAAAAATAGG + Intergenic
1041379068 8:57233734-57233756 ACATCAGAAAAGCAAATATTTGG + Intergenic
1041476028 8:58267215-58267237 AATTAAGAAAATAAAAAACTTGG - Intergenic
1042005235 8:64172456-64172478 ACATTAAAAAAAAAAAACCTTGG + Intergenic
1042014554 8:64293683-64293705 ATATCAGAACACCAAAAACTGGG + Intergenic
1042179913 8:66077254-66077276 ACATCAGCAAACACAATACTGGG + Intronic
1042467409 8:69143564-69143586 ATAGCAGAAAATAGAAAACAAGG - Intergenic
1042507797 8:69579249-69579271 AAATCAGAAAAAATAAAAATTGG + Intronic
1043136491 8:76532994-76533016 ACATCAGAAATTGAAAAATAGGG - Intergenic
1043196819 8:77304168-77304190 AAATGAGAAAATAAAGAAATAGG - Intergenic
1043446718 8:80326395-80326417 TCATCAGAAAATAAAACATGGGG + Intergenic
1043623424 8:82226486-82226508 ACAACAAAATATAAAAGACTAGG + Intergenic
1044101072 8:88139608-88139630 ATATCAGAAAATAAAGAAGAGGG - Intronic
1044323738 8:90836272-90836294 AGATCAGAAAATATAATATTCGG - Intronic
1044496223 8:92887381-92887403 ACATCACAAATGAAAAATCTGGG - Intronic
1044855931 8:96475858-96475880 ATCTCTAAAAATAAAAAACTTGG - Intergenic
1045614282 8:103889635-103889657 ACAGCAGAGAAAAAAAAATTAGG - Intronic
1045747783 8:105443322-105443344 AAAACAAAAAAAAAAAAACTTGG + Intronic
1045756318 8:105547001-105547023 ATATCAGAAAATATAAAATTAGG + Intronic
1045845234 8:106627234-106627256 ACACCAGAAACTAAATAATTTGG - Intronic
1045848987 8:106671231-106671253 ACAGTAAAAACTAAAAAACTGGG + Intronic
1046284638 8:112079360-112079382 AACTCAGTAAATAAAATACTGGG - Intergenic
1046847095 8:118929966-118929988 AAACCAGAAAATAAAAAAAGGGG + Intronic
1046915846 8:119677528-119677550 ACAACAGAAAATAAGCAAGTGGG - Intergenic
1047264286 8:123291272-123291294 ATAGTAGAAAATAAAAATCTTGG - Intergenic
1047424059 8:124729442-124729464 ACATAACAAAAGAAAAGACTGGG + Intergenic
1047819504 8:128503069-128503091 ACAGCAGGAGAGAAAAAACTTGG + Intergenic
1047882358 8:129210214-129210236 TCCTCAGAAAATATAAAAATTGG + Intergenic
1047997067 8:130347260-130347282 ACATCAGCAAAGCTAAAACTAGG + Intronic
1048021467 8:130543284-130543306 AAATCAGAAACTAAGAAATTAGG - Intergenic
1048099647 8:131336484-131336506 AAATCAGTGAATAAAAAGCTGGG + Intergenic
1048113983 8:131499590-131499612 CCATCAGAAAAAAGAAAACAAGG + Intergenic
1048136937 8:131755616-131755638 ACATTAGAAAAGAAAACACCTGG + Intergenic
1048392131 8:133977208-133977230 AAATCAAACAATAAAAATCTTGG + Intergenic
1049522220 8:143098658-143098680 AAATCAGAAAAAAAAAAATTAGG + Intergenic
1050375933 9:4972980-4973002 ACAAAATAAAATAAAAAACTTGG + Intergenic
1050396755 9:5205979-5206001 ACATCAAAAAATAAAAATGTTGG + Intergenic
1050400718 9:5250740-5250762 ACATCAAAAAATAATAGAGTTGG + Intergenic
1050435443 9:5605170-5605192 ACATTAGGAAATAAAAAATATGG + Intergenic
1050496831 9:6251737-6251759 TCATCATTAAAAAAAAAACTTGG + Intronic
1051049357 9:12913425-12913447 GCATAAGGAAATAAAACACTTGG - Intergenic
1051351188 9:16199338-16199360 ACATTAGGAAAAAAAAAAATTGG - Intergenic
1051467452 9:17396512-17396534 ACAAAACAAAATAAAAAACTAGG - Intronic
1051795017 9:20857765-20857787 AACTCAAAAAAAAAAAAACTGGG - Intronic
1051992287 9:23165667-23165689 ACAACAAAAAATTAAAAAGTGGG + Intergenic
1052007732 9:23369611-23369633 ACATCAAAAAATTAAAATGTGGG + Intergenic
1052090293 9:24319473-24319495 ATATCAGACAATCATAAACTTGG + Intergenic
1052096914 9:24394383-24394405 ACATGTGGAAATAAAAACCTCGG + Intergenic
1052133062 9:24874140-24874162 ACAGCAAAGAATAAAATACTTGG - Intergenic
1052410805 9:28118623-28118645 TCTTCACAAAATAACAAACTAGG + Intronic
1052443063 9:28522879-28522901 AAATCAGAAAAAAAAAATATGGG + Intronic
1052492314 9:29185371-29185393 ACAACAAAATATAAAAAACTAGG + Intergenic
1052525362 9:29611240-29611262 AAATCAGAAATAAAAAAATTTGG + Intergenic
1052598236 9:30590283-30590305 GCATCTGAGAATAAGAAACTGGG - Intergenic
1054831188 9:69626899-69626921 ACAGAAAAAAAAAAAAAACTTGG + Intronic
1054842450 9:69758371-69758393 ACCTCAAAAAAAAAAAAAGTTGG - Intronic
1054964427 9:71006246-71006268 ACATCAGAAAATGGTAAAATAGG + Intronic
1055157542 9:73082314-73082336 TCAACAGAAAATAAAAGAATAGG - Intergenic
1055220566 9:73926013-73926035 ACATGACCAAAGAAAAAACTAGG - Intergenic
1055316461 9:75039119-75039141 ACATCTGGAAAGAATAAACTAGG + Intergenic
1055866665 9:80822235-80822257 AAATCAAATAATAACAAACTGGG + Intergenic
1055874068 9:80921807-80921829 ACATTAAAAAATTAAAAAGTAGG - Intergenic
1056087601 9:83167233-83167255 ACCTCAGAAAAAAAAAAATCTGG + Intergenic
1056293558 9:85168974-85168996 AAATCTGAAAATAAAAACCAGGG + Intergenic
1057117359 9:92538584-92538606 ACCTCAGAAATTATAAAATTTGG - Intronic
1057326947 9:94074403-94074425 ACATGAGAAAAAACAAATCTGGG + Intronic
1057577519 9:96255267-96255289 GCATCAGAATTTAAAATACTGGG + Intronic
1057888307 9:98848108-98848130 ACATAAGAAAATACAAGGCTGGG - Intronic
1057963903 9:99484617-99484639 GCATCAGAAGAAAAAAAAATTGG - Intergenic
1057998145 9:99839181-99839203 AGATCAGAAAAGAAAAAATTGGG + Intronic
1058275849 9:103039517-103039539 AAAACAGCAAATAAAATACTGGG + Intergenic
1058415360 9:104783155-104783177 ACATAAGAAAATAAAAATAGTGG + Exonic
1058531926 9:105914749-105914771 AAATCAGAAAAGAAAAAAGATGG - Intergenic
1058633157 9:107009814-107009836 ACAACAGAAAAGGAGAAACTTGG - Intronic
1059080135 9:111240338-111240360 ACAACACAAAAGAAAAAAATTGG - Intergenic
1059377755 9:113899133-113899155 ACTTTACAAAAAAAAAAACTAGG - Intronic
1059501598 9:114758638-114758660 AGATAAAAAAATCAAAAACTAGG - Intergenic
1059568883 9:115412951-115412973 ACATCAGAAAAACATGAACTGGG - Intergenic
1059616550 9:115957978-115958000 ACATACTAAAATAAAAAATTTGG + Intergenic
1059798344 9:117724448-117724470 ACATCAAAAAATAAGGAAGTTGG - Intergenic
1060118471 9:120965676-120965698 AGAACAGAATATAAAACACTTGG + Intronic
1060629310 9:125142382-125142404 ACATCAAAAAGTAAAAAAGTAGG + Intronic
1060790057 9:126479918-126479940 ACATAAGAGAAGAAAAAACCTGG - Intronic
1202798620 9_KI270719v1_random:151175-151197 ACAAAACAAAAAAAAAAACTAGG - Intergenic
1203428085 Un_GL000195v1:60108-60130 ACATCACAATTAAAAAAACTAGG + Intergenic
1203457494 Un_GL000220v1:4237-4259 ACAAAACAAAACAAAAAACTTGG - Intergenic
1185500071 X:590036-590058 ACATAATAAAATAAAATAGTAGG - Intergenic
1185500097 X:590310-590332 ACATAATAAAATAAAATAGTAGG - Intergenic
1185500117 X:590592-590614 ACATAATAAAATAAAATAGTAGG - Intergenic
1185720806 X:2379951-2379973 TCAACAGAAAAGAAAAACCTTGG - Intronic
1185726509 X:2426185-2426207 AACACAGAAAATAAAAGACTTGG + Intronic
1185972497 X:4681051-4681073 AAAGCATAAAATAAAACACTTGG - Intergenic
1186311518 X:8324426-8324448 AGATAAGAAAAAAAAACACTAGG + Intergenic
1186327604 X:8497084-8497106 ACATGTGAAAATAAGAAACCAGG + Intergenic
1186567778 X:10682671-10682693 ATATCAGAAAAGAAAAAGCATGG + Intronic
1186684376 X:11909840-11909862 TCAACAGAAAAAAAAACACTAGG - Intergenic
1186839874 X:13474759-13474781 AGAACAGAAAATAAAAAACTGGG - Intergenic
1186840112 X:13476988-13477010 ACATCAGAATTTTAAGAACTGGG - Intergenic
1187010242 X:15271039-15271061 ACCTCAAAAAAAAAAAAATTTGG + Intergenic
1187544046 X:20229970-20229992 ACTACAGAGAATAAAAAATTTGG + Intronic
1187563442 X:20424374-20424396 ATATCAGAAAATAAAACTCTAGG + Intergenic
1187806024 X:23121597-23121619 AAATAAAAAAATAAAAAACCTGG - Intergenic
1187952009 X:24480313-24480335 ACATGGGTAAATAAAAAATTGGG + Intronic
1187982304 X:24770569-24770591 ACAAAACAAAACAAAAAACTTGG - Intronic
1187985899 X:24810897-24810919 GCTTCTGAAAATAATAAACTTGG + Intronic
1188074638 X:25759885-25759907 CCAACAGAAAAACAAAAACTAGG + Intergenic
1188148189 X:26640202-26640224 AAATAATAAAATAAAAAACATGG - Intergenic
1188449803 X:30296856-30296878 ACATTAAAAAAAAAAAAACTTGG - Intergenic
1188725285 X:33575672-33575694 AAAACAGAAAAAAAAAAACAGGG - Intergenic
1188915729 X:35907988-35908010 ACAACAAAAAGTTAAAAACTAGG - Intergenic
1189141319 X:38609759-38609781 TCATTTGAAAATAAAAAACTTGG + Intronic
1189275396 X:39781595-39781617 AAATGAGTAAATAAAAGACTTGG - Intergenic
1189678157 X:43485725-43485747 ATATCAGAAAATAATATATTTGG + Intergenic
1189730812 X:44018722-44018744 ACATCAGAAATTACACAATTTGG + Intergenic
1191728581 X:64308583-64308605 AAATTGGAAAATAAAAAATTAGG - Intronic
1191770395 X:64750327-64750349 AACTCAGTAAATAAAATACTGGG - Intergenic
1191971561 X:66822714-66822736 CTATCAGAAAATATAAAACGTGG - Intergenic
1192093906 X:68189975-68189997 ACATAAGAAAAAAAAAAAGAGGG + Intronic
1192126835 X:68509090-68509112 ACAACAAAAAACAAAACACTGGG - Intronic
1192655837 X:72993362-72993384 ACATCAGAAAAGAAAACTATAGG + Intergenic
1192788984 X:74362031-74362053 ACATCAAAAAAAAAAAAAAAGGG + Intergenic
1193107316 X:77690935-77690957 AAATTAGAAAATGAAAAATTGGG + Intronic
1193175369 X:78386334-78386356 ACAACAGAAAGTTAAAAAGTGGG + Intergenic
1193289096 X:79750872-79750894 ACAACAACAAATAAAAACCTGGG - Intergenic
1193301006 X:79888057-79888079 AACTCAGTAAATAAAATACTAGG + Intergenic
1193324179 X:80160248-80160270 ACATAAAAAAAAAAAAAATTAGG + Intergenic
1193422692 X:81302666-81302688 ACATAAGTAAATAAATAAATCGG - Intergenic
1193478276 X:81994697-81994719 ACATGAGAAAATGAAATACTTGG + Intergenic
1193626071 X:83821389-83821411 AACTCAGTAAATAAAATACTGGG - Intergenic
1193636733 X:83959752-83959774 AAATAATAAAATAAAATACTTGG + Intergenic
1193746384 X:85287223-85287245 ACATAAGAAAAAACAAAAATAGG + Intronic
1193746620 X:85289698-85289720 ACATTAGAAGATAAACAATTTGG + Intronic
1194010194 X:88552603-88552625 ACATCAAAAAAGAAAAAAAAAGG - Intergenic
1194125891 X:90016012-90016034 ACAGCTGAAAGTAAAAAACTTGG - Intergenic
1194162885 X:90477035-90477057 AAAATAGAAAATAAAAAAATAGG + Intergenic
1194330351 X:92576722-92576744 ACAACAGAAAGTAAAAAAACAGG - Intronic
1195006712 X:100692351-100692373 ACATCAGTAAATAAGATACGTGG - Intronic
1195596167 X:106692712-106692734 ACAACCGAAAATAAAAAAATAGG - Intergenic
1195713651 X:107796892-107796914 ACTTCAAAAAAGAAAAAAGTAGG - Intergenic
1195814892 X:108873937-108873959 ATAACAGAATATGAAAAACTGGG - Intergenic
1195855607 X:109329072-109329094 ACATCACAACTAAAAAAACTAGG - Intergenic
1195865019 X:109423169-109423191 ACTACAGATAATAAATAACTTGG + Intronic
1196166202 X:112537876-112537898 GCTTCAATAAATAAAAAACTAGG + Intergenic
1196215430 X:113046051-113046073 AAATCAGAAGATACAAAACATGG - Intergenic
1196433837 X:115656820-115656842 AAAGCAGAAAATAATAAAATAGG + Intergenic
1196590665 X:117482844-117482866 ACATCAGCAAAACAAAAACTTGG - Intergenic
1196609776 X:117697948-117697970 ACAACAAAAAGTTAAAAACTAGG + Intergenic
1196976845 X:121167790-121167812 AAAACAAAAAAAAAAAAACTGGG - Intergenic
1197221386 X:123917052-123917074 ACATGAGAAAATACAACACTGGG - Intergenic
1197353819 X:125409690-125409712 ACAGCAAAAAGTAAAAAACCTGG - Intergenic
1197432114 X:126378774-126378796 ACAACAAAAAACAAAACACTAGG - Intergenic
1197615137 X:128682285-128682307 AAAACAGCAAATAACAAACTGGG + Intergenic
1198492777 X:137159395-137159417 ATATTAGTAAATAAACAACTGGG + Intergenic
1198510818 X:137349753-137349775 AAATAAAAAAATAAAAAACCTGG + Intergenic
1198600153 X:138275116-138275138 ATTTCAGAAAATAAAGAACAAGG + Intergenic
1198664607 X:139006668-139006690 ACATCAAAAAGTTAAAAAGTGGG + Intronic
1198720955 X:139619610-139619632 AAAACAAAAAATAAAAAAATTGG - Exonic
1198765888 X:140078986-140079008 TCATCAGAAAAAAAAAAAAAGGG + Intergenic
1198946482 X:142021037-142021059 AAAGCAGAAAAAAAGAAACTTGG + Intergenic
1198992640 X:142532996-142533018 AAATCAAACAATAAATAACTAGG - Intergenic
1199027601 X:142958357-142958379 AAAACAGAAACTTAAAAACTAGG - Intergenic
1199060369 X:143349292-143349314 ACATCTGAATAAAGAAAACTCGG + Intergenic
1199139033 X:144288242-144288264 ACATAAGAAAAGTATAAACTAGG - Intergenic
1199162168 X:144626508-144626530 ACATATGAAAATCAAAAAATTGG - Intergenic
1199246067 X:145605216-145605238 ACAACAGAAAGTCAAAAAATGGG + Intergenic
1199555297 X:149101691-149101713 AGATTAGAAAATAAAAATATAGG - Intergenic
1200113774 X:153759988-153760010 AAAACAGAAAATAAAAAACAAGG + Intergenic
1200360734 X:155603894-155603916 ACAAAAGAAAAAAAATAACTTGG + Intronic
1200379687 X:155821914-155821936 ACAACAAAAATTAAAAATCTGGG + Intergenic
1200509160 Y:4054766-4054788 AAAATAGAAAATAAAAAAATAGG + Intergenic
1200639056 Y:5695790-5695812 ACAACAGAAAGTAAAAAAACAGG - Intronic
1200919710 Y:8602420-8602442 TCAACAGAAAATAAAGAACACGG - Intergenic
1200947320 Y:8857607-8857629 ACCTCTAAAAATAAATAACTTGG + Intergenic
1201351475 Y:13047370-13047392 ACTTCATAAGATGAAAAACTGGG + Intergenic
1201434401 Y:13940992-13941014 ACATGTGAAAATAAGAAACCGGG - Intergenic
1201504844 Y:14686946-14686968 AATTCAGAAAATAAATAGCTGGG - Intronic
1201584285 Y:15543745-15543767 CCATCTGAAAATAAAAGAATTGG + Intergenic
1201714568 Y:17030157-17030179 CCATCAAAAAATAAAAATTTGGG + Intergenic
1201727261 Y:17167472-17167494 ACATGAGAAAAAAAAAATTTAGG + Intergenic
1201756469 Y:17492078-17492100 ACATAATAAAATAACACACTGGG - Intergenic
1201845083 Y:18413907-18413929 ACATAATAAAATAACACACTGGG + Intergenic
1201906616 Y:19092188-19092210 TCTACAAAAAATAAAAAACTGGG - Intergenic
1201963020 Y:19703080-19703102 ACTTTTCAAAATAAAAAACTGGG + Intergenic
1202030316 Y:20565233-20565255 AAAACAGAAAAAAAAAAACAGGG + Intergenic
1202196358 Y:22302010-22302032 ACATCAGAACATTAGACACTGGG + Intergenic