ID: 1140466903

View in Genome Browser
Species Human (GRCh38)
Location 16:75189886-75189908
Sequence AACAGTTGCTCTCCCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140466903_1140466906 7 Left 1140466903 16:75189886-75189908 CCAGGTGAGGGAGAGCAACTGTT No data
Right 1140466906 16:75189916-75189938 AAGGCTAATCATACAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140466903 Original CRISPR AACAGTTGCTCTCCCTCACC TGG (reversed) Intergenic
No off target data available for this crispr