ID: 1140464800

View in Genome Browser
Species Human (GRCh38)
Location 16:75172730-75172752
Sequence CAGGGTAGAAAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140464793_1140464800 -4 Left 1140464793 16:75172711-75172733 CCGTCCTCCTGGGATAAAGCAGG No data
Right 1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG No data
1140464789_1140464800 7 Left 1140464789 16:75172700-75172722 CCCGGGTGATGCCGTCCTCCTGG No data
Right 1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG No data
1140464796_1140464800 -8 Left 1140464796 16:75172715-75172737 CCTCCTGGGATAAAGCAGGGTAG No data
Right 1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG No data
1140464788_1140464800 19 Left 1140464788 16:75172688-75172710 CCTAATCAGAAGCCCGGGTGATG No data
Right 1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG No data
1140464791_1140464800 6 Left 1140464791 16:75172701-75172723 CCGGGTGATGCCGTCCTCCTGGG No data
Right 1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140464800 Original CRISPR CAGGGTAGAAAGATGGAGGA TGG Intergenic
No off target data available for this crispr