ID: 1140474133

View in Genome Browser
Species Human (GRCh38)
Location 16:75230136-75230158
Sequence GCATGGGACTGCAGGGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140474122_1140474133 25 Left 1140474122 16:75230088-75230110 CCTGGGCACCCTGGGCTGGGCTT 0: 1
1: 0
2: 3
3: 46
4: 419
Right 1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG 0: 1
1: 0
2: 2
3: 23
4: 236
1140474124_1140474133 16 Left 1140474124 16:75230097-75230119 CCTGGGCTGGGCTTCTCTAAAAG 0: 1
1: 0
2: 0
3: 36
4: 166
Right 1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG 0: 1
1: 0
2: 2
3: 23
4: 236
1140474129_1140474133 -9 Left 1140474129 16:75230122-75230144 CCGCTACTCAGAGTGCATGGGAC 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG 0: 1
1: 0
2: 2
3: 23
4: 236
1140474123_1140474133 17 Left 1140474123 16:75230096-75230118 CCCTGGGCTGGGCTTCTCTAAAA 0: 1
1: 0
2: 1
3: 24
4: 169
Right 1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG 0: 1
1: 0
2: 2
3: 23
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140474133 Original CRISPR GCATGGGACTGCAGGGAAAC GGG Intronic
900619785 1:3581429-3581451 CCAGGGGGCTGCAGGGAAGCCGG + Intronic
901409883 1:9075392-9075414 GGAGCGGACTGCAAGGAAACAGG - Intronic
902230675 1:15025500-15025522 CCATGGCACGGGAGGGAAACAGG - Intronic
902472103 1:16656477-16656499 GCATGGGGGTGCAGGGAGGCCGG - Intergenic
902486700 1:16750969-16750991 GCATGGGGGTGCAGGGAGGCCGG + Intronic
903584927 1:24407071-24407093 GCCAGGGATTGCAGGGAAAAAGG - Intronic
905734502 1:40316367-40316389 GCATTGAATTGCAGGCAAACGGG - Intronic
907113804 1:51950896-51950918 CCATGGGAATGGAAGGAAACTGG + Intronic
907482505 1:54754709-54754731 GCAGGGGACTGTGGGGAAGCCGG - Intergenic
910053722 1:83007028-83007050 GCATGCGAGGGCAGGGACACGGG - Intergenic
911507203 1:98767842-98767864 CCAGGGAACTGCAGAGAAACAGG - Intergenic
912821434 1:112871032-112871054 GGATGGGGCAGCAGGGAAAGTGG - Intergenic
913970064 1:143408161-143408183 ACATGAGACTGCTTGGAAACTGG - Intergenic
913972094 1:143423399-143423421 GCACGGGACTACAAGGAAAGGGG - Intergenic
914064438 1:144233758-144233780 ACATGAGACTGCTTGGAAACTGG - Intergenic
914066475 1:144249012-144249034 GCACGGGACTACAAGGAAAGGGG - Intergenic
914112678 1:144717342-144717364 GCACGGGACTACAAGGAAAGGGG + Intergenic
914114712 1:144732596-144732618 ACATGAGACTGCTTGGAAACTGG + Intergenic
914389694 1:147208818-147208840 GGATGGGAGTGCAGGGATAGTGG - Intronic
918029854 1:180796193-180796215 ACATGGGACTGCACAGAACCTGG - Intronic
918521557 1:185420542-185420564 GAAAAGGACTGCAGGGAAGCCGG + Intergenic
920102997 1:203529576-203529598 GCATGGGGGCGCAGGGAAACAGG - Intergenic
920179963 1:204126462-204126484 GCATGTGACCCCAGGGAGACAGG - Exonic
923063584 1:230498435-230498457 GCATGGGACTTGAGGGACATTGG - Intergenic
923749395 1:236733672-236733694 GCATGGGAATACAGGAATACAGG - Intronic
924685795 1:246288420-246288442 GCATGGGGCTGTAGGGGACCAGG - Intronic
1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG + Intronic
1069744352 10:70705591-70705613 GCGTTGGACGGCAGGGAAACAGG - Intronic
1069784037 10:70976760-70976782 GAAGGGGACTGCAGGGCAAGGGG + Intergenic
1070357087 10:75650796-75650818 TCATGGGACTGCAGGAAGAAGGG - Intronic
1070481730 10:76889622-76889644 TCAAGGGACAGCAGGGAAACGGG + Intronic
1070609368 10:77922964-77922986 GCCTGGAACTGGAAGGAAACTGG - Intronic
1070742185 10:78910458-78910480 GCATTGGAGGGCAGTGAAACAGG + Intergenic
1071515196 10:86292391-86292413 GCATGTGGCTGCAGGGCAAAAGG - Intronic
1072000335 10:91189046-91189068 GCATGTGGCTGCAGGAATACAGG + Intronic
1075256636 10:120930675-120930697 GCAGGGCACTGCCAGGAAACTGG - Intergenic
1076599557 10:131648004-131648026 GGATGGGCCTGAAGGGAAATGGG - Intergenic
1077199743 11:1300010-1300032 GAATGGAACTCGAGGGAAACAGG + Intronic
1077307760 11:1875634-1875656 GCGTGGGACTACAAGGAAAGGGG + Intronic
1080691648 11:34563726-34563748 GCAGGAGACTCCAGGGAAAGAGG - Intergenic
1080756122 11:35200932-35200954 GCATGGAAATGGAGGGAAAGCGG - Intronic
1081765016 11:45604400-45604422 GCGTGGGACAGCAAGGAAAGGGG + Intergenic
1082036329 11:47648074-47648096 GCAGGAGAATGCTGGGAAACTGG + Intergenic
1082758662 11:57104370-57104392 GCATGGGACTGCCTGGAGACTGG + Intergenic
1085454860 11:76660087-76660109 TCCTGGCACTGCAGGGCAACGGG - Exonic
1085464168 11:76713014-76713036 GCCTGGCACTGCAGGGAAGTGGG - Intergenic
1088546966 11:110968900-110968922 GTAAGGGACTGCAGGGACCCAGG - Intergenic
1089113978 11:116079150-116079172 GGATGGGACTGTAAGGAGACAGG - Intergenic
1089157901 11:116416079-116416101 GAGTGGGACTGCAGGGACCCAGG - Intergenic
1090398992 11:126436374-126436396 GCATGGGTGTGCTGGGAACCTGG - Intronic
1091174761 11:133547961-133547983 GCATGGGTGTGCAGGGATGCAGG - Intergenic
1091335490 11:134762794-134762816 GCCTGGGGCTGCAGGGAGAAAGG + Intergenic
1091595580 12:1876686-1876708 GCATGGGAAAGGAGGGAAAGAGG - Intronic
1095969913 12:47894550-47894572 GCAGGGGAGTGAAGGGAAGCAGG - Intronic
1096741286 12:53695762-53695784 GGCTGGGGCTGCAGGGAGACAGG + Intergenic
1097072599 12:56366063-56366085 GGATGGGAGTCCAGGGAAACTGG + Intergenic
1097787741 12:63779850-63779872 GCTGGGGACTGCCTGGAAACGGG + Exonic
1098695593 12:73550243-73550265 TACTGGGGCTGCAGGGAAACTGG + Intergenic
1101738774 12:107483522-107483544 GGAGGGGACTGAAGGGAAAAAGG - Intronic
1101861802 12:108488522-108488544 TGATGGGGCTGCAGGGAAAAGGG + Intergenic
1102099213 12:110264872-110264894 GTCTGGCACTGCAGGGATACTGG - Intergenic
1103468044 12:121157567-121157589 GGATGGGACAAAAGGGAAACAGG - Intronic
1104094289 12:125542502-125542524 GCCTGGGACTGAAAGGAAAGAGG - Intronic
1104530022 12:129560996-129561018 GCAACAGACTGCAGGGAGACAGG + Intronic
1104707232 12:130956255-130956277 GCATGGGGCTGCCGGGCAGCCGG - Intronic
1104966623 12:132511298-132511320 GCAGGGGACTGTGGGGAAGCCGG - Intronic
1105492507 13:20902555-20902577 GCAAGGGCCTGCAGGGAGCCTGG - Intronic
1106240796 13:27911563-27911585 CCTTTGGACTGCAGGGAATCAGG - Intergenic
1107299066 13:38946639-38946661 GGAAGGGACTGGAGGGAAGCAGG - Intergenic
1109975396 13:69825609-69825631 GGATGGGACTGGAGAGAGACTGG + Intronic
1110001288 13:70204834-70204856 GGATGGGACTACAGGGAAGAAGG - Intergenic
1112175191 13:97015695-97015717 GCCTGGATATGCAGGGAAACTGG + Intergenic
1113553662 13:111213890-111213912 GCATGGGACTGGCTGGAAAAGGG - Intronic
1113962638 13:114133612-114133634 GCCGGGGTCTGCAGGGGAACTGG - Intergenic
1114282696 14:21208415-21208437 GCATGGCAGTGCAGGTAAAGGGG - Intergenic
1115001408 14:28424847-28424869 GCATGGAAATGCAAGGAATCAGG - Intergenic
1116301190 14:43185518-43185540 GATTGGGACTGCAGTGAATCTGG - Intergenic
1121957566 14:98228039-98228061 GCATGGAACTGCTGGAAAAAGGG - Intergenic
1121962583 14:98275059-98275081 GCATGGGTCTGCAGGGAAAGGGG - Intergenic
1122036370 14:98951957-98951979 ACATGGGGCTGAAGGCAAACTGG + Intergenic
1122994708 14:105256788-105256810 ACAAGGGACTGCAAGGAACCTGG + Intronic
1126160953 15:45613016-45613038 GGGTGGGACTGCAGGGAATGGGG - Intronic
1126668934 15:51098471-51098493 CCATGGGACTGTAGGTAAGCTGG + Intronic
1126791976 15:52229928-52229950 CCAGGGGACTGCATGGAACCCGG - Intronic
1127854236 15:62941567-62941589 GCAGGGGAGTGAAGGGAAGCAGG - Intergenic
1129365066 15:75049086-75049108 GCAGGGGTCTGCAGGGCTACAGG + Intronic
1132573124 16:652671-652693 GCAGCGGACTGCAGGGGGACGGG - Intronic
1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG + Intergenic
1132801723 16:1757944-1757966 GCAGAGGCCTGCAGGGAACCAGG - Intronic
1134314501 16:13106022-13106044 GCATAGGGCTGCAGGGACAAAGG - Intronic
1134907335 16:17991499-17991521 GCAGGGTACTGCAGGGAAAAGGG + Intergenic
1135060394 16:19266644-19266666 GCATGGGATGGCAGGAAACCAGG + Intronic
1135103605 16:19627892-19627914 GCATGGGCCAGCAGGAACACAGG + Intronic
1135568205 16:23528338-23528360 CAATGGCACTGCAGGGAAGCAGG + Intronic
1135736432 16:24935194-24935216 GCTTGGGACACCAGGAAAACTGG + Intronic
1138506379 16:57480294-57480316 GCCTGGGGCTGGAGAGAAACAGG - Intronic
1139259433 16:65577674-65577696 GCATCAGACTGAAGGGACACTGG + Intergenic
1139432969 16:66920944-66920966 GCATGGGTGGGCAGGGAGACAGG + Intergenic
1139563530 16:67758568-67758590 GCAGGGGACTGAATGGGAACTGG + Intronic
1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG + Intronic
1140698178 16:77555914-77555936 TCATGGGACTGCAGGATTACGGG - Intergenic
1141826212 16:86482177-86482199 GCCTGGGCCTGCAGGGAAGAGGG + Intergenic
1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG + Intronic
1142525512 17:537503-537525 GCAGGGGACTGCAGCAGAACGGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1148736431 17:49867828-49867850 GCCTGGGACTGCAGGGAGGGGGG - Intergenic
1153512856 18:5874262-5874284 GCATGGGAGGGCAGGGAAACAGG - Intergenic
1153762535 18:8346094-8346116 GCATGGGAGTGCAGGTGAGCTGG + Intronic
1154053659 18:10989510-10989532 GGATTTGACTGCACGGAAACTGG + Intronic
1156997282 18:43482958-43482980 TTATGGGTCTGTAGGGAAACAGG + Intergenic
1157333551 18:46720948-46720970 GCAAGGGACTTCAGAGAAGCAGG + Intronic
1158547031 18:58405392-58405414 CCCTGGCACTGCATGGAAACAGG - Intergenic
1158878076 18:61752014-61752036 ACAGGGGACAGCAGGGAAAGAGG - Intergenic
1160010748 18:75105717-75105739 TCAGGGGCCTGCAGGGGAACTGG - Intergenic
1160046038 18:75388190-75388212 GTATGTGACTGCAGGGAATGGGG + Intergenic
1160406768 18:78651740-78651762 GGATGGGACTGCAGGGCCAGAGG + Intergenic
1160876400 19:1298366-1298388 GCAGGAGACTGCTGGGAAACAGG + Intronic
1162301276 19:9846562-9846584 GCTTGGGACTGCAGTGGAAATGG - Intronic
1162739624 19:12766492-12766514 GGATGGGACTGCTGGAAAGCGGG + Intronic
1162760971 19:12887850-12887872 GCATGGGACTGCATGGAGGCTGG + Intergenic
1164412191 19:28015194-28015216 GCATGGGCCTGCAGGAAACATGG - Intergenic
1165072149 19:33261694-33261716 GGAGGGGAGTGGAGGGAAACCGG + Intergenic
1165184315 19:34003841-34003863 GAGTAGGACTGCAGAGAAACAGG - Intergenic
1166366785 19:42281856-42281878 GCATGGCACAGGAGGGAAAGAGG - Intronic
1167150686 19:47707594-47707616 CCAGGGGCCTGCAGAGAAACAGG - Intergenic
1167360015 19:49025010-49025032 GCATGGGGGAGGAGGGAAACTGG - Intronic
1167361068 19:49030761-49030783 GCATGGGGGAGGAGGGAAACTGG + Intronic
1167591914 19:50408878-50408900 GCCCGGGACTGCACAGAAACTGG + Exonic
1202704500 1_KI270713v1_random:13271-13293 GCATGGGGGTGCAGGGAGGCCGG - Intergenic
925578795 2:5388646-5388668 CCATGGGACAACAGGGAAAAGGG + Intergenic
925709979 2:6729486-6729508 GAATGGGAATGCAAGGAAATGGG + Intergenic
926206096 2:10835272-10835294 GCTGGGGACTCCAGGGACACAGG + Intronic
926699031 2:15790432-15790454 CCCTGGGACTGCAGTGAAGCAGG + Intergenic
926831467 2:16966977-16966999 GCATGGGACTTCAGTGAAGAAGG + Intergenic
927240983 2:20919341-20919363 GCAGGGGGCTGCAGGGAAAAAGG - Intergenic
927308323 2:21599398-21599420 GCAGAGGTCAGCAGGGAAACAGG - Intergenic
929001456 2:37351113-37351135 CCATGGGACTGGTGTGAAACTGG - Intronic
929031641 2:37654687-37654709 ACATGGGACTACAAGGAAATTGG - Intronic
929566009 2:42985433-42985455 TCATGGGAGTGCAGTGAAAATGG + Intergenic
931118964 2:59195599-59195621 GAATGGGACTTCAGGAAAAGGGG + Intergenic
934174753 2:89569066-89569088 ACATGAGACTGCTTGGAAACTGG - Intergenic
934285070 2:91643418-91643440 ACATGAGACTGCTTGGAAACTGG - Intergenic
934492054 2:94768106-94768128 GCATGAGACTGCGGGGGATCAGG - Intergenic
937274541 2:120675402-120675424 GCAGGGGAGTGGAGGGAAAGGGG + Intergenic
938202037 2:129380144-129380166 GAATGTGACTACAGGGCAACAGG - Intergenic
938382738 2:130845810-130845832 GGATGGGCCTCCAGGGAACCAGG + Intronic
940017430 2:149121825-149121847 GCATGAGACTGGAGGGAGAGAGG - Intronic
940110108 2:150143453-150143475 ACATGGGACAGCTGGGAAACAGG + Intergenic
942865994 2:180675631-180675653 GCATGAACCTGCAGGGTAACAGG - Intergenic
942912880 2:181266721-181266743 GAATGGAACTGCAGTGAATCTGG + Intergenic
943815429 2:192248544-192248566 GCTTGGAACTGAAGGGAAAGTGG - Intergenic
944905521 2:204257928-204257950 GCATGGGACTGGAGTAAAAATGG - Intergenic
946200469 2:218068235-218068257 GCAGGGGACTGGAGGGAGGCAGG + Intronic
946429084 2:219615079-219615101 GGAAGGGCCTGCAGGGAAAGAGG - Exonic
947747871 2:232518561-232518583 GAATGAGACTGCAGGGATAGAGG + Intergenic
948618148 2:239214841-239214863 GCATGGGACTGGAGAGAAATAGG + Intronic
1171088889 20:22265768-22265790 GTCTGGCACTGCAGGGAAGCTGG + Intergenic
1171327428 20:24307659-24307681 GTGTAGGACTGCAGGGAAAGAGG - Intergenic
1174239065 20:49118193-49118215 GCATGGCAGCGCAGGGAATCAGG + Intronic
1175523519 20:59618219-59618241 GGATGGGGCTGCAGGGGAGCTGG + Intronic
1175826151 20:61937671-61937693 GCAGGGGCCTGGAGGGGAACAGG + Exonic
1178499799 21:33116265-33116287 GCATGCAAATGCAGGGACACTGG - Intergenic
1178878279 21:36429236-36429258 GAAGGGGAGTTCAGGGAAACTGG - Intergenic
1179089200 21:38248375-38248397 GCAAGGCACTTCAGGAAAACTGG + Intronic
1179982101 21:44900961-44900983 CGCTGGGACTGCAGGGAAGCAGG + Intronic
1180038283 21:45262156-45262178 GCATTGCACTGGAGTGAAACAGG + Intergenic
1181058661 22:20271622-20271644 GGATGGGGCAGCAAGGAAACTGG + Intronic
1181393782 22:22603661-22603683 GCATGTGTCTGCAGTGACACTGG - Intergenic
1184467197 22:44675846-44675868 GCACAGGACTGCAGAGAATCTGG - Intronic
1184881003 22:47304198-47304220 GCGTGGGCCTGCAGGGAGGCTGG - Intergenic
1184925470 22:47633369-47633391 GAGTGGGTCTGCAGAGAAACCGG + Intergenic
1185347736 22:50317755-50317777 GCCTGGGACTGCAGGGCCAGTGG + Intronic
949508006 3:4744832-4744854 AAATGGGAATTCAGGGAAACAGG + Intronic
951582410 3:24180022-24180044 GAATGGGTTTCCAGGGAAACAGG - Intronic
951844207 3:27068124-27068146 TCATGGGACAGCAGTGAAACAGG - Intergenic
954608481 3:51931759-51931781 GCATGGGTCTGCAGGCCAACGGG - Intergenic
954652231 3:52172157-52172179 CCATGGGACTCCATGGAAAGGGG - Intergenic
954864850 3:53719506-53719528 GCCAGGGCCTGCAGGGAATCTGG + Intronic
955154948 3:56407823-56407845 TGATGGGAGTACAGGGAAACAGG - Intronic
960088345 3:113614222-113614244 GCAGGAGACTGCAGGGACAAAGG - Intronic
961168322 3:124778883-124778905 GCAGAGGAGTTCAGGGAAACAGG + Intronic
961451337 3:127003643-127003665 GGCTGGGTCTGCAGGGGAACCGG + Intronic
961814064 3:129539272-129539294 GCATCAGACTGCAGGGACAACGG - Intergenic
970112410 4:12653110-12653132 GCATGGTCCTGCAGGTAAAAAGG - Intergenic
970146700 4:13043710-13043732 GCAGGGGAGGGAAGGGAAACAGG - Intergenic
970793524 4:19887944-19887966 GCATGGGAGAACAGGGAAAAAGG - Intergenic
972374238 4:38456033-38456055 GGATGGGACTGCAGGGTTACAGG + Intergenic
974251955 4:59395985-59396007 AAATAGGACTGCAGGGAAAAAGG - Intergenic
975593531 4:76024333-76024355 GCTTGAGACAGAAGGGAAACAGG + Intronic
975930982 4:79522158-79522180 TCATGTGACTCCAGTGAAACTGG - Intergenic
976766619 4:88604453-88604475 GCCTAGGACTGGAGGGAAAGAGG - Intronic
977376526 4:96212117-96212139 TTATCTGACTGCAGGGAAACTGG - Intergenic
985140428 4:186833771-186833793 GCAGGTGACTGGAGGGAAAGTGG + Intergenic
986424273 5:7614716-7614738 CCAGGGGACTGCAGGGCAAGAGG + Intronic
986554452 5:8997490-8997512 ACAGTGGACTGCAGGGAAATGGG + Intergenic
986660934 5:10059484-10059506 GCTTGAGACTGCAAGGTAACTGG - Intergenic
989297375 5:39845609-39845631 GCATGGTACTGCATAAAAACAGG - Intergenic
989800835 5:45536927-45536949 GCATGCAATTGCAGGGAAACAGG - Intronic
991631004 5:68656333-68656355 GGATGGGTCTCCAGGGAAAGGGG - Intergenic
993968705 5:94389870-94389892 GCATGGCACTGCAAGGTAAGAGG - Intronic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
997870399 5:137500960-137500982 GCATGGGAGTGCAGAGATGCAGG - Intronic
998341964 5:141426275-141426297 GCATGGGAAGGATGGGAAACAGG + Intronic
998428436 5:142049507-142049529 TCATGGCACTGAAAGGAAACTGG + Intergenic
998891267 5:146748480-146748502 GATGGGGACTGGAGGGAAACTGG - Intronic
999079736 5:148831737-148831759 GCATGTGACTGCAGGGTTTCTGG + Intergenic
1000026116 5:157360585-157360607 TCATGGGACTGCTGGGAAGTTGG + Intronic
1000897510 5:166873553-166873575 GCATATGGCTGCAGGAAAACCGG - Intergenic
1001922901 5:175614399-175614421 GCATTGCTCTGCCGGGAAACTGG + Intergenic
1002141324 5:177141678-177141700 GAATGAGACTGCAGAGAAAGAGG - Intronic
1002451448 5:179321352-179321374 GCAAGGGAGTGGAGGGAAGCTGG - Intronic
1002698477 5:181105813-181105835 GCATGGGACTGGAGGGAGAGAGG - Intergenic
1002708423 5:181179103-181179125 GCATGGGACTGGAGGGAGAGAGG + Intergenic
1002815803 6:678691-678713 GCATGGGGCTCCAGGGCAACAGG + Intronic
1004429659 6:15532126-15532148 GAATGGGAGGGCAGGAAAACAGG + Intronic
1007176533 6:39901490-39901512 GCCTGGGACTGAGGGGAGACGGG + Intronic
1008312189 6:49989985-49990007 GCCTGGGACTTCAGGGCAATGGG - Intergenic
1009477706 6:64114924-64114946 GTATGGGGCTGCAGGGGAGCTGG - Intronic
1011545540 6:88478367-88478389 ACAGGGGACTTCAGGGAAAATGG + Intergenic
1011743813 6:90389397-90389419 GCTGGGGCCTTCAGGGAAACTGG + Intergenic
1012442034 6:99269996-99270018 GAATGGGTTTGCAGGGAAAATGG - Intergenic
1013291136 6:108719681-108719703 GCCTGGGAGTGCAGGGAGAACGG + Intergenic
1013585200 6:111572229-111572251 TCAAGGGACTGCAGGGGGACAGG + Intronic
1013656456 6:112251725-112251747 CCATGGGACCGCAGGCTAACTGG + Intronic
1016427303 6:143948343-143948365 GCTTGAGACTGCATGTAAACTGG - Exonic
1016969526 6:149749590-149749612 CCAGGGGACTGCAGGGAGGCCGG - Exonic
1019144306 6:169967028-169967050 TCATGGGGCTGCTTGGAAACGGG - Intergenic
1019866902 7:3720587-3720609 GCGTGAGAATGCAGAGAAACTGG + Intronic
1019972377 7:4551404-4551426 GCATTGGACTGCAGGCAGAGAGG + Intergenic
1019996942 7:4730652-4730674 GCATGGCAGTGAAGGGACACAGG - Intronic
1023584493 7:41715213-41715235 GCAAGGGACTGCAGAGAAGCAGG - Intergenic
1023861909 7:44221659-44221681 GCATGGGGGTGCGGGGCAACAGG - Intronic
1028582959 7:92425561-92425583 GAGTTGGAATGCAGGGAAACTGG + Intergenic
1029124488 7:98287171-98287193 GGGCGGCACTGCAGGGAAACAGG + Intronic
1029462054 7:100700709-100700731 GGATGAGAATGCAGGGAAACTGG - Intergenic
1029498747 7:100914342-100914364 GCATGGGATTTCAGGTCAACTGG + Intergenic
1030409721 7:109160788-109160810 GCAGGGCACTGCAGGGGCACAGG - Intergenic
1033645602 7:143300725-143300747 GCATGGAAGTGTAGGTAAACAGG - Intronic
1033727849 7:144139561-144139583 ACATGGGACCGCATGGAACCTGG + Intergenic
1034440870 7:151085621-151085643 CAATGGGACTGCAGAGGAACTGG + Intergenic
1036668497 8:10764143-10764165 GAAAGGGGGTGCAGGGAAACTGG + Intronic
1037805361 8:22055585-22055607 CCATGGAACTGCAGAGAAAAAGG - Intronic
1037862421 8:22415232-22415254 GTATGAGGCTGCAGAGAAACAGG + Intronic
1037881119 8:22573963-22573985 GCAGGGGTGTGCAGGGAAAAGGG + Intronic
1039988988 8:42472035-42472057 GCAAAGTACTGCAGGGAAGCGGG + Intronic
1040492975 8:47941984-47942006 GCGTGGGCCTGCAGGGAAGCCGG - Intronic
1040681583 8:49817177-49817199 GCATGGGCCTTCCAGGAAACTGG - Intergenic
1044843358 8:96356761-96356783 GCATGGGTTTACAGGGAAAAGGG + Intergenic
1045867901 8:106890178-106890200 GCATGGTACCTCATGGAAACTGG - Intergenic
1046124069 8:109882353-109882375 TCATGGGAGTGCAGTGAAGCAGG - Intergenic
1049335349 8:142081616-142081638 GCAAGTGGCTGCAGGGAAACAGG + Intergenic
1049366169 8:142237949-142237971 GCGTGGGCCAGCAGGGAAACGGG - Intronic
1057921054 9:99097160-99097182 GGATGTGTCTCCAGGGAAACAGG + Intergenic
1057967170 9:99515539-99515561 GCCTGGGGCTGCAAGGAAAAAGG - Intergenic
1060061870 9:120467896-120467918 GCATGGGTTTCCAGGGAAATGGG - Exonic
1060375100 9:123110275-123110297 GCATGGGGCTGCAGGGCTAACGG + Intronic
1062656330 9:137605951-137605973 GCCCGGGACTGCTGGGAAGCGGG + Intronic
1186153494 X:6701301-6701323 GGATGGGGCTCCTGGGAAACAGG + Intergenic
1186865666 X:13718252-13718274 GCATGGGATTCCACGGCAACGGG - Intronic
1189192645 X:39123696-39123718 GCATGGAATTCCAGGCAAACAGG - Intergenic
1194639829 X:96390625-96390647 GCCTGGGAGAGGAGGGAAACCGG + Intergenic
1200211958 X:154350691-154350713 GCATGGTACTGCAGGGTAGAAGG + Intronic