ID: 1140476210

View in Genome Browser
Species Human (GRCh38)
Location 16:75240334-75240356
Sequence GACACAGATGTCCCGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476206_1140476210 10 Left 1140476206 16:75240301-75240323 CCTGAGGCTTGGAGGGGAGCACC 0: 1
1: 0
2: 2
3: 25
4: 343
Right 1140476210 16:75240334-75240356 GACACAGATGTCCCGCAGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 127
1140476200_1140476210 30 Left 1140476200 16:75240281-75240303 CCAGGCATTTGAGGGGCAGGCCT 0: 1
1: 0
2: 1
3: 16
4: 208
Right 1140476210 16:75240334-75240356 GACACAGATGTCCCGCAGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476210 Original CRISPR GACACAGATGTCCCGCAGCC AGG Intronic
900575931 1:3382444-3382466 GACACAGCTGTGCCCCAGGCAGG - Intronic
902245860 1:15119975-15119997 GACACAGATGTACGGGAGCCAGG - Intergenic
903004378 1:20289038-20289060 GACACAGATTTCCAGGAACCTGG - Intergenic
903478856 1:23638612-23638634 GACAAAGACGTCCAGCTGCCTGG + Intronic
911104188 1:94117305-94117327 GACAAACATGACCCGGAGCCTGG + Intronic
915495267 1:156278030-156278052 GACGCAGAGCTCACGCAGCCTGG + Exonic
918119641 1:181527235-181527257 CAGACAGCTGTCCAGCAGCCAGG - Intronic
920056476 1:203196638-203196660 AACACAGCTGTCCCACATCCAGG - Intergenic
920891721 1:209993430-209993452 TACCCAGATGTCCCGCAGCTTGG - Intronic
921327737 1:214004181-214004203 GTCACATCTGTGCCGCAGCCTGG - Intronic
1064106281 10:12503413-12503435 GTCACAGCTGTCTGGCAGCCTGG + Intronic
1069624807 10:69861077-69861099 GGCTCAGATGCCCAGCAGCCGGG - Intronic
1070307700 10:75249423-75249445 GACACAGCTGTCTCCCAGGCTGG + Intergenic
1070660916 10:78304643-78304665 GAGACAGATGTGCCAGAGCCAGG - Intergenic
1073434948 10:103510691-103510713 GACACAGATGTTTCTCAGGCAGG - Intronic
1075075428 10:119347166-119347188 GACACAGATTGTCCTCAGCCAGG + Intronic
1075833202 10:125428548-125428570 GACTCAGATGTCCCACAGTGGGG + Intergenic
1076591869 10:131588962-131588984 GAGACAGCTGTCCCACAGGCAGG - Intergenic
1083252647 11:61478152-61478174 GAGACAGGTGTCCAGCAGGCTGG - Intronic
1084413196 11:69015589-69015611 GACAGAGATGTCTCCCTGCCAGG + Intergenic
1085269918 11:75264189-75264211 GACTCAGAAGTCGCGCTGCCAGG + Exonic
1089078859 11:115760109-115760131 GACACTGATGACCCGCGGCGGGG - Intergenic
1090255483 11:125280832-125280854 GCCACAGATGTCCATCACCCTGG - Intronic
1090465035 11:126925930-126925952 GACACAGATGTCTCAGATCCGGG - Intronic
1090543808 11:127739206-127739228 TACACATATGACTCGCAGCCAGG - Intergenic
1090928585 11:131275137-131275159 GACCCAGAGGTCCCACAGCTAGG + Intergenic
1091407051 12:215515-215537 GCCACAGCTGACCCCCAGCCCGG - Intergenic
1098485028 12:71010628-71010650 GACACAGTTGGCCCACAGCTTGG - Intergenic
1101965464 12:109279309-109279331 GTCACTGAGGTCACGCAGCCAGG + Exonic
1101990209 12:109477799-109477821 GACCCAGTTCTCCCGCAGGCCGG - Exonic
1103901382 12:124305310-124305332 GACTCAGCTGTGCCGAAGCCTGG + Intronic
1104366593 12:128183601-128183623 CACACAGATGTCCCAGTGCCTGG + Intergenic
1106553607 13:30791723-30791745 GGCACAGCTGCCCTGCAGCCTGG + Intergenic
1108418269 13:50222878-50222900 GACACCTTTGTCACGCAGCCAGG - Intronic
1108792950 13:53995004-53995026 GACACAGATTTCCTCCTGCCTGG + Intergenic
1110324193 13:74195302-74195324 GACACAGAGGCCTCACAGCCAGG + Intergenic
1112248476 13:97756137-97756159 GACACAAATGTCCCGGAATCAGG + Intergenic
1112368021 13:98772446-98772468 GTCCCAGATGTCAAGCAGCCAGG + Intergenic
1118456143 14:65947031-65947053 GACACTGATGTCACACACCCAGG - Intergenic
1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG + Intergenic
1120856428 14:89216665-89216687 GAACCAAATGTCCCCCAGCCAGG + Intronic
1121122278 14:91383465-91383487 CACTCAGATGTCCGGGAGCCAGG + Intronic
1122089713 14:99330295-99330317 GACTCAGATGGCCCTCAGCACGG - Intergenic
1130445855 15:84001223-84001245 GACACAGGTGTCCCGAGGCTAGG + Intronic
1131051587 15:89351756-89351778 GCCCCAGATGACCTGCAGCCTGG + Intergenic
1131229653 15:90650720-90650742 GGCATTGAGGTCCCGCAGCCTGG - Intergenic
1132032771 15:98451889-98451911 CTCACAGAAGTCCCGCAGCATGG + Exonic
1132874638 16:2130914-2130936 GACCCAGGTGACCCCCAGCCAGG + Intronic
1134228580 16:12411488-12411510 GACACATATGTCCAGCAGGAAGG - Intronic
1134409894 16:13995164-13995186 GACTCAGATGTCCCCCAGTAAGG + Intergenic
1134553580 16:15149747-15149769 GACCCAGGTGACCCCCAGCCAGG + Intergenic
1137722551 16:50636008-50636030 GACCCAGAAGGCCAGCAGCCAGG - Exonic
1138627245 16:58262055-58262077 CACACAGAAGTCCCTAAGCCAGG - Intronic
1140476210 16:75240334-75240356 GACACAGATGTCCCGCAGCCAGG + Intronic
1143110485 17:4550132-4550154 GAGAAACATGGCCCGCAGCCAGG + Exonic
1143296012 17:5872712-5872734 GACCCAGATGTTCCCCAGCAGGG + Intronic
1143658827 17:8312538-8312560 GATGCAGATGCCCCGGAGCCAGG + Exonic
1147606980 17:41779355-41779377 GAGACAGATGTCACCCAGGCTGG + Intronic
1149487212 17:57051982-57052004 CACACAGATGGCTCGAAGCCTGG + Intergenic
1150122955 17:62618584-62618606 GACATAGATGTCCCCCAGTGGGG + Intergenic
1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG + Intronic
1160478036 18:79210415-79210437 GACACAGAAGACCCTCACCCAGG - Intronic
1160478043 18:79210466-79210488 GACACAGGTGACCCACACCCAGG - Intronic
1164565620 19:29323877-29323899 GACATAGATGACCTGCAACCAGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925464890 2:4098355-4098377 GGCACAGATGTTCCACAGCAGGG - Intergenic
931667168 2:64617795-64617817 GGCACAGATGTGCAGCAGCTTGG + Intergenic
932714319 2:74090486-74090508 GAGACATCTGTCCGGCAGCCAGG - Intronic
934219313 2:90067250-90067272 GACACACATGTCCGCCAGCTGGG + Intergenic
935856411 2:107279295-107279317 GACACAGATGTGCCTCATCATGG + Intergenic
936255453 2:110906864-110906886 CACACAGATGTCCCCCAGTGGGG + Intronic
937295153 2:120805682-120805704 GACACAGCTGTCCCTCAACCTGG + Intronic
938737156 2:134196667-134196689 GCCACAGGTGGCCCGCAGTCTGG - Intronic
938787109 2:134640195-134640217 AACACAGATGTCGCACAGCATGG - Intronic
946248007 2:218398200-218398222 GAGACAGATGTCCCGCTCCCAGG + Intergenic
1168857403 20:1018439-1018461 GACTCAGATGTCCCTTTGCCAGG + Intergenic
1172617722 20:36300217-36300239 GGCTCAGATGTGCCCCAGCCTGG + Intergenic
1173229294 20:41181630-41181652 GGGACAGATGTCCCAGAGCCAGG + Exonic
1174054560 20:47788940-47788962 GGCTCACATGTCCCCCAGCCTGG + Intergenic
1174601029 20:51724969-51724991 GGCACAGATGTCCCCCAATCTGG - Intronic
1175334318 20:58185266-58185288 GACACAGAAGGCCAGCTGCCTGG + Intergenic
1178235759 21:30839281-30839303 GACACTGATGTCACAGAGCCCGG + Intergenic
950716696 3:14852894-14852916 GACACACACATCCCACAGCCTGG - Intronic
961346075 3:126264187-126264209 GACATAGATGCCCCTCAGCGAGG + Intergenic
961390988 3:126552309-126552331 GGCACAGAGGTTCCACAGCCAGG + Intronic
969093768 4:4717229-4717251 GACACAGCTGTGCACCAGCCCGG + Intergenic
976829105 4:89293484-89293506 GAGCCAAATGTCCGGCAGCCTGG - Intronic
977352571 4:95907086-95907108 GAGACAGATGCCCAGCAGCATGG - Intergenic
985151671 4:186953760-186953782 GTCACAGCTGTTCCGCATCCAGG - Intergenic
985479875 5:102849-102871 CACACAGATGTCGCCCAGGCAGG - Intergenic
992008429 5:72502409-72502431 GACACAGATCTCCCTCTGACAGG - Intronic
1001096074 5:168776351-168776373 CACACAGATGTCCTCCTGCCTGG + Intronic
1001487035 5:172127291-172127313 GACAGAGCTGTCCAGCAGTCAGG + Intronic
1002897204 6:1386313-1386335 GACAAAGCTGGCCAGCAGCCTGG - Intergenic
1006452015 6:34110792-34110814 AAGACAGATGGCCTGCAGCCTGG - Intronic
1006794973 6:36726113-36726135 GAGCCAGAGGTCCCTCAGCCTGG + Intronic
1006797756 6:36742157-36742179 CACACAGATGTCCCAAAGGCCGG + Exonic
1014978304 6:127916493-127916515 GACACAGAGGTCCTTCTGCCTGG + Intronic
1015340940 6:132099622-132099644 GGCACAGATGGCCAGCAGCCAGG + Intergenic
1016882556 6:148924794-148924816 GACACAGCTTTCTCTCAGCCAGG + Intronic
1018650003 6:165985691-165985713 GACACAGGTGTCCTGCACACAGG + Intronic
1019266291 7:119253-119275 GGCACAGACGTCCCTGAGCCCGG + Intergenic
1022589046 7:31643497-31643519 GACCCAGATGTCCTCCAGCCTGG + Exonic
1024262153 7:47581288-47581310 CACACAGCTGGCCCCCAGCCTGG + Intronic
1024521522 7:50308761-50308783 GACACAGAGGCCCTGTAGCCAGG + Exonic
1027051454 7:75023955-75023977 AACCCAGATGTCCCCCAACCAGG - Intronic
1033528814 7:142243412-142243434 GACACGGATGTCCTCCAGCTGGG - Intergenic
1034992221 7:155555153-155555175 GCCAAAGCTGTCCCGCAGCCTGG + Intergenic
1036643361 8:10597670-10597692 GACTCTGATGTCCCCCAGGCCGG - Intergenic
1036930641 8:12952125-12952147 CACAGCGCTGTCCCGCAGCCAGG - Intronic
1037952206 8:23026944-23026966 GAAGCAGATGTCCTGCAGACTGG + Intronic
1037967170 8:23144261-23144283 GAAGCAGATGTCCTGCAGACTGG + Intronic
1039427091 8:37495090-37495112 AACACAGAAGGCCCACAGCCAGG + Intergenic
1039884125 8:41645836-41645858 GAGGCAGATTTCCTGCAGCCTGG + Exonic
1045319404 8:101070260-101070282 CAAACAGATGTCCCCCACCCTGG - Intergenic
1045880007 8:107027445-107027467 GAAACAGCTGTCCTTCAGCCTGG + Intergenic
1048159366 8:131999773-131999795 GACACAGAAAGCCCTCAGCCTGG - Intronic
1050176632 9:2875686-2875708 GAGACAGATTTCCTACAGCCTGG - Intergenic
1054862097 9:69964590-69964612 GACACAGCTGTCTGTCAGCCAGG + Intergenic
1056126225 9:83538372-83538394 GACACACATGCCCAGCGGCCGGG + Exonic
1060273578 9:122165529-122165551 CACACAGCTGTACTGCAGCCTGG + Intronic
1061010861 9:127953826-127953848 GACACAGGGGTCCAGCAGGCCGG + Exonic
1061135440 9:128730765-128730787 GCCCCAGATGGCCCACAGCCGGG + Exonic
1061145026 9:128792561-128792583 GACAAAGATGTCCGGTAGGCAGG + Exonic
1061326171 9:129866093-129866115 GCCCCAGATGGCCCACAGCCTGG + Intronic
1062001044 9:134215814-134215836 AACCCAGATGTCCCTCAGCTGGG + Intergenic
1062651699 9:137581094-137581116 GACACATATGTCCCCCTCCCTGG + Intergenic
1186547377 X:10464655-10464677 GAGACAGATGTGCAGCAGTCGGG + Intronic
1186808121 X:13160584-13160606 GAGACAGATGTCTGGAAGCCAGG - Intergenic
1196277045 X:113778763-113778785 GAGACAGATGTCACCCAGGCTGG + Intergenic
1197709087 X:129653595-129653617 GACACAGAGGACAGGCAGCCTGG + Intronic
1199842403 X:151663557-151663579 GACCCAGCAGTCCCGCAACCAGG - Intronic
1199976814 X:152899055-152899077 GCCTCAGATGTCCCAAAGCCGGG - Intergenic
1200244432 X:154515682-154515704 GACACAGATGTCGCGACGCTGGG + Intronic
1200419973 Y:2954651-2954673 GGCACAGCTGTACCCCAGCCTGG + Intronic