ID: 1140474228

View in Genome Browser
Species Human (GRCh38)
Location 16:75230746-75230768
Sequence CCTATTGGTTTTGCTCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140474228_1140474236 24 Left 1140474228 16:75230746-75230768 CCACAATGAGCAAAACCAATAGG 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1140474236 16:75230793-75230815 AACCTCGCACTGTCCCCCTTAGG 0: 1
1: 0
2: 2
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140474228 Original CRISPR CCTATTGGTTTTGCTCATTG TGG (reversed) Intronic
900724897 1:4209647-4209669 CCTATTTGTTTTGTTCCTTTAGG - Intergenic
900989475 1:6091674-6091696 CCTGATGGCTTTGCTCCTTGTGG - Intronic
907627505 1:56044391-56044413 CCCACTGGTTTTGCTTATGGTGG - Intergenic
910859167 1:91726642-91726664 ACTGTTGGCTTTGCTCACTGTGG + Intronic
911606010 1:99905946-99905968 ACTATTGGTTTTTTTTATTGTGG + Intronic
917167243 1:172125991-172126013 CTTATTGGTCTTACTCCTTGTGG + Intronic
918121475 1:181544867-181544889 GCTGTTTGTTTTGGTCATTGTGG + Intronic
918152099 1:181806384-181806406 CCTCTTTGTTTTGCTCCTAGAGG + Intronic
918162492 1:181914570-181914592 CCCATTGGCTGTGGTCATTGTGG - Intergenic
919095897 1:193035763-193035785 GCTATTGGTATTGCTGTTTGGGG - Intronic
921352376 1:214249342-214249364 CCTGTTGGTTTTTCTCATGTTGG + Intergenic
923454916 1:234155793-234155815 CCTATTGGTTTTTGTTTTTGGGG - Intronic
924025341 1:239826698-239826720 CTTATAGGTTTTTCTCATTCAGG - Intronic
924950270 1:248875772-248875794 CCTATTTGTTTTAAACATTGTGG - Intergenic
1065508450 10:26453772-26453794 CATAGTGGTTGTACTCATTGTGG - Intronic
1069077856 10:64056873-64056895 CCTTTTGGTTTTTCTGATTTGGG + Intergenic
1076274650 10:129186878-129186900 CCTATTGGTATTGCTCACAGAGG - Intergenic
1078127458 11:8581737-8581759 CATTTAGCTTTTGCTCATTGTGG - Intronic
1085808458 11:79658353-79658375 CCTATGGGTTTTTCTCAGTGAGG + Intergenic
1086607734 11:88716447-88716469 CCTTTGGGTATTCCTCATTGGGG - Intronic
1090553359 11:127847130-127847152 CCTACTGGTTTTGCTCAAAATGG - Intergenic
1093315955 12:17649809-17649831 TCTATGGGTTTTGCTGGTTGGGG - Intergenic
1094438137 12:30444710-30444732 CACATTTGTTTTGCTCATTCTGG - Intergenic
1095293629 12:40504409-40504431 CCTCTTGTTTTTGCACTTTGTGG - Intronic
1095882325 12:47151076-47151098 CCTATTGGTTTTGCTTTTCTGGG - Intronic
1096548596 12:52357563-52357585 ACTAAGTGTTTTGCTCATTGAGG - Intergenic
1098239386 12:68451207-68451229 CCTTTTGGTTGTGCTTATTTCGG - Intergenic
1109874951 13:68388833-68388855 CTTATTTGTTTTGTTCATTAAGG + Intergenic
1113653036 13:112050776-112050798 CTTATTGCTTTTGCTCATAAAGG - Intergenic
1116133096 14:40884879-40884901 CCTATTTAGTTTGCTCATTAAGG + Intergenic
1125025296 15:35023591-35023613 CTTTTTGGTATTGCTCCTTGTGG + Intergenic
1125490803 15:40147205-40147227 CCTTCTGGTTCTGCTCCTTGGGG - Intergenic
1127162795 15:56207864-56207886 CCTATTGGTCTTTCCCATTTGGG - Intronic
1129612190 15:77070280-77070302 TCTATTTGTTTTGGTCATGGGGG - Intronic
1131193779 15:90338459-90338481 CCAATTGCTCTTCCTCATTGTGG - Intergenic
1132422492 15:101684175-101684197 CCTATTAGATTTGCTGATTTTGG - Exonic
1133136586 16:3716868-3716890 GCTATAGGTTTTGTTCACTGTGG + Intronic
1140305756 16:73801013-73801035 GCTGTTGGTTTTGCTCATTACGG - Intergenic
1140474228 16:75230746-75230768 CCTATTGGTTTTGCTCATTGTGG - Intronic
1141204529 16:81923389-81923411 CCATTTGGTTCTTCTCATTGGGG - Intronic
1143286533 17:5794037-5794059 CCTATTGGGTTTTGTCATTAGGG + Intronic
1145098727 17:20055360-20055382 CATCTTGGTTTTACTCTTTGAGG + Intronic
1148961116 17:51393696-51393718 CCTAGTGGTTTTGGTCAATGGGG + Intergenic
1149569145 17:57660181-57660203 TATATTGGTTTTCCTCATGGTGG + Intronic
1150362395 17:64548238-64548260 CCTATTAGCTTTGTTGATTGAGG + Intronic
1151599446 17:75097387-75097409 CCTAGAGGTTTGGCTCAATGTGG - Intronic
1155183007 18:23364423-23364445 TATATTGGTTGTGCTCCTTGTGG - Intronic
1155794522 18:30018826-30018848 CCTATTTTTATTGCTTATTGAGG - Intergenic
1158619031 18:59014774-59014796 GCTTTTGGTTTTGCTAATTTTGG - Intergenic
1160680052 19:408344-408366 CATGTTGGTTTTTCTCATGGGGG + Exonic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166208467 19:41289333-41289355 CCTTTTTGTTTTGCAAATTGAGG - Intronic
925770622 2:7279363-7279385 CCTATTGGTTTTATTTATTTGGG + Intergenic
935719388 2:105966839-105966861 CATACTGGTTTTGCCCATTTGGG + Intergenic
940413538 2:153393994-153394016 CCTATTGGTTTTGTTCTTCTGGG + Intergenic
944951714 2:204758104-204758126 CCTCTTGGTTTTCCTCCATGTGG + Intronic
946974612 2:225134301-225134323 CCTATTGGCTTTGGTCAATTTGG + Intergenic
948170459 2:235897628-235897650 CCTTTTCGTGTTACTCATTGAGG + Intronic
1168965610 20:1896174-1896196 CCTGGTGGTCTTGCTCCTTGAGG + Intronic
1170448509 20:16456548-16456570 CCTATTTGTTTCCCTCTTTGGGG - Intronic
1173293845 20:41738308-41738330 CATATTTGTTTTCCTCATTGTGG + Intergenic
1176844052 21:13862996-13863018 CCTATAGGTTTTCCACAATGAGG + Intergenic
1178623801 21:34199111-34199133 AACATTGGTTTTGCTCTTTGGGG - Intergenic
1178750283 21:35296311-35296333 CCTATTGGTTCTGCTTCTTTGGG + Intronic
1182349113 22:29688751-29688773 CAAATTGGATTTGTTCATTGGGG + Intronic
950866419 3:16192994-16193016 ATTCCTGGTTTTGCTCATTGTGG + Intronic
951229585 3:20161596-20161618 AATATTGGTTTTGGTCACTGAGG + Intronic
951702242 3:25508005-25508027 CCTCTTTGTATTGCTCTTTGAGG + Intronic
955840819 3:63110876-63110898 CCTTTTTGTCTTGCTTATTGTGG - Intergenic
956524585 3:70143572-70143594 CCTATTGGGTTTGGCCAATGGGG + Intergenic
957420123 3:79957020-79957042 TCTTTTGCTTTTGCTCATTTAGG - Intergenic
958453989 3:94307239-94307261 CCTCTTGGCTTTGCCCAGTGGGG + Intergenic
960935422 3:122897825-122897847 CCTGTTAATTTTTCTCATTGTGG + Intergenic
961423767 3:126828866-126828888 CCTTTTTGTTTTGCTCATTCTGG + Intronic
961448697 3:126992714-126992736 CCTGCTGGTTCTGCTCATAGTGG + Intronic
962345602 3:134616979-134617001 CCTATTAGTTTTGTTCTTTGTGG - Intronic
962622000 3:137189640-137189662 CCTACTGGTTGTCCTCACTGTGG + Intergenic
965718942 3:171639868-171639890 CCTATTGGTTCTGTTTCTTGAGG + Intronic
970312461 4:14797418-14797440 CCTAGTGGGTTGGATCATTGGGG - Intergenic
973989452 4:56389338-56389360 CTTGTTGGTTTTGCTCACTGGGG + Intergenic
974071051 4:57123926-57123948 TCTATTGGTTTTGGACTTTGAGG + Intergenic
974430915 4:61794785-61794807 CCTAATGGTTTACCTCATTTAGG - Intronic
978975872 4:114871194-114871216 CATATCAGTTTTGCTTATTGTGG + Intronic
979694439 4:123596599-123596621 CCAGGTGGTCTTGCTCATTGGGG + Intergenic
983287344 4:165756080-165756102 TTTATTTGTTTTGCTCATGGCGG + Intergenic
984892306 4:184504697-184504719 CCTCTTTGTTGTGCTCTTTGTGG - Intergenic
986622820 5:9693140-9693162 CCTATTTGTTTTTCACTTTGGGG - Intronic
987940817 5:24533576-24533598 AGTAATAGTTTTGCTCATTGTGG + Intronic
989318950 5:40112606-40112628 CTTACTGGTTTTGCCAATTGTGG + Intergenic
989774488 5:45187116-45187138 CCTATTTGTGAGGCTCATTGTGG + Intergenic
993756705 5:91739926-91739948 TTTGTTGGTTTTGCTCACTGTGG - Intergenic
994977375 5:106827491-106827513 CATAATTGTTTTTCTCATTGGGG - Intergenic
998949211 5:147374865-147374887 GCTTTTGTTTTTACTCATTGAGG + Intronic
1009522286 6:64698262-64698284 CCTATTTTTTTAGTTCATTGAGG - Intronic
1009706345 6:67256991-67257013 CCAATTGGTTTTTCTGATTTAGG + Intergenic
1010552931 6:77245000-77245022 GGTATTGGTTTTTCTCAGTGCGG - Intergenic
1011878409 6:91992004-91992026 CCTGCTGGTTTTGCTGCTTGTGG - Intergenic
1014303986 6:119717208-119717230 CCTTTTAGTATTGCTCCTTGTGG + Intergenic
1018737513 6:166698628-166698650 CCTTTTAATTTTGATCATTGGGG - Intronic
1024088199 7:45914659-45914681 CCTATTTGCTTTGCTCTTTCTGG + Intronic
1024861874 7:53853637-53853659 CCTATTGTGTTTGTTCAGTGTGG - Intergenic
1024895356 7:54254141-54254163 CATTTTGGTTTGGCACATTGGGG + Intergenic
1031602446 7:123727147-123727169 CCTTTTGTTTTTGGTCATTTTGG - Intronic
1032905531 7:136360272-136360294 TCTATTGTTTTTTCTCTTTGTGG - Intergenic
1033827207 7:145206101-145206123 CATAATGATATTGCTCATTGTGG + Intergenic
1038999805 8:32967264-32967286 CCTAATGGTTCTGATAATTGAGG + Intergenic
1039403319 8:37291752-37291774 GCAATTGGTTTTGAGCATTGGGG + Intergenic
1040434599 8:47378235-47378257 AATATTGTTTTAGCTCATTGTGG + Intronic
1040434774 8:47379799-47379821 CCTGTTGCCTTTGCTCCTTGTGG + Intronic
1041727648 8:61032821-61032843 CCTATTGGATTTTCCCATGGGGG - Intergenic
1047056866 8:121174575-121174597 CCTATTGGGTTTTGTCAGTGAGG - Intergenic
1047772371 8:128039594-128039616 CCTATCTTTTTTGCTCTTTGTGG - Intergenic
1051009996 9:12400097-12400119 CATAATGTTTTTGCTCATGGAGG - Intergenic
1053147839 9:35723965-35723987 CCTTGTGCTTCTGCTCATTGTGG + Exonic
1055203017 9:73690829-73690851 CATAATGTTTTTGCTCATTCTGG - Intergenic
1055229713 9:74047567-74047589 CATATTGCTTTGGCTCTTTGGGG + Intergenic
1187501758 X:19844706-19844728 CCCTTTGTTTTTGCTCCTTGAGG - Intronic
1187847271 X:23553406-23553428 CAGGTTGGTTTTGCTCATGGGGG - Intergenic
1188160591 X:26796287-26796309 CTTATTGTTTTTTCTCATGGAGG - Intergenic
1188853772 X:35166217-35166239 CCTATTGTTTATGCTTACTGAGG + Intergenic
1189499568 X:41543678-41543700 CCTAATGATTTTGCTCATGGGGG + Intronic
1191613657 X:63144453-63144475 CTTATTTGTTTTGCTCTTTTTGG + Intergenic
1191622640 X:63234474-63234496 CTTATTTGTTTTGCTCTTTTTGG - Intergenic
1191757727 X:64612223-64612245 CATATTGGTTTGTCTCAGTGGGG - Intergenic
1194973125 X:100366223-100366245 TCTATTAGTTTTGCCCACTGGGG + Intronic
1202340403 Y:23858561-23858583 CTTGTTGGTTTTGCTGATTGAGG + Intergenic
1202530363 Y:25811521-25811543 CTTGTTGGTTTTGCTGATTGAGG - Intergenic