ID: 1140475836

View in Genome Browser
Species Human (GRCh38)
Location 16:75238876-75238898
Sequence CCTGCCTTTGGGAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 606}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140475836_1140475851 22 Left 1140475836 16:75238876-75238898 CCTCCCAGCCTCCCAAAGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 606
Right 1140475851 16:75238921-75238943 AGCCAGGACCCAGCACCAGCAGG 0: 1
1: 0
2: 2
3: 45
4: 321
1140475836_1140475848 6 Left 1140475836 16:75238876-75238898 CCTCCCAGCCTCCCAAAGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 606
Right 1140475848 16:75238905-75238927 CCCAGCCTCAAGGCTCAGCCAGG 0: 1
1: 1
2: 6
3: 41
4: 423
1140475836_1140475854 26 Left 1140475836 16:75238876-75238898 CCTCCCAGCCTCCCAAAGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 606
Right 1140475854 16:75238925-75238947 AGGACCCAGCACCAGCAGGAGGG 0: 1
1: 0
2: 1
3: 44
4: 362
1140475836_1140475853 25 Left 1140475836 16:75238876-75238898 CCTCCCAGCCTCCCAAAGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 606
Right 1140475853 16:75238924-75238946 CAGGACCCAGCACCAGCAGGAGG 0: 1
1: 0
2: 2
3: 48
4: 478
1140475836_1140475846 -4 Left 1140475836 16:75238876-75238898 CCTCCCAGCCTCCCAAAGGCAGG 0: 1
1: 0
2: 5
3: 52
4: 606
Right 1140475846 16:75238895-75238917 CAGGTGGGGACCCAGCCTCAAGG 0: 1
1: 0
2: 1
3: 39
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140475836 Original CRISPR CCTGCCTTTGGGAGGCTGGG AGG (reversed) Intronic
900034931 1:399816-399838 CTTGACTTTGATAGGCTGGGTGG - Intergenic
900056548 1:635568-635590 CTTGACTTTGATAGGCTGGGTGG - Intergenic
900255792 1:1697734-1697756 CCTGGCTGTGGGAGGCAGGGTGG + Intronic
900264463 1:1750344-1750366 CCTGGCTGTGGGAGGCAGGGTGG + Intergenic
900288733 1:1914806-1914828 CCTGGCTTTGGGAGTCTGGTGGG + Exonic
900641637 1:3690469-3690491 CCTGCCTGGGGAAGGCTCGGGGG - Intronic
901249551 1:7765777-7765799 CAGCACTTTGGGAGGCTGGGTGG + Intronic
901382181 1:8881768-8881790 CATCACTTTGGGAGGCTGAGGGG + Intergenic
901459662 1:9384033-9384055 CAGCCCTTTGGGAGGCTGAGCGG - Intergenic
901937434 1:12636472-12636494 GCTTCCCTTGGGAGGCAGGGTGG - Intergenic
902334346 1:15746611-15746633 CCTGCCACTGCGAGGCTGCGAGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903537205 1:24074834-24074856 CAGCCCTTTGGGAGGCTGAGTGG + Intronic
903558255 1:24208918-24208940 CAGCCCTTTGGGAGGCTGAGGGG - Intergenic
904046477 1:27612256-27612278 CCTTCCTTTGGGAGCGGGGGTGG - Exonic
904124661 1:28229523-28229545 CAACACTTTGGGAGGCTGGGGGG + Intronic
904376199 1:30083945-30083967 CCTGGCTTTGGGATGGTGGTCGG + Intergenic
904395975 1:30222492-30222514 GCAGCCTGTGGGAGCCTGGGTGG - Intergenic
904420226 1:30386337-30386359 CCTGGCTCTGGGAGGCTCAGGGG + Intergenic
905398834 1:37686817-37686839 CCCAGCTTTGGGAGGCTGAGCGG + Intronic
906231903 1:44171557-44171579 CCTGCCTGTGGGGTGCTGGGCGG - Intergenic
907409219 1:54273026-54273048 CCTGCACTTGGGAGGCCAGGAGG + Intronic
908518517 1:64917794-64917816 CCAGCTGTTGGGAGCCTGGGAGG - Intronic
908656909 1:66397819-66397841 CAGCCCTTTGGGAGGCTGAGGGG + Intergenic
910016091 1:82526185-82526207 CATCACTTTGGGAGGCTGAGGGG + Intergenic
911452794 1:98086171-98086193 CAGTACTTTGGGAGGCTGGGGGG + Intergenic
912346504 1:108968063-108968085 CAGGACTTTGGGAGGCTGAGGGG - Intergenic
912929106 1:113940527-113940549 CTTGCCCTTGTGTGGCTGGGAGG - Exonic
915027242 1:152842591-152842613 GATGTCCTTGGGAGGCTGGGCGG - Intergenic
915685660 1:157630141-157630163 GCTCCCTTTGGTGGGCTGGGAGG + Intergenic
915741540 1:158122350-158122372 CAGCACTTTGGGAGGCTGGGCGG + Intergenic
916452050 1:164930117-164930139 GCTGGCTTTGTGAGGCTCGGGGG + Intergenic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
916813477 1:168327535-168327557 CAGCACTTTGGGAGGCTGGGCGG + Intergenic
919156397 1:193771052-193771074 CCTTCCTTTGGGAGGTTCTGTGG - Intergenic
919460286 1:197869100-197869122 CCTGCCTCTGGGAGGCAGTAGGG - Intergenic
919862574 1:201750735-201750757 CCTGCCTTTCTGAGATTGGGAGG - Intronic
920023013 1:202969634-202969656 CATCACTTTGGGAGGCTGGATGG + Intergenic
920364039 1:205438757-205438779 CCTGGCTTTGGGAACATGGGTGG - Intronic
920374507 1:205500517-205500539 CCTGCCCTTGGCAGGCAGGAGGG - Intergenic
920446294 1:206021232-206021254 CCTGCCGCTGTGGGGCTGGGTGG - Intronic
921179995 1:212624698-212624720 CCGGCCTCTGGGAGGCTCTGAGG + Exonic
921559541 1:216640441-216640463 CTTGCCTTAGGGAAGCTGGTTGG + Intronic
921668428 1:217900456-217900478 CCAGACTTTGGGAGGCTGAGGGG + Intergenic
922257458 1:223905373-223905395 CTTGACTTTGATAGGCTGGGTGG - Intergenic
922766811 1:228160313-228160335 CAGGCCTAAGGGAGGCTGGGGGG - Intergenic
922792298 1:228317138-228317160 CCTGACCATGGGAGTCTGGGAGG + Intronic
923541342 1:234890460-234890482 CCGGTCTTTGGGAGACTGGGAGG - Intergenic
924338654 1:243008153-243008175 CTTGACTTTGATAGGCTGGGTGG - Intergenic
924415022 1:243849940-243849962 CCCGCCTGAGGGAGGCAGGGAGG + Intronic
924515954 1:244766437-244766459 CCAGCACTTGGGAGGCTGGGGGG - Intergenic
1062825865 10:568144-568166 CCTCCCTTTTGGGGGCTTGGTGG - Intronic
1063147541 10:3309526-3309548 CAGCACTTTGGGAGGCTGGGGGG + Intergenic
1063207966 10:3853117-3853139 CGTGGCTTGGGAAGGCTGGGTGG + Intergenic
1064373179 10:14772105-14772127 CAGCACTTTGGGAGGCTGGGCGG + Intronic
1065059975 10:21890161-21890183 CAGCACTTTGGGAGGCTGGGGGG + Intronic
1065343125 10:24724137-24724159 CCTGGTTTTGGGGTGCTGGGGGG - Intergenic
1067948353 10:50706168-50706190 CCTCCCTGTGGGAGACAGGGTGG - Intergenic
1068105948 10:52616537-52616559 CCTTCCTTTTGGAGGCTGTAAGG + Intergenic
1068676241 10:59772363-59772385 ACTGTCTTTGGGATGGTGGGGGG + Intergenic
1069678435 10:70266363-70266385 ACTGCTGTTGGGAGGCTGGGAGG + Exonic
1069748790 10:70732634-70732656 CCTGCCTTTGGGTGGGTCAGTGG + Intronic
1070314395 10:75296245-75296267 CCAGCCCCTGGGAGGATGGGTGG + Intergenic
1072209865 10:93236572-93236594 CCTGCCTGTGCCAGGCTGGCAGG + Intergenic
1072333283 10:94374320-94374342 CAGGACTTTGGGAGGCTGAGAGG + Intergenic
1072682304 10:97516250-97516272 CCTGTCTTTGGGGAGCTGTGTGG + Intronic
1073023910 10:100471719-100471741 CCTAGCTGTGTGAGGCTGGGTGG + Intronic
1073419680 10:103414527-103414549 ACTGCCTTTGTGTAGCTGGGTGG - Intronic
1074403790 10:113163781-113163803 TCAGCCTCTGGGAGGCAGGGAGG + Intronic
1074422439 10:113321165-113321187 TCTCCTTTTGGGAGGATGGGCGG + Intergenic
1074874396 10:117602829-117602851 ACTGCCTTGGGGAAGTTGGGGGG + Intergenic
1075023159 10:118965958-118965980 GATGCCTTTAGGAGGCTGGATGG - Intergenic
1075616903 10:123896919-123896941 TCTGTATCTGGGAGGCTGGGAGG + Intronic
1075763095 10:124871457-124871479 CCTGCCTATGGGCAGGTGGGTGG - Intergenic
1075795123 10:125114790-125114812 TCTGCATTTGGGTGGGTGGGTGG - Intronic
1076065865 10:127447442-127447464 GCTGCCTTTGAGAGGCAGAGGGG - Exonic
1076678208 10:132158923-132158945 TCTTCCTTTGTGATGCTGGGGGG + Intronic
1076678382 10:132159624-132159646 TCTTCCTTTGTGATGCTGGGGGG + Intronic
1076718854 10:132383864-132383886 TCTGCCTTTGGCAGGCTGGTGGG + Intergenic
1076833741 10:133009671-133009693 CCTGCATTGGGGAGGCTGCATGG - Intergenic
1076836297 10:133022651-133022673 CCTGGCTCTGGGAGTCTGGATGG + Intergenic
1076843752 10:133058963-133058985 CCAGCCTTTTGGGGGGTGGGAGG + Intergenic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076870268 10:133189478-133189500 CGTGCAATGGGGAGGCTGGGGGG + Intronic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077143145 11:1033691-1033713 CCAGCCTCTGGGAGTCAGGGTGG - Intronic
1077176926 11:1195325-1195347 CCAGCCCTTGGAAGGGTGGGAGG - Intronic
1077213528 11:1384364-1384386 CCCGCCTTTGGGTGGGTGGGTGG - Intergenic
1077226933 11:1442700-1442722 CCTGCCTGTGGGGTGCCGGGAGG - Intronic
1077308817 11:1879588-1879610 CCTGCCTTTGGGGTGCAGGAGGG + Intronic
1078084230 11:8224240-8224262 CCTGCCCTTGAGAGGCAGAGGGG + Intergenic
1078436375 11:11328991-11329013 CCTGCCTAAGGGATGGTGGGGGG - Intronic
1078897753 11:15612646-15612668 CCTGGGTTTGGGAGACTTGGGGG - Intergenic
1079695570 11:23478035-23478057 ACTGCCCTGAGGAGGCTGGGAGG + Intergenic
1080734198 11:34994976-34994998 CCTGCATTTTGGCGGTTGGGAGG + Exonic
1080853064 11:36088145-36088167 ACTGGTTTTGGGGGGCTGGGTGG - Intronic
1081633145 11:44702905-44702927 CCTGCCTTTGAGAGAGTGGCAGG + Intergenic
1081712862 11:45228697-45228719 TCTGCATTTGGGAGGCAGGGGGG + Intronic
1081854984 11:46297209-46297231 CCTGGCTGTGGCTGGCTGGGTGG + Intronic
1082193478 11:49274217-49274239 CCAGCCTTTGGGGAACTGGGGGG - Intergenic
1082849670 11:57753803-57753825 CAGGACTTTGGGAGGCTGAGGGG + Intronic
1082883468 11:58060471-58060493 CCTGCCTAAGGAAAGCTGGGAGG + Intronic
1083144147 11:60746038-60746060 CAGCACTTTGGGAGGCTGGGGGG + Intergenic
1083555820 11:63626129-63626151 CAGCACTTTGGGAGGCTGGGGGG + Exonic
1083606331 11:63981053-63981075 CCTGCATTTGTGGGGATGGGTGG + Intronic
1083630442 11:64092413-64092435 CCTGCCTATGGAGGGCTGGTGGG + Intronic
1083783655 11:64931631-64931653 CCCGCCAGAGGGAGGCTGGGAGG + Intronic
1083784548 11:64936365-64936387 CTTGAGTCTGGGAGGCTGGGAGG - Intergenic
1084709004 11:70832474-70832496 CCTGCCTTTGAGAAGCTGGGAGG - Intronic
1084845685 11:71897872-71897894 CCTGCCTTTTGAAGGCTGAATGG - Intronic
1085058733 11:73425149-73425171 ACTGCTTTTGTGAAGCTGGGGGG - Intronic
1085459835 11:76686882-76686904 CATGACCTTGGGCGGCTGGGAGG + Intergenic
1085851091 11:80121191-80121213 CCTGCCTTTGGGAGACAATGAGG - Intergenic
1086159911 11:83710409-83710431 CCAGCATTTGGGAGGCTGAGCGG - Intronic
1086688453 11:89760709-89760731 CAGCACTTTGGGAGGCTGGGCGG - Intergenic
1086717407 11:90079236-90079258 CAGCACTTTGGGAGGCTGGGCGG + Intergenic
1088548675 11:110987914-110987936 CAGTACTTTGGGAGGCTGGGTGG - Intergenic
1088624097 11:111716331-111716353 CAGCACTTTGGGAGGCTGGGTGG + Intronic
1088817504 11:113431896-113431918 CCTGCCTGGGGCAGCCTGGGTGG - Intronic
1089556289 11:119317330-119317352 CCTGGCTTGGGAAGGCTGAGGGG + Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1089786015 11:120907805-120907827 GCTGGCTTAGGGAGGATGGGTGG + Intronic
1090235004 11:125140522-125140544 CCTGGCTGTGGGAGACTGGCAGG - Intergenic
1090821294 11:130344384-130344406 CAGCCCTTTGGGAGGCTGAGGGG + Intergenic
1091727386 12:2855404-2855426 CCCACGTTTGGGAGGGTGGGAGG + Intronic
1091770600 12:3148815-3148837 GCAGCCGTGGGGAGGCTGGGAGG - Intronic
1092140967 12:6183155-6183177 CCTGCCTCTTTGTGGCTGGGTGG - Intergenic
1092847594 12:12598265-12598287 CATCACTTTGGGAGGCTGAGGGG - Intergenic
1092884903 12:12916442-12916464 GCTGCCTTTGCAAGGCTGAGAGG - Exonic
1093950289 12:25157979-25158001 CAGCCCTTTGGGAGGCTGAGGGG + Intronic
1095042204 12:37455578-37455600 CATGGGTTTGGGTGGCTGGGTGG - Intergenic
1095464435 12:42475842-42475864 CCAGCATTTGGGAGGCTGGGGGG + Intronic
1096069729 12:48768315-48768337 CCAGCCTTTGGGAGCAGGGGAGG - Exonic
1096652479 12:53068658-53068680 CCTGTGTTTGGGACCCTGGGCGG - Intronic
1099191822 12:79569114-79569136 CATCACTTTGGGAGGCTGAGTGG + Intergenic
1100078828 12:90823857-90823879 CCAGCCGTTGGGAGGCTAAGGGG - Intergenic
1100380738 12:94059470-94059492 CATGCCTTTGGCAGTCTGGCAGG - Intergenic
1101353061 12:103950597-103950619 CCTGCCTTAGGGAGTATGGATGG + Exonic
1102280623 12:111615962-111615984 CCAGCCTTTGGGAGGCGAGGTGG - Intergenic
1102511165 12:113416348-113416370 CCTGGGTCTGGGGGGCTGGGAGG + Intronic
1103528896 12:121586268-121586290 CCCCACTTTGGGAGGCTGAGGGG - Intergenic
1103656178 12:122472574-122472596 CAGCACTTTGGGAGGCTGGGCGG + Intergenic
1103744810 12:123115176-123115198 CATGCCTTGGGCAGGCTGGCTGG + Intronic
1104755790 12:131268694-131268716 ACTGCAGTTGGGAGGCTGGTGGG - Intergenic
1105013033 12:132768396-132768418 CAGCACTTTGGGAGGCTGGGAGG - Intergenic
1105341678 13:19532141-19532163 CCTGTCTATGAGTGGCTGGGAGG - Intronic
1105822915 13:24095994-24096016 CCTGCCTCTGAGAGGCTGCCTGG + Intronic
1105882650 13:24617541-24617563 CCTGCGTCTGGGAGGCTGCCTGG + Intergenic
1107678823 13:42825966-42825988 ACTGCCTGTGGGAGGGTGGCAGG - Intergenic
1108495212 13:51018272-51018294 CAGCACTTTGGGAGGCTGGGTGG - Intergenic
1108684191 13:52804663-52804685 TCTGCCCTGGGAAGGCTGGGAGG - Intergenic
1108896253 13:55332984-55333006 TCTGACTTGGGGAAGCTGGGAGG + Intergenic
1110671604 13:78186691-78186713 CCTGCCCTTGGGAGGCCCAGAGG - Intergenic
1110782018 13:79477683-79477705 CCTGCTTCTGGGAAGGTGGGAGG + Intergenic
1112006581 13:95258932-95258954 CCTGCCTGCGGGAGGCTGCTGGG + Intronic
1112192761 13:97193846-97193868 TCTGCCCTTGGAAGGCTGTGAGG - Intergenic
1112951367 13:105001147-105001169 CCTGACTGTGGGAGGCATGGAGG - Intergenic
1113462400 13:110491357-110491379 CCTGCCTGAGGAAGGCTGTGTGG - Intronic
1113549185 13:111178690-111178712 CCTGCCTTTTCCAAGCTGGGTGG - Intronic
1114201186 14:20522301-20522323 CAGCACTTTGGGAGGCTGGGGGG + Intergenic
1114251509 14:20965746-20965768 CAGCACTTTGGGAGGCTGGGCGG + Intergenic
1115275541 14:31604697-31604719 CCTTTTTTTGGGAGGGTGGGGGG + Intronic
1115463344 14:33686229-33686251 GCTGCATTTGGGAGGCAGGAAGG + Intronic
1115611224 14:35050465-35050487 CCTCTATTTGGGAGGCGGGGTGG - Intronic
1116930428 14:50685306-50685328 CAGCACTTTGGGAGGCTGGGAGG - Intergenic
1117078942 14:52131929-52131951 CCTACCTATGTTAGGCTGGGAGG + Intergenic
1117418027 14:55515922-55515944 CCTGCGTTTTACAGGCTGGGAGG + Intergenic
1117558434 14:56910285-56910307 CAGCACTTTGGGAGGCTGGGGGG - Intergenic
1118286579 14:64479815-64479837 TCTGCAGTTGGGAGGCTGAGAGG - Exonic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1118596919 14:67442848-67442870 CTTCCCTTTGGGAGGCTGGAAGG - Intergenic
1118734290 14:68690867-68690889 CATGCCTTTCAGAGGGTGGGGGG - Intronic
1118779407 14:68996958-68996980 CAGCACTTTGGGAGGCTGGGGGG + Intergenic
1119402205 14:74370578-74370600 CAGCACTTTGGGAGGCTGGGAGG - Intergenic
1119488078 14:75005127-75005149 CAGCACTTTGGGAGGCTGGGCGG + Intronic
1119734579 14:76973789-76973811 CAGCACTTTGGGAGGCTGGGGGG - Intergenic
1119788004 14:77327138-77327160 CCTGACCCTGGGAGGGTGGGTGG + Intronic
1120645362 14:87067694-87067716 CATCACTTTGGGAGGCTGAGAGG + Intergenic
1121106653 14:91284331-91284353 CCAGACTTTGAGTGGCTGGGAGG - Intronic
1121633483 14:95438334-95438356 CAGAACTTTGGGAGGCTGGGAGG - Intronic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1121940391 14:98064722-98064744 CCTGAGTTTGTGAGGCTGGATGG + Intergenic
1121991519 14:98562259-98562281 TCTCTCTTTGGGAGGCTGAGGGG - Intergenic
1122614525 14:103007924-103007946 CCTGCCTTAGGCAGGCAGGAGGG + Intronic
1122615060 14:103011482-103011504 CAGCACTTTGGGAGGCTGGGCGG + Intronic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1124182676 15:27491362-27491384 GCTGCCTGTCTGAGGCTGGGAGG - Intronic
1124252762 15:28117723-28117745 CCTGTGTTGGGGAGGCTGAGTGG - Intronic
1124368537 15:29090536-29090558 CAGGCCCTGGGGAGGCTGGGAGG - Intronic
1124458817 15:29870086-29870108 CAGCACTTTGGGAGGCTGGGCGG - Intronic
1124634687 15:31357526-31357548 CCTGCCTGGGGGAGGGAGGGTGG + Intronic
1125079715 15:35657999-35658021 GCTGGCTTTGGGTGGGTGGGTGG - Intergenic
1125745330 15:41993766-41993788 CTTGCTTTTGGGAAGGTGGGAGG + Intronic
1126335514 15:47582770-47582792 GCTGCCCTTGAGAGGCTGGCAGG - Intronic
1126672282 15:51127288-51127310 CCTGGCTTTTGGCGGCTGGTGGG + Intergenic
1127128224 15:55834541-55834563 CAGCACTTTGGGAGGCTGGGTGG + Intronic
1127999160 15:64174883-64174905 ACTGCCCTTGAGAGGCTGAGGGG - Intronic
1128562495 15:68677974-68677996 CCTGCCTCTCGGAGGCCTGGTGG + Intronic
1128567343 15:68710232-68710254 ACTGCATCTGGGAGGCTGAGGGG - Intronic
1129453574 15:75664126-75664148 GCTGCCTTTTGAAGGCTGGGGGG + Intergenic
1129776483 15:78240051-78240073 CCTGCCATTAGGAGGAAGGGTGG + Intronic
1129786138 15:78311329-78311351 CCTGCACTTGGGAGGCAAGGGGG + Intergenic
1132476758 16:143141-143163 CCTGCCCTTGGCAGGATAGGAGG + Intergenic
1132556101 16:573339-573361 CCTGCCCTGGGGTGGCTGTGGGG + Intronic
1132732935 16:1371772-1371794 ACTGCCTGTGGGGGGCTGCGAGG - Intronic
1132796511 16:1726424-1726446 CCACACTTTGGGAGGCTGAGGGG + Intronic
1132797460 16:1732258-1732280 CCTGGCTGTGGGAGGCTTGGGGG - Intronic
1133124553 16:3637535-3637557 CCTGCCTGTGGAAGGCTTAGGGG + Intronic
1135586776 16:23677928-23677950 CCAGCATTTGGGAGGCCGAGGGG + Intronic
1136145105 16:28311918-28311940 CCTGGGTGTGGGAGGCAGGGAGG + Intronic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1136278751 16:29194720-29194742 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1136534789 16:30893286-30893308 TCTCCCTGTGGGAGGGTGGGGGG + Exonic
1137659532 16:50192836-50192858 CAGCACTTTGGGAGGCTGGGTGG + Intronic
1137669382 16:50270640-50270662 CCTCCCTGGGGGAGCCTGGGTGG + Intronic
1138418629 16:56885512-56885534 CCTGTCTTGTGGTGGCTGGGTGG - Intronic
1139429526 16:66903764-66903786 CCAGCCTCTGGGGGCCTGGGCGG - Intergenic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139614426 16:68080325-68080347 TCTGCCTGTGTGAGGCTGGCTGG + Intergenic
1139681682 16:68569651-68569673 CAACACTTTGGGAGGCTGGGTGG + Intronic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1141102456 16:81208163-81208185 CAGGACTTTGGGAGGCTGAGGGG - Intergenic
1141166195 16:81662465-81662487 TCTGCCTTTTGGAGGGAGGGGGG + Intronic
1141978345 16:87533413-87533435 GCTGCCTATGGGAGGATGAGCGG - Intergenic
1142083142 16:88160801-88160823 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1142251996 16:88996325-88996347 CCAGCCTTTGTCAGGCTGCGGGG - Intergenic
1142265489 16:89062380-89062402 ACAGCCTTTTTGAGGCTGGGTGG - Intergenic
1142508290 17:379872-379894 CTTGCTTTTGGGATGCTTGGGGG - Intronic
1142518740 17:490298-490320 CCTGCCTTTGCCGGGCGGGGGGG - Intergenic
1142585105 17:967262-967284 CCTGCTGCTGGGAGTCTGGGAGG + Intronic
1142611258 17:1110060-1110082 CCTGCGGTGGGGTGGCTGGGGGG - Intronic
1143089719 17:4442287-4442309 CAGCACTTTGGGAGGCTGGGTGG + Intronic
1143630393 17:8136225-8136247 CAGCACTTTGGGAGGCTGGGTGG + Intergenic
1144136865 17:12303521-12303543 GCTGTCTTTGGGTGGCTGGAGGG - Intergenic
1144158199 17:12528976-12528998 CAGCACTTTGGGAGGCTGGGTGG - Intergenic
1144206322 17:12982113-12982135 ACTGGCATTAGGAGGCTGGGTGG - Intronic
1144606438 17:16669932-16669954 CAGCCCTTTGGGAGGCTGAGGGG + Intergenic
1144642296 17:16944211-16944233 TGTGCCGTTGGGAGGCTGTGAGG - Intronic
1144664058 17:17090262-17090284 CCTGCCTTAGTGCGGCTGGTTGG - Intronic
1144778729 17:17797468-17797490 CCTGCCCTCCGGGGGCTGGGAGG - Exonic
1145012623 17:19378463-19378485 CGTGGCCTTGGGAGGCGGGGCGG + Intronic
1145031351 17:19507496-19507518 CCTGGCTGGGGGCGGCTGGGCGG - Intronic
1145311770 17:21704805-21704827 GCTGTCTTTGGGGTGCTGGGTGG + Intergenic
1146682680 17:34819508-34819530 CCTGCCTTTGGCTGGCTCAGCGG + Intergenic
1146906267 17:36620291-36620313 TCTGCCTTTGGGTGGGTGGGAGG + Intergenic
1146937394 17:36820729-36820751 CGTGCCTTCGGGAAGCTTGGAGG + Intergenic
1147185045 17:38708645-38708667 CCAGACTTTGGGAGGCTGAGGGG + Intronic
1147273852 17:39298367-39298389 CAGGACTTTGGGAGGCTAGGTGG - Intronic
1147470005 17:40649785-40649807 CCTGCCTTTGGGATTATGGTGGG + Intergenic
1147705228 17:42421514-42421536 CAGGCCTTTGGGAGGCGGGGAGG + Intronic
1147927414 17:43954181-43954203 CCTGCCACTGGGGGGCTGTGGGG - Intronic
1148021211 17:44555225-44555247 TCTGCCTTGGGGTGGCTGGGAGG + Intergenic
1148049122 17:44760482-44760504 CCTTCCTCTGGGAGGCAGGAGGG - Intronic
1148339864 17:46866979-46867001 CCTGCCTGTAGGAGGCCTGGGGG - Intronic
1148438098 17:47697551-47697573 ACTGCCCTTGGGAGGCTGTGAGG + Intronic
1148495864 17:48053323-48053345 ACTCCCTTTGGGAGGTGGGGTGG + Intronic
1148543564 17:48499718-48499740 CATCACTTTGGGAGGCTGAGCGG - Intergenic
1148602461 17:48904802-48904824 CCAGCACTTGGGAGGCTGAGTGG + Intergenic
1148847701 17:50538889-50538911 CGTCCCTGTGGGAGGCTGGGGGG - Exonic
1148870998 17:50658718-50658740 CCTGCATCTGGCAGGCTGTGGGG + Intronic
1148935376 17:51160856-51160878 CAGCCCTTTGGGAGGCTGAGGGG - Intronic
1149682170 17:58514328-58514350 CCTGCCTTTGGGGGCCTAGGAGG - Intronic
1149703361 17:58673814-58673836 CAGGACTTTGGGAGGGTGGGAGG - Intronic
1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG + Intergenic
1150601283 17:66653104-66653126 CCTGCCTGTGGCAGTCTGGCCGG - Intronic
1151193542 17:72415769-72415791 CCTCCCTCTGGGAGGGTGAGAGG + Intergenic
1151955526 17:77378320-77378342 TCTGCCATTGGAAAGCTGGGCGG + Intronic
1152100671 17:78300175-78300197 CAGCACTTTGGGAGGCTGGGTGG - Intergenic
1152254574 17:79230207-79230229 CCAGTCTTTGAGAGGCTTGGAGG + Intronic
1152549192 17:81020923-81020945 GCTGCATTTGGGGGGCGGGGAGG + Intergenic
1152556803 17:81057327-81057349 TCTGCCTCTGAGATGCTGGGAGG + Intronic
1152567952 17:81108527-81108549 CCTGTCTTTGGGACCGTGGGTGG + Intronic
1152648097 17:81479502-81479524 GCTGCCTGTGGGGGGCTGTGAGG - Intergenic
1152684724 17:81688388-81688410 CCTGCCTGTTGGAGGCTGACGGG + Intronic
1153045894 18:855557-855579 CCAGCACTTGGGAGGGTGGGTGG + Intergenic
1153599425 18:6764587-6764609 GCTGCCTCAGGGAGGCTGGCAGG - Intronic
1154163765 18:11998937-11998959 CCTGCCATTGGGTGGGGGGGGGG - Intronic
1154172346 18:12061027-12061049 CCTGCCAGTGGCAGGCGGGGTGG + Intergenic
1154271688 18:12925835-12925857 CATCACTTTGGGAGGCTGAGGGG + Intronic
1154277808 18:12977243-12977265 CCTGCATGTAGGAGACTGGGTGG - Intronic
1154298871 18:13175342-13175364 GCTGCCTGTGGGAGTGTGGGTGG - Intergenic
1156505299 18:37586879-37586901 CCTGCCTTTTGGAAGCTGATAGG - Intergenic
1156948499 18:42864788-42864810 CCTGCCTTGGCGAGGCTTAGTGG - Intronic
1157113962 18:44845814-44845836 CCTGCCTGGGGGATGGTGGGAGG + Intronic
1157276214 18:46312759-46312781 CCTGCCCAGGGGAGGCTGGCAGG + Intergenic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1157523850 18:48363915-48363937 CCTTCATCTGGGAGGCTGTGGGG - Intronic
1157585211 18:48796670-48796692 TCTGCCCTTGGGTGGCTGTGGGG - Intronic
1157820924 18:50767766-50767788 CCTGTCTTTGGGCCCCTGGGAGG - Intergenic
1158109863 18:53929088-53929110 GCTGGCTGTGGGAGGCTGGCTGG - Intergenic
1158192053 18:54841139-54841161 TCTGTCTTTGGGTGGCGGGGCGG + Intronic
1158220120 18:55141805-55141827 CATGCATTTGTGGGGCTGGGAGG - Intergenic
1160394984 18:78564324-78564346 CCTGCCTTAGGGAGGGGAGGAGG - Intergenic
1160717442 19:582693-582715 CCCGCCTGTGGGTCGCTGGGAGG + Intronic
1160753957 19:748112-748134 TCTGCCCCTGGGTGGCTGGGAGG + Exonic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161087468 19:2341625-2341647 GCTGCCTCAGGAAGGCTGGGAGG - Intronic
1161113062 19:2480320-2480342 CAAGACTTTGGGAGGCTTGGGGG + Intergenic
1161159344 19:2753212-2753234 CCTGGCTGTGGGAGGCAGGTGGG - Intergenic
1161324807 19:3658503-3658525 CCTGTGTCTGGGAGGCTGGAGGG - Intronic
1161486330 19:4537853-4537875 CCTGCCTTTGGCCGGGTGCGGGG - Exonic
1161548760 19:4898872-4898894 CAGCACTTTGGGAGGCTGGGTGG - Intronic
1161635593 19:5386923-5386945 CCAGCATTTGGGAGGCTGAGCGG - Intergenic
1161686645 19:5706020-5706042 CCTGGCTCCGGGAAGCTGGGTGG + Intronic
1161962190 19:7529041-7529063 CCTTCCTTTGGGGGGCCTGGGGG - Intronic
1162344708 19:10112466-10112488 CCCTCCTTCGGGAGGATGGGGGG - Intronic
1162458935 19:10802984-10803006 CCTGCCTGAGGCAGGCCGGGTGG + Intronic
1162635132 19:11962166-11962188 CCAGCACTTGGGAGGCTGAGGGG + Intronic
1163032137 19:14551701-14551723 CCTGGCTGTGTGAGGCTGTGGGG + Intronic
1163560595 19:18017170-18017192 GCTGCCTTGGGCAGGCTGGCTGG - Intergenic
1163568550 19:18066500-18066522 CCTGGCTTGGGGAGGAAGGGAGG - Intronic
1163655914 19:18544643-18544665 CTTGCCTTGGGGAGGTTGGGAGG - Intergenic
1163758774 19:19121692-19121714 CCTGCCTGGGGGACCCTGGGAGG + Intronic
1164147583 19:22521443-22521465 CCTGTCTTGGGCAGGCTGGGGGG + Intronic
1164635085 19:29785961-29785983 CATGGGTGTGGGAGGCTGGGAGG + Intergenic
1165019965 19:32916028-32916050 CAGCCCTTTGGGAGGCTGAGGGG + Intronic
1165249630 19:34519364-34519386 CAGCACTTTGGGAGGCTGGGTGG - Intergenic
1165318078 19:35068771-35068793 CCTGCCCTGGGAAGTCTGGGGGG + Intergenic
1165320864 19:35084408-35084430 TCTGGCTTTGGGAGGAGGGGTGG - Intergenic
1165718626 19:38063289-38063311 CCTGCCGTGGGAAGGCTGGCAGG - Intronic
1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG + Intergenic
1166053645 19:40275748-40275770 CAGCACTTTGGGAGGCTGGGGGG + Intronic
1166352075 19:42203989-42204011 CCTGTCCCTGGGAGGGTGGGGGG + Intronic
1166409160 19:42544844-42544866 CAGCACTTTGGGAGGCTGGGGGG + Intronic
1166565240 19:43760984-43761006 CCAGCCTTTGGGAGGCTGATGGG - Intergenic
1166664291 19:44669545-44669567 CCTGTGTGTGTGAGGCTGGGAGG - Intronic
1166847403 19:45737421-45737443 CAGCACTTTGGGAGGCTGGGTGG - Intronic
1167010363 19:46803111-46803133 CCTGCCCTTGGGGGTCTGAGGGG + Intergenic
1167419309 19:49393967-49393989 CTTGCCTTAGGGATGCAGGGAGG + Intronic
1167515128 19:49918879-49918901 CAGCACTTTGGGAGGCTGGGGGG + Intronic
1167531952 19:50023427-50023449 CAGGACTTTGGGAGGCTGAGGGG - Intronic
1167537444 19:50063772-50063794 CAGCACTTTGGGAGGCTGGGCGG + Intergenic
1168153362 19:54460610-54460632 CCTGAGGTGGGGAGGCTGGGAGG + Intronic
1168287606 19:55342305-55342327 CCTGACGCTGGGAGGCTGGACGG + Exonic
1168568030 19:57440774-57440796 CCTGAGTTTGGGTGTCTGGGAGG + Intronic
1168725375 19:58578349-58578371 CATGCCTTTGGGGGGCTCAGAGG - Intergenic
925149573 2:1606016-1606038 CCTGTCTCTGGGAGGATGTGTGG + Intergenic
925217533 2:2110457-2110479 CCTGGCTTTGGGAAACTTGGAGG - Intronic
925382073 2:3435511-3435533 ACTGCTTTTGGGAGGTGGGGAGG - Intronic
925735067 2:6956737-6956759 CATGCTTCTGGGAGGCTTGGTGG + Intronic
925809241 2:7682725-7682747 CCTGCATGTGGGTGGGTGGGTGG + Intergenic
926076586 2:9948016-9948038 CAGCACTTTGGGAGGCTGGGAGG + Intergenic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926205480 2:10832168-10832190 CCTGGGGTTGGGATGCTGGGTGG - Intronic
926282272 2:11459629-11459651 CAGGACTTTGGGAGGCGGGGTGG + Intronic
927699422 2:25258475-25258497 CCTGCAGTAGGTAGGCTGGGGGG + Intronic
927904122 2:26845212-26845234 CCGGCCTTCTGGAGGCTGGCAGG + Intergenic
928498218 2:31857823-31857845 CCTGCCTTTGGGAGGCGGAGCGG + Intergenic
928578723 2:32683235-32683257 CAGCACTTTGGGAGGCTGGGTGG - Intronic
928684652 2:33736012-33736034 CAGCACTTTGGGAGGCTGGGAGG + Intergenic
931252381 2:60544742-60544764 CTTGCCTTTCGGGAGCTGGGTGG + Intronic
931275423 2:60739956-60739978 CCAGCATTTGGGAGGCTGAGTGG - Intergenic
931451099 2:62368446-62368468 GCTTGCTTTGGGAGGCTGTGTGG + Intergenic
931729370 2:65139450-65139472 CAGCACTTTGGGAGGCTGGGCGG + Intergenic
931758104 2:65392290-65392312 CCTGTGGTTGGGAGGCTGAGTGG - Intronic
931782014 2:65587045-65587067 CCTGCCTTTGGGAAGCTTCAGGG - Intergenic
932577265 2:72969642-72969664 CCAGCATTTTGGAGGCTGAGGGG - Intronic
932699567 2:73984190-73984212 CCCTCCTCTGGGAGGCAGGGCGG + Intergenic
933706196 2:85292364-85292386 GCTGCCTTTGGGAAGTGGGGAGG + Intronic
933763645 2:85692900-85692922 CCAGCACTTTGGAGGCTGGGAGG + Intronic
934066049 2:88343013-88343035 GGTGCCAGTGGGAGGCTGGGAGG - Intergenic
935298290 2:101669846-101669868 CAGCACTTTGGGAGGCTGGGTGG + Intergenic
935571137 2:104661135-104661157 CCTGCCTCTGGGAGGGTGGAGGG - Intergenic
935610833 2:105024031-105024053 CCTGCCTTTGAGAGGCTTATTGG - Intergenic
935678552 2:105617072-105617094 GCTACCCTTGGGAGGGTGGGAGG - Intergenic
936009941 2:108919123-108919145 CCGGTGTCTGGGAGGCTGGGAGG + Intronic
936230181 2:110693594-110693616 CATCACTTTGGGAGGCTGAGGGG + Intergenic
937043355 2:118837418-118837440 TCTGCCTTTGGCAGGCAGGTGGG - Intergenic
937126486 2:119478042-119478064 CCTGACTTTGAAAGGCTGGTGGG + Intronic
937447456 2:121970938-121970960 CCTGACTGTGGGTGGGTGGGTGG + Intergenic
937465584 2:122130769-122130791 CCTGTCTTTGGGACTCAGGGTGG + Intergenic
937615025 2:123911878-123911900 CCCAACTTTGGGAGGCTGAGGGG + Intergenic
937669355 2:124521926-124521948 ACTGCCTTTGGGAGGAAGTGGGG + Intronic
938241059 2:129742574-129742596 CCTGTGCTAGGGAGGCTGGGAGG - Intergenic
938278813 2:130050665-130050687 CCTGCCTCTCAGAGGGTGGGTGG - Intergenic
938501165 2:131831873-131831895 GCTGCCTTAGGGAGGCCGGAAGG - Intergenic
938501682 2:131833957-131833979 CCTGCCTTTGCCACGCTTGGCGG - Intergenic
938757474 2:134393968-134393990 CCTAACTTTGAGAGGCTGGCAGG + Intronic
938876229 2:135533628-135533650 CAGCACTTTGGGAGGCTGGGCGG + Intronic
939317999 2:140577670-140577692 CAGCACTTTGGGAGGCTGGGGGG - Intronic
939760491 2:146171381-146171403 CCTACCATTTGGATGCTGGGAGG + Intergenic
941715187 2:168756153-168756175 CCTGCCTCTATGAGGATGGGAGG + Intronic
942281638 2:174370296-174370318 CCTCACTTTGGGAGGCTGAGAGG - Intronic
942953165 2:181744880-181744902 CAGGCCTTTGGGAGGCCGAGTGG - Intergenic
944667933 2:201972329-201972351 CCTGTCCCTGGGAGGCAGGGAGG + Intergenic
944762692 2:202833331-202833353 CAGGACTTTGGGAGGCTGTGGGG + Intronic
944789039 2:203105103-203105125 CCAGACTTTGGGAGGCTGAGGGG - Intronic
944982523 2:205137784-205137806 CTAGCCTTTTGGAGGGTGGGAGG - Intronic
944996619 2:205301967-205301989 CAGTACTTTGGGAGGCTGGGAGG + Intronic
945046907 2:205789649-205789671 CCGGCCTCTGGGAGGCAGAGGGG - Intronic
945254164 2:207790208-207790230 CCAGCTGTTGGGAGGCTGGCAGG - Intergenic
946334787 2:219029491-219029513 CCTGCCTTTGGGACGCTGGTGGG - Exonic
947593539 2:231397647-231397669 GCCCCCCTTGGGAGGCTGGGTGG - Intronic
947799743 2:232921325-232921347 CCTGCCTGCTGCAGGCTGGGAGG + Intronic
947830661 2:233139335-233139357 CCTGCATTTGGGCTGCTAGGAGG + Intronic
947976093 2:234367757-234367779 CAGCCCTTTGGGAGGCTGAGGGG - Intergenic
948078254 2:235183880-235183902 ACTGCATTTGGGAGGCAAGGGGG - Intergenic
948989152 2:241543045-241543067 GCTGCCTCCAGGAGGCTGGGCGG - Intergenic
1168981702 20:2009529-2009551 CCTACCTATGATAGGCTGGGGGG + Intergenic
1169155205 20:3323737-3323759 CCTGCTCTGGGGAGGCTGAGTGG + Intronic
1169847022 20:10005042-10005064 CCTGCCATGGGGAGGGTGAGGGG + Intronic
1169942177 20:10949086-10949108 CCGCACTTTGGGAGGCTGAGCGG + Intergenic
1170449432 20:16466988-16467010 CATGCTTTTGGGAGGCAGAGAGG + Intronic
1172172504 20:32947817-32947839 CACGCCTTTGGGAGGCAGGTGGG + Intronic
1172894527 20:38291237-38291259 GCTGACTCAGGGAGGCTGGGAGG + Intronic
1172939313 20:38643816-38643838 CTTGCCTTTGGGGAGCTTGGGGG - Exonic
1173657074 20:44706784-44706806 CCTGCCTTTGCCATGGTGGGAGG - Intergenic
1175182899 20:57161055-57161077 CCTCCACTTGGGAGGCTGAGAGG - Intergenic
1175822408 20:61917473-61917495 CCTTCCTGTGGGAGGCTCGCAGG + Intronic
1178375507 21:32064475-32064497 GTTAGCTTTGGGAGGCTGGGGGG - Intergenic
1178678844 21:34654441-34654463 CCAGCGTTTGGGAGGCTGGCAGG + Intergenic
1178892955 21:36535140-36535162 CAGCCCTTTGGGAGGCTGAGGGG + Intronic
1178968510 21:37147972-37147994 CCACACTTTGGGAGGCTGAGGGG - Intronic
1179569019 21:42267167-42267189 CCGGCCTCTGTGAGCCTGGGTGG - Intronic
1180027800 21:45178272-45178294 CCTGGCTTGGGAAGGCTGGAGGG + Intronic
1180859757 22:19071043-19071065 CCAGCCTTTGGTAAGCTGGGGGG + Intronic
1180999999 22:19983582-19983604 CCTGCCTGTGGGAGAGGGGGAGG - Intronic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181477188 22:23176000-23176022 CCTGCCTGCGTGAGGCTGGGTGG - Intergenic
1182015081 22:27032572-27032594 CGTGCCTGTGGGAGGCGGGCCGG + Intergenic
1182287654 22:29257878-29257900 CATGCCTTAGGGAGCGTGGGAGG - Intronic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1182622541 22:31625929-31625951 TCTGCCTCTGCGAGGCTGGTTGG + Exonic
1183051483 22:35265475-35265497 CCAGCGTATGGGATGCTGGGAGG - Exonic
1183368429 22:37419189-37419211 TCTGCCTTTGGGAGGGGGTGAGG - Intronic
1183524258 22:38314485-38314507 CCAGGCTGTGGGAGCCTGGGGGG - Intronic
1183690036 22:39383217-39383239 CCTCCCTATGGGAGGCAGAGCGG + Exonic
1184103958 22:42356728-42356750 CCTGCCTTTCCGAGGCCGTGTGG + Intergenic
1184647292 22:45903264-45903286 CCAGCCTTTGGAAGGCATGGAGG + Intergenic
1184661875 22:45969204-45969226 CCTGGCTGTGGCAGGGTGGGGGG - Intronic
1184737143 22:46405978-46406000 CCTCCCTGTGGAAGTCTGGGTGG - Intronic
1184999776 22:48238314-48238336 CCTGACTTGGCGGGGCTGGGTGG - Intergenic
1185035579 22:48475045-48475067 CCGGCCTGTGGGAGGCAGAGGGG - Intergenic
1185052207 22:48559763-48559785 CCTGCCTTTGGGGAGCAGAGGGG + Intronic
1185329580 22:50246146-50246168 CCTGAGATTGGGAGGTTGGGAGG - Intronic
951464960 3:22991041-22991063 CCAGCCTATGGGAGTGTGGGAGG + Intergenic
951525789 3:23651341-23651363 CAGGACTGTGGGAGGCTGGGAGG + Intergenic
952395383 3:32916439-32916461 CCAGCGTTCGAGAGGCTGGGTGG + Intergenic
953422014 3:42761504-42761526 CCTGCCATTGTGAAGCTGGTGGG - Intronic
953431356 3:42843316-42843338 CAGCACTTTGGGAGGCTGGGGGG - Intronic
953863485 3:46564616-46564638 ACTCCCACTGGGAGGCTGGGAGG + Intronic
954193586 3:48982644-48982666 CCTGCCTTTGGGAGTGTGGAGGG + Intronic
954313190 3:49786186-49786208 CCAGCATCTGGGAGGCTCGGCGG + Exonic
954574475 3:51668193-51668215 CCTGTCTTGGGCAGGCTGGGGGG - Exonic
955229194 3:57084044-57084066 AGTCCCTTTGGGAGGCTGAGGGG + Intergenic
955433872 3:58878761-58878783 CATCACTTTGGGAGGCTGAGGGG + Intronic
956286302 3:67613977-67613999 CCAGGCTTTGGGAGGGAGGGAGG + Intronic
957424943 3:80025329-80025351 CGGCACTTTGGGAGGCTGGGGGG - Intergenic
958035896 3:88170395-88170417 CAGCACTTTGGGAGGCTGGGGGG + Intergenic
958482308 3:94658358-94658380 CCTGCCTTGGAGTAGCTGGGAGG - Intergenic
958595967 3:96223246-96223268 CAACACTTTGGGAGGCTGGGAGG - Intergenic
960561809 3:119092576-119092598 CCGCACTTTGGGAGGCTGAGAGG - Intronic
960797390 3:121501729-121501751 CAGAACTTTGGGAGGCTGGGTGG + Intronic
960906004 3:122602228-122602250 ACTGCCTTTGGGAGACTGAAGGG + Intronic
961510164 3:127395946-127395968 CCTGCCTTTTGCAGGCAGAGAGG - Intergenic
961775838 3:129284654-129284676 CAGCACTTTGGGAGGCTGGGAGG + Intronic
962954067 3:140248061-140248083 CCTGCCCTTGGATGCCTGGGAGG - Intronic
963249657 3:143091446-143091468 CCTGCCTTTTGCAGACTGAGTGG + Intergenic
963982602 3:151556696-151556718 CCAGCCTTTGAGAGGATGGTAGG + Intergenic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
964947196 3:162240438-162240460 CAGCACTTTGGGAGGCTGGGAGG + Intergenic
965261414 3:166489992-166490014 CCGCACTTTGGGAGGCTGAGGGG - Intergenic
965656331 3:170989196-170989218 CCTCCCTTTGTGAGACTGGACGG + Intergenic
965695022 3:171399344-171399366 CCTGCCTCTGGGAGGGAGGGAGG - Intronic
966679926 3:182631194-182631216 CCTGGCTTTGGGAGCCTGCTTGG - Intergenic
966711136 3:182974001-182974023 CACTCCTTTGGGAGGCTGAGAGG + Intronic
967189884 3:186975961-186975983 GTTTCCTATGGGAGGCTGGGAGG - Intronic
969140730 4:5069280-5069302 CCTGCCATTGTGAACCTGGGAGG - Intronic
969721672 4:8895665-8895687 CCTGGCTGTGGGACTCTGGGTGG - Intergenic
970451219 4:16168355-16168377 CAGGACTTTGGCAGGCTGGGTGG - Intronic
971508830 4:27398872-27398894 CCTGCATTTAGGCAGCTGGGAGG + Intergenic
971867463 4:32190899-32190921 CAGCCCTTTGGGAGGCTGAGTGG + Intergenic
972340217 4:38146337-38146359 CCTGCCTTTTTGGGGGTGGGTGG - Intergenic
973111238 4:46400737-46400759 CATCACTTTGGGAGGCTGAGTGG - Intronic
973685245 4:53363395-53363417 CATCACTTTGGGAGGCTGAGGGG - Intronic
974797923 4:66778416-66778438 CAGCCCTTTGGGAGGCTGAGGGG + Intergenic
977089529 4:92652720-92652742 CAGCACTTTGGGAGGCTGGGGGG + Intronic
977566596 4:98587000-98587022 CCGGCAGTTGGGAGGCAGGGTGG + Intronic
978603735 4:110456231-110456253 CAGCACTTTGGGAGGCTGGGAGG - Intronic
978976226 4:114877698-114877720 CAGCACTTTGGGAGGCTGGGCGG + Intronic
979238466 4:118427086-118427108 CTTGACTTTGATAGGCTGGGTGG + Intergenic
980173564 4:129318109-129318131 CAGCACTTTGGGAGGCTGGGGGG - Intergenic
980342675 4:131570302-131570324 CCTGCCTTAGAGAGGAAGGGAGG - Intergenic
980857078 4:138453362-138453384 CCTGACTTTGGGAGACACGGAGG - Intergenic
982166063 4:152614562-152614584 CCTGCCCTGGGGAGGGTGTGAGG - Intergenic
982700636 4:158657293-158657315 CTGCACTTTGGGAGGCTGGGGGG - Intergenic
983277712 4:165638391-165638413 CAGCTCTTTGGGAGGCTGGGTGG - Intergenic
984099513 4:175468350-175468372 CATTACTTTGGGAGGCTGAGGGG - Intergenic
984438550 4:179735266-179735288 CCTGTCATTGGGAAGCAGGGAGG - Intergenic
985015521 4:185629807-185629829 CCAGCAGTTGGGAGGCTGAGGGG - Intronic
985526648 5:406383-406405 ACTCCATGTGGGAGGCTGGGAGG + Intronic
985963344 5:3320433-3320455 CCAGCCTTCAGGAGGCAGGGTGG + Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
985972476 5:3389330-3389352 TCTTCCTTTGGGAGGCGTGGTGG - Intergenic
986058564 5:4164268-4164290 GCTGCCTGTGGGTGGGTGGGTGG - Intergenic
986377553 5:7148133-7148155 TTTGGCTTGGGGAGGCTGGGAGG - Intergenic
988508185 5:31842465-31842487 AGTGCCTTTGGAAGGCTGTGTGG - Intronic
989058372 5:37386059-37386081 CAGGACTTTGGGAGGCTGAGGGG - Intronic
989184531 5:38610390-38610412 CTGCCCTTTGGGAGGCTGAGTGG + Intergenic
989377758 5:40782847-40782869 CCTTCTTTTGGGTGGTTGGGGGG - Intronic
989568961 5:42927274-42927296 CATGCAGTGGGGAGGCTGGGGGG + Intergenic
990567344 5:57042767-57042789 CCTGCATTAGGAAGGCTGGCAGG - Intergenic
991041650 5:62182514-62182536 CCTGCCCATGGGGGCCTGGGAGG - Intergenic
991940590 5:71848586-71848608 CAGGTCTTTGGGAGGCTGAGGGG - Intergenic
992167688 5:74071197-74071219 CCTGTCTTGGGGGGGCGGGGGGG - Intergenic
992432232 5:76720324-76720346 CCAGCACTTGGGAGACTGGGAGG + Intronic
992794376 5:80242502-80242524 CCAGCATTTGGGAGGCGAGGCGG + Intronic
994105888 5:95948186-95948208 CAGCACTTTGGGAGGCTGGGCGG + Intronic
997650180 5:135511485-135511507 CAGCCCTTTGGGAGGCTGAGGGG + Intergenic
997910135 5:137863550-137863572 TGAGCCTTTGGGAGGCTAGGCGG + Intergenic
997932033 5:138080712-138080734 CAGCCCTTTGGGAGGCTGAGTGG - Intergenic
998066543 5:139163869-139163891 CAGCACTTTGGGAGGCTGGGCGG + Intronic
998165397 5:139839783-139839805 CCTGCGGTGGGGTGGCTGGGGGG + Intronic
1000287482 5:159839133-159839155 CAGCACTTTGGGAGGCTGGGTGG + Intergenic
1000692498 5:164341078-164341100 CCTGCCCTTGGAAGGATGAGAGG - Intergenic
1000805774 5:165789556-165789578 CATCACTTTGGGAGGCCGGGCGG - Intergenic
1001478370 5:172067103-172067125 CAGCACTTTGGGAGGCTGGGTGG + Intronic
1001582178 5:172806320-172806342 CCAGCCTCTGGGAAGCTGTGTGG + Intergenic
1001920169 5:175593684-175593706 CAGCACTTTGGGAGGCTGGGGGG + Intergenic
1001948801 5:175801553-175801575 CCTGCCATTGAGAAGCTGTGTGG + Intronic
1002008713 5:176258841-176258863 ACTGTCTTTGGGAGGTTGGTGGG + Intronic
1002122042 5:177012447-177012469 CGGCACTTTGGGAGGCTGGGTGG + Intronic
1002218009 5:177653411-177653433 GCTGTCTTTGGGAGGTTGGTGGG - Intergenic
1002382256 5:178839288-178839310 CCTGCCTGAGGCAGGCTGGAGGG - Intergenic
1002430360 5:179199711-179199733 CCAGACTCAGGGAGGCTGGGAGG - Intronic
1002524027 5:179805989-179806011 CCGGCCTGTGGGAGGGAGGGAGG - Intronic
1002597668 5:180334793-180334815 CCTGCCCTTGGAGGCCTGGGAGG + Intronic
1002648384 5:180673706-180673728 CCTGCCTGAGGCGGGCTGGGGGG + Intergenic
1002738888 5:181419055-181419077 CTTGACTTTGATAGGCTGGGTGG + Intergenic
1002938768 6:1698087-1698109 TCTGGTGTTGGGAGGCTGGGCGG - Intronic
1003630404 6:7781459-7781481 CCTGGCTGTGGGAGGCAGTGTGG + Intronic
1003945351 6:11070442-11070464 CAGCACTTTGGGAGGCTGGGAGG + Intergenic
1004335850 6:14763804-14763826 CCAGCCTGTGGGAGACAGGGTGG - Intergenic
1005828610 6:29652301-29652323 CCAGTCCTGGGGAGGCTGGGAGG - Intergenic
1006011035 6:31043082-31043104 TCTGCCTGTGTGAGGCTGGAAGG - Intergenic
1006079270 6:31555905-31555927 CAGCACTTTGGGAGGCTGGGGGG - Intronic
1006258038 6:32846569-32846591 CAGCCCTTTGGGAGGCTGAGGGG + Intronic
1006573175 6:35022131-35022153 CCTGACTTTCTCAGGCTGGGTGG - Intronic
1006984903 6:38169669-38169691 ACAGCCTTGGGGAGGCTGAGGGG + Exonic
1007341268 6:41192764-41192786 TCTGCCCTCAGGAGGCTGGGAGG + Intronic
1007633829 6:43286472-43286494 CCCGCCTGTGGGAGGGAGGGAGG + Exonic
1007746549 6:44046796-44046818 CCTTCCTTTGGCTGGCTGTGAGG - Intergenic
1007770897 6:44191668-44191690 CAGCACTTTGGGAGGCTGGGGGG - Intergenic
1011437757 6:87357070-87357092 ACTGTCTCTGGGAGGCAGGGAGG - Intronic
1012458491 6:99433102-99433124 CATGCTGTTGGGAGGCTGAGTGG - Exonic
1013039855 6:106422581-106422603 CAGCACTTTGGGAGGCTGGGAGG - Intergenic
1013168757 6:107617390-107617412 CCTGCCTTTTAGAGGGTGGCTGG - Intronic
1013371405 6:109473832-109473854 CAGCGCTTTGGGAGGCTGGGAGG + Intronic
1014210499 6:118703451-118703473 CAGCACTTTGGGAGGCTGGGTGG - Intronic
1015417961 6:132971092-132971114 CAGCCCTTTGGGAGGCTGAGGGG - Intergenic
1016811579 6:148266215-148266237 CAGCACTTTGGGAGGCTGGGTGG - Intergenic
1017156326 6:151325600-151325622 CCCGCGTGTGGGTGGCTGGGTGG + Intronic
1019243996 6:170694607-170694629 CTTGACTTTGATAGGCTGGGTGG + Intergenic
1019328369 7:450794-450816 CCTGCCTGTGGGTGGGTTGGGGG - Intergenic
1019427867 7:985872-985894 CCTGCCTCTGGGAAGCCAGGAGG - Intronic
1019544151 7:1565155-1565177 CCTGCCCGAGGGAGGTTGGGTGG + Intergenic
1019701543 7:2476848-2476870 CCTGCCCTTGGCCGGATGGGAGG - Intronic
1020349977 7:7208815-7208837 CCTGCCTGTGGGAGTGAGGGTGG + Intronic
1021054996 7:16036130-16036152 CCTGCCTTGGGCAGGCACGGTGG + Intergenic
1021602674 7:22379845-22379867 CATGCCTTTTGGAGGCTGAGAGG + Intergenic
1021613763 7:22481986-22482008 CCTGCTCTGGGGAGACTGGGTGG + Intronic
1022988803 7:35686792-35686814 CAGCACTTTGGGAGGCTGGGGGG + Intronic
1023723345 7:43117426-43117448 CCTGCCTTTGGTGGGGCGGGTGG - Intronic
1023926475 7:44673533-44673555 CCTGCCCTTGGAAGGCTAGGAGG + Intronic
1025218369 7:57080756-57080778 TCTTTCTTTGGGAGGCTGAGGGG + Intergenic
1025262461 7:57427777-57427799 CCTGCCCTAGTGACGCTGGGTGG + Intergenic
1025629288 7:63254375-63254397 TCTTTCTTTGGGAGGCTGAGGGG + Intergenic
1025652977 7:63489705-63489727 TCTTTCTTTGGGAGGCTGAGGGG - Intergenic
1026117962 7:67512118-67512140 CAGGACTTTGGGAGGCTGAGAGG - Intergenic
1027126016 7:75557285-75557307 CAGGACTTTGGGAGGCTGAGGGG - Intronic
1028244050 7:88454526-88454548 CATCACTTTGGGAGGCTGAGGGG - Intergenic
1029516996 7:101030847-101030869 CCAGCACTTTGGAGGCTGGGGGG - Intronic
1030278391 7:107744074-107744096 ACTGCCTTCCGGAGGCCGGGAGG - Exonic
1030451351 7:109716756-109716778 CCTGCCTTTGGAAGGCTACTGGG - Intergenic
1030969943 7:116044747-116044769 GCTGCCTTTCTCAGGCTGGGAGG + Intronic
1030996650 7:116367526-116367548 CCTGGCTTTGGGTGACAGGGTGG + Intronic
1032475957 7:132211616-132211638 ACTGCCGCAGGGAGGCTGGGAGG + Intronic
1033192366 7:139293316-139293338 ACTCCTTTTGGGATGCTGGGTGG + Exonic
1033264593 7:139873864-139873886 CCTGCCTTTGTTTGGCTTGGTGG - Intronic
1033650552 7:143339513-143339535 GCTGCATTTGGAAGGCTGGTAGG + Exonic
1033741676 7:144280884-144280906 TCTGCCTTTCAGAGGCAGGGAGG - Intergenic
1033752225 7:144368730-144368752 TCTGCCTTTCAGAGGCAGGGAGG + Intronic
1033850392 7:145488142-145488164 TCCCCTTTTGGGAGGCTGGGAGG + Intergenic
1033951796 7:146793715-146793737 CCAGCCTTTGGGCAGCTGTGGGG + Intronic
1034139684 7:148803970-148803992 CAGCACTTTGGGAGGCTGGGCGG + Intergenic
1034338553 7:150338526-150338548 CTGGGCTTTGGGAGCCTGGGAGG - Intronic
1034627368 7:152503703-152503725 CCTGCCAGGGGGAGGCAGGGAGG + Intergenic
1034824622 7:154250388-154250410 CCTGCATTTGGGAGGGCGTGTGG + Intronic
1035504129 8:113553-113575 CTTGACTTTGATAGGCTGGGTGG - Intergenic
1036182620 8:6598230-6598252 CCAGCCTTGGGGAGCCAGGGTGG + Intronic
1037822433 8:22141487-22141509 CCGGCCTTTGGGACGTGGGGAGG + Exonic
1038241959 8:25818251-25818273 CCTGCCTTGGGCTGGCAGGGTGG + Intergenic
1038496697 8:28008413-28008435 CATGCCTCTGGGAGGCAGGGAGG - Intergenic
1039740509 8:40378691-40378713 CAGCACTTTGGGAGGCTGGGTGG + Intergenic
1042199633 8:66268907-66268929 ACTGAGTTTGGAAGGCTGGGTGG - Intergenic
1042451877 8:68956892-68956914 CCAGCCCTTGGGAGGCCGAGGGG - Intergenic
1042928073 8:73987312-73987334 CACCCCTTTGGGAGGCTGAGGGG + Intergenic
1043064369 8:75548231-75548253 CAGCCCTTTGGGAGGCTGAGAGG - Intronic
1043160500 8:76840843-76840865 GCTGGATTTGGGAGGCTGGAGGG - Intronic
1043327027 8:79064964-79064986 CCTGCCTTTGGGAGACTCAGAGG + Intergenic
1045425935 8:102065728-102065750 CAGCACTTTGGGAGGCTGGGAGG + Intronic
1046029418 8:108765654-108765676 CAGCACTTTGGGAGGCTGGGAGG - Intronic
1046053337 8:109049870-109049892 CAGCCCTTTGGGAGGCTGAGCGG + Intergenic
1047361315 8:124171993-124172015 CCTGAGTTTGGGCGGCGGGGGGG + Intergenic
1047450239 8:124958900-124958922 CCACCCTTTGGGAGGCTGAGAGG - Intergenic
1047929504 8:129712824-129712846 CCTGCCTTGGGGCAGCAGGGAGG + Intergenic
1048233626 8:132668688-132668710 CAGCCCTTTGGGAGGCTGAGGGG - Intronic
1048320611 8:133396958-133396980 CAGCACTTTGGGAGGCTGGGAGG + Intergenic
1049129490 8:140825249-140825271 CCTGAGTTGGGGATGCTGGGTGG - Intronic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049438637 8:142599151-142599173 CCTGGCATGGGGAGGCTGTGTGG + Intergenic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1049830535 8:144698881-144698903 CCTCCCTTGGGGGGGTTGGGGGG + Intergenic
1050459320 9:5863660-5863682 CCTGCCCTTGGGAAGCTGGGTGG + Intergenic
1053430963 9:38041478-38041500 CCTGCATTTGCTAGGCTGGATGG + Intronic
1053527770 9:38847148-38847170 CCTGCATTTGGGAGGAAGCGAGG - Intergenic
1054199992 9:62071576-62071598 CCTGCATTTGGGAGGAAGCGAGG - Intergenic
1054638363 9:67516781-67516803 CCTGCATTTGGGAGGAAGCGAGG + Intergenic
1054736822 9:68761575-68761597 CCTTCCTTTTGGAGGCTCTGGGG + Intronic
1055472087 9:76621932-76621954 CAGGACTTTGGGAGGCTGAGTGG - Intronic
1055804954 9:80082328-80082350 CATGCCTTTGGGAGGTTCTGAGG - Intergenic
1056659015 9:88531282-88531304 CCTGTCTTGGGGAGGTAGGGAGG + Intergenic
1056820316 9:89836954-89836976 CCTGCCTCTGGCGGGGTGGGTGG + Intergenic
1056941722 9:90961796-90961818 CCTGGCCTTGGGTGTCTGGGTGG + Intergenic
1057204745 9:93164466-93164488 CCAGACATTTGGAGGCTGGGAGG + Intergenic
1057597038 9:96423471-96423493 CAGTGCTTTGGGAGGCTGGGGGG - Intergenic
1057696532 9:97326675-97326697 CCTGCCTTCTGGAGTCTGGTTGG - Intronic
1057741048 9:97711428-97711450 CCTTTCTTTGTCAGGCTGGGTGG - Intergenic
1057998708 9:99844012-99844034 CACCACTTTGGGAGGCTGGGGGG - Intronic
1058071653 9:100607424-100607446 CCAGCATTTAGGAGGCAGGGGGG + Intergenic
1058452619 9:105111381-105111403 CAGCACTTTGGGAGGCTGGGTGG - Intergenic
1059540425 9:115124913-115124935 CCTACCATTGGAAGGCTGTGGGG - Intergenic
1060343320 9:122795843-122795865 CCTGACTTTGGGAGGCAAGGTGG + Intergenic
1060491838 9:124090945-124090967 CCTGCCTTTGGGAGTGCAGGTGG + Intergenic
1060685313 9:125605645-125605667 TCTGCCTCTGGGTGGCAGGGTGG - Intronic
1061422935 9:130481965-130481987 CCTGCCCTTGGGAGCCAGCGCGG + Intronic
1061701421 9:132419015-132419037 CGTGCCTTTGAGTGACTGGGTGG - Intronic
1062271385 9:135711343-135711365 GCTGCCTTTGGCCAGCTGGGGGG - Intronic
1062340186 9:136090667-136090689 CCTGACTATGGAGGGCTGGGGGG + Intronic
1062361147 9:136188798-136188820 CAGCACTTTGGGAGGCTGGGGGG + Intergenic
1062383015 9:136296665-136296687 CCTGCCCTTGAGCGGGTGGGTGG - Intronic
1062399643 9:136366747-136366769 CCTCACTTGGGGAAGCTGGGAGG + Intronic
1062530209 9:136996381-136996403 CCTTCCTGTGGGTGGCTAGGGGG - Intronic
1062699434 9:137891290-137891312 TCTGGATCTGGGAGGCTGGGCGG + Intronic
1203604185 Un_KI270748v1:43831-43853 CTTGACTTTGATAGGCTGGGTGG + Intergenic
1187020301 X:15374555-15374577 CCAGAGGTTGGGAGGCTGGGAGG + Intronic
1187856159 X:23637514-23637536 GGTGCCTATGGCAGGCTGGGTGG - Intergenic
1188520217 X:31030271-31030293 GCTGCCCCTGGGAGGCTAGGGGG + Intergenic
1190526532 X:51333737-51333759 CCTGCTTTTGGGCGGGGGGGGGG + Intronic
1192146331 X:68685439-68685461 CCTGACTTGGGGATGGTGGGGGG - Intronic
1192557959 X:72105369-72105391 CCTGGCTTTGGGCTGCAGGGAGG - Intergenic
1193602840 X:83529547-83529569 CCTGCCTTTGGGAAAATGGTTGG + Intergenic
1194264005 X:91733633-91733655 CCAGCTTTGGGGAGTCTGGGAGG - Intergenic
1195065278 X:101233924-101233946 CCTGCCTTTGAGAGGCAGAGAGG - Intronic
1196387183 X:115170298-115170320 CCTGTCTGTGAGAGGCTGTGAGG + Exonic
1197873700 X:131083295-131083317 CCTGGCTATTGGAGACTGGGTGG + Intronic
1197896075 X:131317174-131317196 CCAGTCTTTGGGATGGTGGGAGG + Intronic
1198628341 X:138604923-138604945 CAGCACTTTGGGAGGCTGGGGGG + Intergenic
1199526061 X:148793237-148793259 CCAGTCTTTGGCAGGGTGGGTGG + Intronic
1200077398 X:153557973-153557995 CTTGGCTTTGGGGGGCGGGGTGG + Intronic
1200135909 X:153874573-153874595 CCTGGCGTTGGGAGGCAGTGAGG - Intronic
1202386240 Y:24328878-24328900 CTTGACTTTGATAGGCTGGGTGG + Intergenic
1202484546 Y:25341250-25341272 CTTGACTTTGATAGGCTGGGTGG - Intergenic
1202581428 Y:26385084-26385106 CAGCACTTTGGGAGGCTGGGTGG + Intergenic