ID: 1140476214

View in Genome Browser
Species Human (GRCh38)
Location 16:75240362-75240384
Sequence CCTTCATTACGGTGGCACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476214_1140476225 20 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476225 16:75240405-75240427 CCAGGGCCCGCCCCAGCAGAGGG 0: 1
1: 0
2: 0
3: 36
4: 328
1140476214_1140476226 21 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476226 16:75240406-75240428 CAGGGCCCGCCCCAGCAGAGGGG 0: 1
1: 0
2: 1
3: 32
4: 312
1140476214_1140476223 19 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476223 16:75240404-75240426 CCCAGGGCCCGCCCCAGCAGAGG 0: 1
1: 0
2: 4
3: 62
4: 424
1140476214_1140476227 22 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476227 16:75240407-75240429 AGGGCCCGCCCCAGCAGAGGGGG 0: 1
1: 0
2: 1
3: 29
4: 231
1140476214_1140476221 3 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1140476214_1140476220 2 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1140476214_1140476219 -10 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476219 16:75240375-75240397 GTAATGAAGGCATGAGCAATCGG 0: 1
1: 0
2: 2
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476214 Original CRISPR CCTTCATTACGGTGGCACGG CGG (reversed) Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
905449925 1:38049491-38049513 CCCTCATTACCGTGGGATGGGGG + Intergenic
906802580 1:48750586-48750608 ACTTCTTTAAGGTGGCAAGGGGG + Intronic
917518837 1:175731624-175731646 ATTTCATTAAGGAGGCACGGCGG + Intronic
917731076 1:177875666-177875688 CCTTCAGCAGGGTGGCACTGGGG - Intergenic
1072537871 10:96377012-96377034 CCTTCCTGACTGTGGCTCGGGGG + Intronic
1076687366 10:132204156-132204178 CCTTCAAGACAGTGGCACTGGGG + Intronic
1079315965 11:19408073-19408095 GCTTCATTACAGTGGCATTGGGG - Intronic
1127668523 15:61172314-61172336 CCTTTCTTACGGTGGCACAAAGG + Intronic
1130371228 15:83286123-83286145 GCCTCAATACGGGGGCACGGAGG - Intergenic
1136505464 16:30699917-30699939 CCTTCAGTACGGCGGCACCGTGG + Exonic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1142367043 16:89656091-89656113 CCTTCATGATGATGACACGGTGG + Intronic
1152079588 17:78178435-78178457 CCTTCCTCAGGATGGCACGGTGG + Intronic
1155202887 18:23533034-23533056 CCTTCATCTCAGTGGCAGGGAGG + Intronic
1158771977 18:60529874-60529896 CCTGCAAGACGGTGGCACTGAGG - Intergenic
1161456115 19:4370485-4370507 CCTGCATCAGGGTGGCAGGGTGG + Intronic
1165681358 19:37779132-37779154 CGTTGATTGCGGTGGCACTGCGG - Intronic
929031014 2:37649779-37649801 GCTTCATGTCGGTGGCATGGAGG + Intronic
932576220 2:72963736-72963758 CCTTCATTCCAGTGCCAGGGAGG + Intronic
936449277 2:112621351-112621373 CCTTAATTATGGTGGCAGTGTGG - Intergenic
938598414 2:132812275-132812297 CCTTCATCACGGAGGACCGGAGG - Intronic
957037795 3:75311225-75311247 CCTTCATTAGGCTGGCGCTGTGG - Intergenic
960193684 3:114739068-114739090 ACTTCAATACGTTGGCACGATGG - Intronic
962706905 3:138052371-138052393 CCTTCCACACGGTGGCACTGTGG - Intergenic
969507176 4:7595353-7595375 GCTTCATTACGTAGGCACGGTGG + Intronic
1003213989 6:4092108-4092130 CCTTCATTACGGCGCCCAGGTGG - Intronic
1017480291 6:154846825-154846847 CAATCATTAGGGTGGCACGAGGG - Intronic
1029028177 7:97440107-97440129 CCTTCACTACGGTGCCTAGGTGG + Intergenic
1029425312 7:100490708-100490730 CCTCCATTGCGGTGGCAGGCGGG - Exonic
1034785387 7:153921581-153921603 CCCTCTTTACAGTGGCACTGTGG - Intronic
1037704646 8:21309071-21309093 CCTACTTTACCGTGGCACAGTGG - Intergenic
1185499365 X:585222-585244 TCTTTATTACGGTGGGATGGGGG - Intergenic