ID: 1140468958

View in Genome Browser
Species Human (GRCh38)
Location 16:75204307-75204329
Sequence GGCCTCCAGAGTCACCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 2, 2: 4, 3: 41, 4: 250}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140468956_1140468958 -5 Left 1140468956 16:75204289-75204311 CCTTCTGGCAGACCAGGGGGCCT 0: 1
1: 0
2: 3
3: 10
4: 145
Right 1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 4
3: 41
4: 250
1140468946_1140468958 17 Left 1140468946 16:75204267-75204289 CCCACCAGGGTCCAGGCTCCGTC 0: 1
1: 1
2: 1
3: 28
4: 148
Right 1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 4
3: 41
4: 250
1140468950_1140468958 6 Left 1140468950 16:75204278-75204300 CCAGGCTCCGTCCTTCTGGCAGA 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 4
3: 41
4: 250
1140468948_1140468958 13 Left 1140468948 16:75204271-75204293 CCAGGGTCCAGGCTCCGTCCTTC 0: 1
1: 0
2: 3
3: 25
4: 287
Right 1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 4
3: 41
4: 250
1140468943_1140468958 30 Left 1140468943 16:75204254-75204276 CCAGGACACAATGCCCACCAGGG 0: 2
1: 0
2: 1
3: 15
4: 197
Right 1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 4
3: 41
4: 250
1140468953_1140468958 -1 Left 1140468953 16:75204285-75204307 CCGTCCTTCTGGCAGACCAGGGG 0: 1
1: 1
2: 3
3: 19
4: 237
Right 1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 4
3: 41
4: 250
1140468947_1140468958 16 Left 1140468947 16:75204268-75204290 CCACCAGGGTCCAGGCTCCGTCC 0: 1
1: 2
2: 4
3: 33
4: 311
Right 1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG 0: 1
1: 2
2: 4
3: 41
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140468958 Original CRISPR GGCCTCCAGAGTCACCCTGC AGG Exonic
901203314 1:7479073-7479095 GGCCTCCAGCTGCACCCAGCTGG + Intronic
901468731 1:9440890-9440912 GGCCTCAAGAGTGTTCCTGCTGG - Intergenic
901653507 1:10756228-10756250 GGCCTCCAGAGCCTCCTTACAGG + Intronic
902287439 1:15415902-15415924 GGCCTCCAGGGGCTCCTTGCAGG - Intronic
902641155 1:17767188-17767210 GGCCTCCACAGTCCCACCGCAGG - Intronic
902864367 1:19268736-19268758 GGCTTCCAGTGTGACCCTGATGG - Intergenic
903053103 1:20616164-20616186 GGGCTTCAGAGTCAGCCTGATGG - Intronic
904035640 1:27557184-27557206 GGACCCGAGGGTCACCCTGCCGG + Intronic
904037364 1:27566019-27566041 GGGCTCCAGAGTCACCCCAAAGG - Intronic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
904498605 1:30901487-30901509 GGCCTGAAGAGTCATCATGCAGG + Intronic
905308149 1:37033128-37033150 GGCCGCCCAAGGCACCCTGCAGG - Intronic
905470014 1:38184870-38184892 GGCCTTCAGAGTCACCACTCAGG - Intergenic
907623956 1:56010476-56010498 GGCCTCCAGCCACCCCCTGCTGG + Intergenic
908356617 1:63329463-63329485 GGCCTCCGGGGTCACCCTGGAGG + Intergenic
908356618 1:63329465-63329487 GGCCTCCAGGGTGACCCCGGAGG - Intergenic
911048908 1:93652795-93652817 GGAGTCCAGTTTCACCCTGCTGG - Intronic
911337820 1:96602299-96602321 GGCCTGCAGTGTCTCCTTGCAGG - Intergenic
912512961 1:110200934-110200956 GGGCTCCCGAAGCACCCTGCCGG - Exonic
913251713 1:116917344-116917366 TGCCACCAGAGTCTCCCAGCTGG - Intronic
914904188 1:151730418-151730440 TGCCTTCAGAGTCACACTTCGGG + Intergenic
917254072 1:173095809-173095831 GGGTTCCAGAGTCATACTGCTGG + Intergenic
917333230 1:173903976-173903998 GGCCTTGAAAGTCACCCTGTTGG + Exonic
920322905 1:205138302-205138324 GACCTCCACAGCCACCCTTCTGG - Intergenic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
920447850 1:206033446-206033468 AGCTTCTAGAGTCTCCCTGCAGG + Intergenic
923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG + Intronic
924039510 1:239970864-239970886 GGCTCCCAGAGTCAGCATGCTGG + Intergenic
1062848449 10:725730-725752 GGGCTCCAGACACACCCTGCTGG - Intergenic
1065963428 10:30752530-30752552 GGCCTCCACAGTCCCCCTTCTGG - Intergenic
1066250654 10:33629743-33629765 GCGCTCCAGAGTCAGGCTGCAGG - Intergenic
1067044055 10:42974671-42974693 GGACTCCAAAGTCGCTCTGCTGG - Intergenic
1067794523 10:49311177-49311199 GACCTCCAGCGTCACCCAGTGGG + Intronic
1069915770 10:71785731-71785753 GCCCTCCAGTCTCACCCTCCTGG - Intronic
1070804549 10:79263488-79263510 GGTCTCCTGAGTCACTCTTCAGG + Intronic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1074866522 10:117547201-117547223 GGCCTCCAGCCCCACCCTGGTGG + Intronic
1075713828 10:124544576-124544598 GGCCAACAGTCTCACCCTGCAGG + Intronic
1076250847 10:128982760-128982782 GGCATCCAGAGCCACCCTCTGGG - Intergenic
1076543348 10:131228148-131228170 GGCCTCCGGAGTCTCCCCTCCGG + Intronic
1076925402 10:133481258-133481280 GGTCTTCAGAGAAACCCTGCAGG - Intergenic
1077359527 11:2134487-2134509 GGCTTCCAGAGTCAAGCAGCAGG + Intronic
1077474676 11:2780691-2780713 GGCCTAGAGTGTCCCCCTGCAGG + Intronic
1078108468 11:8373325-8373347 GGGCTACAAAGTCACACTGCTGG + Intergenic
1081609593 11:44552745-44552767 GGGCTCCAGAAACAGCCTGCAGG + Intergenic
1082003990 11:47409745-47409767 GGCAGCCAGAGACACCCAGCTGG + Intronic
1082725713 11:56733714-56733736 AGCCTCCTGAGTAACCCTCCTGG - Intergenic
1083638890 11:64134904-64134926 GGCCCTCAGAGTCTCCCTCCAGG + Intronic
1083818338 11:65150741-65150763 GTCAGCCAGAGTCACCCTGCTGG + Intergenic
1083829515 11:65222475-65222497 GGCTTCCAGAGTCATCCCGCTGG + Intergenic
1083986780 11:66220814-66220836 GGCCTCCAGACTCTCCTTCCTGG + Intronic
1084270654 11:68027494-68027516 GGATTCCAGAGTCAGACTGCCGG - Intronic
1084681588 11:70669530-70669552 GGCCTCCAGAGCCACCGGGCAGG + Intronic
1085694358 11:78691261-78691283 GTCCTCCAGGGTCACGCTGCTGG - Intronic
1086291068 11:85309810-85309832 GGGCACCAGACTCAGCCTGCAGG - Intronic
1087453245 11:98352236-98352258 GGCCTTCAGATGTACCCTGCAGG + Intergenic
1088729814 11:112670920-112670942 GGTCTCCAGCCACACCCTGCTGG + Intergenic
1088815139 11:113415522-113415544 GCCCTTCATTGTCACCCTGCTGG - Exonic
1089494429 11:118901186-118901208 GGCCTCCAGAGAATCCCTGCTGG + Exonic
1089599392 11:119604278-119604300 GGACTTCTGAGTCACCCTGATGG + Intergenic
1089771969 11:120809388-120809410 GGCCTGCAGAATCAGCATGCAGG + Intronic
1091679793 12:2519009-2519031 GGGCTCCAGATTCCCCATGCAGG + Intronic
1091714957 12:2770355-2770377 GGCCTGCAGAGCCACCTTCCTGG + Intergenic
1096122637 12:49098067-49098089 AGCGTCCAAAGTCACCCAGCAGG + Exonic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1096866793 12:54569259-54569281 GGCCTCCACCTTCACCCAGCAGG + Exonic
1097850238 12:64404358-64404380 GGCCTCCGGCGTCAGCCCGCGGG + Exonic
1102614903 12:114145109-114145131 GGCCTCAACTGTCACCCTGCAGG - Intergenic
1103496316 12:121365032-121365054 TGGCTCCTGAGTCACCCTGATGG - Intronic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1105858654 13:24391526-24391548 TGCCTCCCGAGGCTCCCTGCAGG + Intergenic
1111227229 13:85289634-85289656 GGCCTCCACAGTCATGCTTCTGG - Intergenic
1112381901 13:98899328-98899350 GGCCTACAGAGTCATACAGCTGG - Intronic
1112621602 13:101058975-101058997 GGCCTCCTGGAGCACCCTGCTGG + Intronic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1114690129 14:24573795-24573817 GGCCTCCGGAATCCCCCTGTAGG + Exonic
1116014144 14:39386293-39386315 GGCCTCCAAAGTGACTGTGCTGG + Intronic
1117767866 14:59101628-59101650 GCATTCCAGAGTCACCCAGCTGG + Intergenic
1118733564 14:68686213-68686235 GGCCTCCAAAGTCCACTTGCTGG + Intronic
1119668940 14:76504296-76504318 GGCCACCAGAGGCACCTGGCTGG + Intergenic
1121226210 14:92323543-92323565 GGCCGCCAGCGCCACCGTGCCGG + Intronic
1122230216 14:100303290-100303312 GGCCTCGAGGGGCCCCCTGCTGG - Intronic
1123891802 15:24788942-24788964 GTCTTGCAGACTCACCCTGCAGG - Intergenic
1124120154 15:26882259-26882281 AGCCTCCCGGGCCACCCTGCTGG + Intronic
1126376441 15:48001621-48001643 ACCCTCCAGGGTTACCCTGCAGG - Intergenic
1128723793 15:69973005-69973027 GGGTTCCACAGTCAGCCTGCTGG + Intergenic
1129724935 15:77896884-77896906 GGCCACCAATGTCTCCCTGCTGG + Intergenic
1130049069 15:80468233-80468255 GGCCTCAGGAATCTCCCTGCTGG + Intronic
1131195470 15:90351792-90351814 GGCCTCCGCAAACACCCTGCAGG + Intergenic
1131264448 15:90907258-90907280 GGCGTCCAGAGGCTGCCTGCTGG + Intronic
1132008076 15:98249076-98249098 GGGACCCACAGTCACCCTGCTGG - Intergenic
1132261529 15:100429316-100429338 AGCCTCCAGAGTTTCCCTCCTGG - Intronic
1132704564 16:1237513-1237535 GCCCTCCCGAGTCACCCTGAGGG + Intergenic
1132706949 16:1248912-1248934 GCCCTCCCGAGTCACCCTGAGGG - Intergenic
1132976313 16:2712799-2712821 GGCCGCCCGAGTCGCCCTGCGGG + Exonic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133130632 16:3674291-3674313 GGACAACAGAGTCACCCTGAGGG + Intronic
1133325114 16:4937327-4937349 GGCCTCCGGAGTCCCCCGGCTGG - Intronic
1135381013 16:21996251-21996273 GGTGACCCGAGTCACCCTGCAGG + Intronic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1138203545 16:55107635-55107657 AGCCTCCAGAGACTGCCTGCTGG - Intergenic
1140357936 16:74321751-74321773 GGCCTCCAGTGTTCCCCTCCTGG - Intergenic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140472813 16:75224698-75224720 GGCCGCCAGAGTCGCCCTGTGGG - Exonic
1140473629 16:75227983-75228005 GGCTGTCGGAGTCACCCTGCAGG - Intergenic
1141241324 16:82267615-82267637 TGCCTCCAGAGTTCCCCTGTGGG - Intergenic
1141581540 16:85002931-85002953 GGCCTGAACTGTCACCCTGCAGG + Intronic
1142068082 16:88074133-88074155 CGCCTGCAGAGTCACCATGAAGG - Intronic
1142217059 16:88834927-88834949 GGCCTCCGGGGTCACCCTTCGGG + Intronic
1145039620 17:19567622-19567644 GCCCTGCAGAGTCACCCTCAGGG - Intronic
1145862532 17:28222480-28222502 GGCCTACAGAAGGACCCTGCAGG - Intergenic
1146720292 17:35119270-35119292 GGCCTCCTGAGACGGCCTGCCGG - Intronic
1146787264 17:35731506-35731528 CCCCTCCAGACTCTCCCTGCGGG - Intronic
1147637862 17:41974868-41974890 GGCCTCCAGAGGCACCATGGAGG - Exonic
1148446254 17:47739369-47739391 GGCCTCCCGAGTCACCCGAGCGG - Intronic
1148865854 17:50628243-50628265 GGCGTCCAGAGGCAACCTCCTGG + Intergenic
1148901946 17:50884993-50885015 GGCCACCACACTCACCCAGCAGG + Intergenic
1149474734 17:56950438-56950460 GGCCTCCAAAGTGACTTTGCTGG + Exonic
1149772371 17:59331908-59331930 GGCCTCCGGACTCCCCCGGCCGG + Intronic
1150271240 17:63866764-63866786 AGCCTCCAGGATCTCCCTGCTGG - Intergenic
1150274778 17:63889632-63889654 AGCCTCCAGGATCTCCCTGCTGG - Intergenic
1150276915 17:63904415-63904437 AGCCTCCAGGCTCGCCCTGCTGG - Intergenic
1151242823 17:72771503-72771525 GCCCTCCAGGCTCACCTTGCAGG + Intronic
1151362340 17:73596220-73596242 TGCCTCCCCACTCACCCTGCGGG - Intronic
1151662646 17:75526678-75526700 GGGCTCCAGGGACCCCCTGCTGG + Intronic
1152351036 17:79784255-79784277 GGCCTTCAGCGCCAACCTGCTGG - Exonic
1157567434 18:48689088-48689110 GGCCTTCAGACACACCCTGGAGG + Intronic
1158342262 18:56479510-56479532 TTCCTCCAGAGAGACCCTGCAGG + Intergenic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160824704 19:1074257-1074279 TCCCTCCAGACCCACCCTGCTGG - Intronic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1161215834 19:3094644-3094666 GGACTCCAGAGTCATCGTCCCGG - Exonic
1162389445 19:10380495-10380517 CGCGTCCAGACTCACCCTTCCGG + Exonic
1164949052 19:32321057-32321079 GGGCTCTAGAGTCAGACTGCCGG - Intergenic
1166126445 19:40717742-40717764 AGCCTCCAGACTCACCCAGAAGG + Exonic
1167247320 19:48381468-48381490 GGCTTCCAGAGCCAGCCTCCAGG + Intergenic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
929717393 2:44326890-44326912 GGCCTCCAGTGGCACGCTGATGG - Exonic
929856280 2:45640877-45640899 GGCTTCCACAGTCACCCTGAAGG - Intergenic
933990402 2:87629801-87629823 GGCCTGCTGAGTCACACTGCAGG - Intergenic
935171613 2:100614734-100614756 GCCCTCCAGGGCCTCCCTGCTGG - Intergenic
936075608 2:109399803-109399825 TGGCTGCAGGGTCACCCTGCCGG - Intronic
936303444 2:111321023-111321045 GGCCTGCTGAGTCACACTGCAGG + Intergenic
938584416 2:132675216-132675238 GGCCTCAATGATCACCCTGCAGG - Intronic
938801442 2:134766969-134766991 AGCCTCCAGTGCCAGCCTGCAGG + Intergenic
942892430 2:181007621-181007643 GGTCTCCAGAGTTACCATCCTGG + Intronic
946477198 2:220018419-220018441 TGCCTCCAGACTCCCCCTGTGGG + Intergenic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947854590 2:233314503-233314525 GCCCTCAAGATCCACCCTGCGGG - Intronic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
948350972 2:237340632-237340654 GGCCCAGAGAGTCATCCTGCAGG - Exonic
948513702 2:238489595-238489617 GGCCACCACAGTGAGCCTGCCGG + Intergenic
948616463 2:239202452-239202474 CTTCTCCAGAGTCACCCCGCTGG - Intronic
948806572 2:240455767-240455789 GCTCTGCAGAGTCCCCCTGCAGG - Intronic
948838904 2:240639874-240639896 GGGCTCCGAAGTCACCCCGCCGG - Intergenic
1168813377 20:720680-720702 GGCCTGCAGAGTCACCCTCTAGG + Intergenic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1171988134 20:31675149-31675171 GCCCTCCAGAGTCACCCAAGAGG - Intronic
1172096544 20:32463326-32463348 GGCCTCAAGGGTGACCCTCCTGG - Intronic
1172306676 20:33885556-33885578 GGCCTCCAAGGAAACCCTGCGGG + Intergenic
1173663696 20:44751037-44751059 AGGCTCCAGGGTCACCCTGTAGG + Exonic
1173974028 20:47173744-47173766 TGCCTCCACAGTCACCTGGCGGG - Intronic
1175375159 20:58519034-58519056 TGCCTCCAGAGTGAGCATGCTGG + Intergenic
1175979878 20:62733240-62733262 TGCCTCCAGGGTGGCCCTGCGGG - Intronic
1179321098 21:40291754-40291776 GTCCTCCAGCGTCACCCCCCAGG + Intronic
1179411901 21:41168512-41168534 CGCGGCCAGAGTCCCCCTGCAGG - Exonic
1179450928 21:41467871-41467893 GCCCTCCACTGTCACCCTGTGGG + Exonic
1180066474 21:45415011-45415033 AGCCTCCAGAGGACCCCTGCGGG + Intronic
1180824236 22:18851914-18851936 GGCCACCAGGGTGACCCGGCTGG - Intronic
1180831197 22:18907020-18907042 TACCACCAGAGTCAGCCTGCCGG - Intronic
1181124664 22:20695068-20695090 GGCCACCAGGGTGACCCGGCTGG - Intergenic
1181188500 22:21122634-21122656 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1181210700 22:21287859-21287881 GGCCACCAGGGTGACCCGGCTGG - Intergenic
1181398810 22:22639029-22639051 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1181501541 22:23318385-23318407 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1181650612 22:24257030-24257052 GGCCACCAGGGTGACCCGGCTGG - Intergenic
1181706769 22:24653708-24653730 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1183046677 22:35226175-35226197 GGCTTCCAGAGACACTCAGCGGG - Intergenic
1183688885 22:39377117-39377139 AGCCTCAAGAGTCTCCTTGCAGG - Intronic
1184048730 22:41988756-41988778 GGCCTCCAGTTTGGCCCTGCAGG + Intronic
1184116715 22:42426665-42426687 GGCCTCCCCAGTCCCCCTGTAGG - Intronic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185317432 22:50185186-50185208 GGCCTCCAGGGGGACCCGGCTGG - Intergenic
1203216247 22_KI270731v1_random:7571-7593 GGCCACCAGGGTGACCCGGCTGG + Intergenic
1203274373 22_KI270734v1_random:77818-77840 GGCCACCAGGGTGACCCGGCTGG - Intergenic
1203281284 22_KI270734v1_random:132291-132313 TACCACCAGAGTCAGCCTGCCGG - Intergenic
950106294 3:10391222-10391244 GGACTGCCGAGTCACTCTGCAGG + Intronic
950414672 3:12862108-12862130 GGGCTCCAGCCTCAGCCTGCTGG + Intronic
951284291 3:20790514-20790536 TGCCTGCACAGTCACACTGCTGG - Intergenic
953368385 3:42366546-42366568 TGACTCCAGTGTCACCCTCCAGG + Intergenic
953890156 3:46745296-46745318 GGCCTCTGGGGTCTCCCTGCTGG - Intronic
953919444 3:46941814-46941836 GGCCTCCTGAGACACCTTTCAGG + Intronic
955409709 3:58647634-58647656 AGCCTTCACAGTCACGCTGCTGG + Intronic
957571162 3:81949199-81949221 GGCCTCCTGTGACACCATGCTGG + Intergenic
961230308 3:125301260-125301282 GGCCTCAAAAGTGATCCTGCTGG - Intronic
968750966 4:2388829-2388851 GGGCTGGAGAGTCACCCTGGTGG + Intronic
968883077 4:3311081-3311103 GGCCTCCAGGGTGACCCCACGGG - Intronic
970483374 4:16500224-16500246 GGCCTCCACAGTCAGCTTCCTGG - Intergenic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
974831291 4:67192827-67192849 GACCCCAAGAGTCACACTGCCGG + Intergenic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
978318530 4:107466986-107467008 GGCCCCCACAGTCACCTTGAGGG + Intergenic
979058139 4:116019797-116019819 GGTCTCCAGATTCCCCCTTCGGG + Intergenic
979642419 4:123024545-123024567 GGCCTCCAAAGTGACTTTGCTGG - Intronic
983533132 4:168832036-168832058 AGCCTCCTGAGTCACCCGGCGGG + Intronic
985553936 5:546995-547017 GGTCTCCAGGTGCACCCTGCAGG + Intergenic
985641782 5:1066803-1066825 TGCCTCCAGAGTCTCCCGGGAGG - Intronic
986210168 5:5664584-5664606 TGCCTTCAGAGTCTCTCTGCCGG - Intergenic
987539120 5:19230720-19230742 GTCCTGGAGAGCCACCCTGCAGG - Intergenic
989090980 5:37731055-37731077 AGTCTCCAGGGTTACCCTGCAGG - Intronic
990370205 5:55110014-55110036 GGCTTCCAGAATCTCCCTGGAGG - Exonic
991290380 5:65028265-65028287 GTGCTTCAGAATCACCCTGCAGG + Intergenic
996747074 5:126854669-126854691 GGCCTCCACTGCCACCCAGCCGG - Intergenic
997206700 5:132054424-132054446 TGACTCCAGTGTGACCCTGCAGG + Intergenic
997589929 5:135066327-135066349 GGGCTCCAGGGTCAGACTGCCGG + Intronic
997634162 5:135392318-135392340 CTCCTCCAGTGCCACCCTGCTGG + Intronic
997665953 5:135629615-135629637 CGCCCACAGAGTCAGCCTGCTGG - Intergenic
997978518 5:138454387-138454409 GTCCTCCTGAGTCATCCTCCCGG - Intergenic
999135998 5:149319635-149319657 GGGCTCCAGAGTCACTCCGGAGG + Exonic
1000239980 5:159400269-159400291 GGTTTCCAAAGTGACCCTGCCGG - Intergenic
1001556643 5:172641494-172641516 GCTCTCCAGAGTCACCCAGCGGG - Intronic
1001787445 5:174425893-174425915 AGCCTCCTGCCTCACCCTGCAGG - Intergenic
1002188960 5:177469066-177469088 GGCCTCCAGCAGTACCCTGCTGG - Intronic
1003899542 6:10641393-10641415 GCCCTTCAGTGTCACCCTGATGG + Intergenic
1004191749 6:13470282-13470304 GGCCTCCAGCCACAGCCTGCTGG - Intronic
1004263685 6:14130643-14130665 GGCCTCCTGAGTCAACCTTCTGG - Intronic
1005501838 6:26435604-26435626 AGCCTCCAGCTTCAGCCTGCAGG - Intergenic
1005813133 6:29531188-29531210 CTCCTCCTGTGTCACCCTGCGGG + Intergenic
1006373351 6:33658740-33658762 GGCATCCAGAGTCACCCGCATGG - Exonic
1006434792 6:34020464-34020486 TGCTGCCAGAGTCACCCTGGGGG + Intronic
1006831725 6:36972139-36972161 GCTCTCCAGAGTCACTCAGCTGG - Intronic
1007951400 6:45875760-45875782 GGACTCTAGAGCCACCCTGCTGG - Intergenic
1017313671 6:153003075-153003097 GGCCTCCAGAGCCGCAGTGCAGG + Intergenic
1018443511 6:163834562-163834584 GGGCTCCAGAGCCACGCGGCCGG - Intergenic
1018694646 6:166382440-166382462 GGCGCCCACTGTCACCCTGCCGG + Intronic
1019064801 6:169288032-169288054 TACCTCCAGAGTCTCCATGCGGG + Intergenic
1019144108 6:169965900-169965922 GCGCTCCAGAGGCACTCTGCAGG - Intergenic
1019442058 7:1052482-1052504 CACCTCCAAAGTCACACTGCTGG - Intronic
1019911425 7:4102637-4102659 GGCCACCAGAGCCTCCCAGCAGG + Intronic
1020232563 7:6331017-6331039 GGCCTGCAGATGCACCCTCCTGG - Exonic
1020414823 7:7934034-7934056 GGCCTCCACAGATACCCTCCTGG + Intronic
1021600090 7:22356567-22356589 GGCCCCCAGATTCAGGCTGCGGG - Intronic
1022144189 7:27521075-27521097 GGTCTCCAAAGCCATCCTGCTGG - Intergenic
1024930426 7:54662948-54662970 AGCCTTCAGAGCAACCCTGCCGG - Intergenic
1025265912 7:57456814-57456836 GACATCCAGAGTCCCCCTCCAGG - Intronic
1025992461 7:66506209-66506231 GGACTCCAGAGTCATCGTCCCGG + Intergenic
1026760715 7:73123870-73123892 TGCCTCAAGAGTCCCTCTGCTGG + Intergenic
1026982581 7:74535556-74535578 GGGCTCTGGAGTCACACTGCTGG - Intronic
1027037058 7:74932665-74932687 TGCCTCAAGAGTCCCTCTGCTGG + Intergenic
1027086506 7:75268782-75268804 TGCCTCAAGAGTCCCTCTGCTGG - Intergenic
1028514245 7:91658888-91658910 GGCCTCCAGAGTCTGCCCCCAGG + Intergenic
1029226770 7:99034181-99034203 GGCCTTCAGAGACCTCCTGCAGG + Intronic
1029260185 7:99296910-99296932 TGCCCTCAGACTCACCCTGCAGG - Intergenic
1031026551 7:116685987-116686009 GGCCACCAGGGTCCCCCTCCTGG + Intronic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1036707624 8:11056882-11056904 GGCCTCTAGTCTCACCCTTCAGG + Intronic
1037585369 8:20272293-20272315 GACCTCCAGAGTGACCTTACTGG + Intronic
1039922805 8:41905163-41905185 GGCCTGCAGACTCACCCTGGTGG - Intergenic
1042307202 8:67343943-67343965 GGCCTCCAGCGTTCGCCTGCAGG + Intergenic
1045378213 8:101597141-101597163 GCCCTCCAGATTCACTCTCCAGG - Intronic
1047526861 8:125641315-125641337 GGCCTCCTGCCTCAGCCTGCAGG - Intergenic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1048635345 8:136289450-136289472 GGCCCCCAGAGTTAGCCTGTCGG + Intergenic
1048906523 8:139094487-139094509 GGCCTCCACATTCAGCCTGCTGG - Intergenic
1049440722 8:142608394-142608416 GCCCTCAACAGTGACCCTGCTGG + Intergenic
1049493463 8:142917109-142917131 GGGCTCCAGGATCATCCTGCAGG + Exonic
1049967505 9:792621-792643 GGCCTCAAGAGACACAGTGCTGG + Intergenic
1052766982 9:32651113-32651135 GGCCTCCAGCCACCCCCTGCTGG + Intergenic
1053493237 9:38527215-38527237 GGCCTGCAGATGCACCCTCCTGG + Intergenic
1054870723 9:70045017-70045039 GGCCTGCAGAGGCACACAGCTGG - Intronic
1057673922 9:97121777-97121799 GGCCTGCAGATGCACCCTCCTGG + Intergenic
1060553466 9:124496552-124496574 GGGCTCCAGAGGGGCCCTGCTGG - Intronic
1061484709 9:130914447-130914469 CTCCTCCAGGGCCACCCTGCTGG - Intronic
1061584717 9:131558307-131558329 GGCCCCCAGATTCCCTCTGCAGG - Intergenic
1061587443 9:131578164-131578186 GGCCTCCAGCATGAGCCTGCAGG - Exonic
1061808085 9:133147613-133147635 GTCCCCCAGAGGGACCCTGCCGG + Intronic
1061851175 9:133416708-133416730 GGACTCCAGAGTCAGCCACCTGG + Intronic
1062177049 9:135169136-135169158 GGCATCCAGGGTCAACCTGCCGG - Intergenic
1186480002 X:9889523-9889545 GGCCTCCAGGGGAACACTGCTGG - Intronic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1190279771 X:48922086-48922108 GGCCCCCAGACAGACCCTGCTGG + Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1192524249 X:71828174-71828196 GGCCTGCCGAGTCACCATGGTGG - Intergenic
1195740918 X:108063730-108063752 AGCCTCTAGCGTCACCCTGGGGG + Intronic
1196610611 X:117710451-117710473 GGTTTCCAGAGTCATCCTGAGGG - Intergenic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic