ID: 1140476219

View in Genome Browser
Species Human (GRCh38)
Location 16:75240375-75240397
Sequence GTAATGAAGGCATGAGCAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476212_1140476219 6 Left 1140476212 16:75240346-75240368 CCGCAGCCAGGTGTTACCGCCGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1140476219 16:75240375-75240397 GTAATGAAGGCATGAGCAATCGG 0: 1
1: 0
2: 2
3: 16
4: 171
1140476211_1140476219 7 Left 1140476211 16:75240345-75240367 CCCGCAGCCAGGTGTTACCGCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1140476219 16:75240375-75240397 GTAATGAAGGCATGAGCAATCGG 0: 1
1: 0
2: 2
3: 16
4: 171
1140476209_1140476219 30 Left 1140476209 16:75240322-75240344 CCTGGAGGTTCAGACACAGATGT 0: 1
1: 0
2: 0
3: 17
4: 218
Right 1140476219 16:75240375-75240397 GTAATGAAGGCATGAGCAATCGG 0: 1
1: 0
2: 2
3: 16
4: 171
1140476214_1140476219 -10 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476219 16:75240375-75240397 GTAATGAAGGCATGAGCAATCGG 0: 1
1: 0
2: 2
3: 16
4: 171
1140476213_1140476219 0 Left 1140476213 16:75240352-75240374 CCAGGTGTTACCGCCGTGCCACC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1140476219 16:75240375-75240397 GTAATGAAGGCATGAGCAATCGG 0: 1
1: 0
2: 2
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476219 Original CRISPR GTAATGAAGGCATGAGCAAT CGG Intronic
901409642 1:9073319-9073341 GTACTGACTGCAAGAGCAATGGG - Intronic
903251422 1:22056111-22056133 GTATTCTAGGCATTAGCAATGGG - Intronic
907026998 1:51129848-51129870 GTAATTAAGACATGAGGACTTGG - Intronic
907973221 1:59405181-59405203 ATCCTGAAGGCATGAGCAAGAGG + Intronic
908774533 1:67627457-67627479 GCAGTGAAGGCATGAGCACAGGG - Intergenic
909731479 1:78896969-78896991 GTGATGAGGGTATGAGCCATGGG - Intronic
911199096 1:95026294-95026316 GTGAGGAAGGCATTTGCAATAGG - Intronic
911496215 1:98634697-98634719 TAAATGAAGGCATGAGCAGATGG - Intergenic
913678984 1:121170669-121170691 CTGAGGAAGGGATGAGCAATGGG - Intronic
914030816 1:143958315-143958337 CTGAGGAAGGGATGAGCAATGGG - Intronic
914158633 1:145109647-145109669 CTGAGGAAGGGATGAGCAATGGG + Intronic
914337026 1:146724742-146724764 GTCATGAAGGAATGAGCCACTGG - Intergenic
915290080 1:154877674-154877696 GGAAAGAAGGCATGGGAAATGGG + Intergenic
918478501 1:184951879-184951901 GTTACGGAGGAATGAGCAATGGG - Intronic
918580847 1:186127100-186127122 AGACTGAAGGCATGAACAATTGG + Intronic
920466283 1:206189207-206189229 CTGAGGAAGGGATGAGCAATGGG - Intronic
922119623 1:222651553-222651575 TTAATTTAGGCAAGAGCAATTGG + Intronic
922991537 1:229917302-229917324 CTAATAAAGGCAGGAGCAAAAGG + Intergenic
923080531 1:230649424-230649446 GTCATGAAGGCAACAGCCATGGG - Intronic
924368575 1:243322455-243322477 GTAGTCCAGGCATGTGCAATGGG - Intronic
924705036 1:246493967-246493989 GTGATGAAGGCCTGAGCTAGGGG - Intronic
1065468316 10:26049391-26049413 GCTATGAAGGGATGAGAAATAGG + Intronic
1066606292 10:37176714-37176736 GAAAGGAAAGCATGAGGAATAGG + Intronic
1066607076 10:37188515-37188537 GAAAGGAAAGCATGAGGAATAGG + Intronic
1067457605 10:46431881-46431903 GTAATGAAGACATGTGGTATAGG - Intergenic
1067629594 10:47952753-47952775 GTAATGAAGACATGTGGTATAGG + Intergenic
1069402192 10:68061102-68061124 GCAATGTAGGCAAGAGCTATTGG - Intronic
1072188944 10:93065307-93065329 CTAATAAGAGCATGAGCAATGGG + Intronic
1079821264 11:25132932-25132954 TTAATGAAGGCATAAATAATTGG - Intergenic
1081046508 11:38279803-38279825 GTAATGAGGGGCTGAGAAATAGG - Intergenic
1081949415 11:47030425-47030447 GTAATAAAGACATGGGCAAGAGG - Intronic
1083621543 11:64051782-64051804 GCAATGAAGCCATGGGCAATGGG - Intronic
1085977774 11:81680518-81680540 GTGATGAAGGCATCACTAATGGG - Intergenic
1087567329 11:99878446-99878468 GTAGTGATGGCATGTGCAATAGG + Intronic
1090457177 11:126860313-126860335 TTAATAAAGGCGTGGGCAATGGG + Intronic
1090630799 11:128645626-128645648 GTCATGAAGGCATGAGACCTAGG - Intergenic
1091289829 11:134432631-134432653 TTAAAGAAGGCATGAACATTTGG - Intergenic
1091844070 12:3641698-3641720 GGAATGAAGGGATGAGCAAGTGG + Intronic
1092987765 12:13863098-13863120 GCAATGAAGGAAGGAGCAAGGGG + Intronic
1093005125 12:14043327-14043349 GAGATGAAGGCAAGAGCAAAGGG + Intergenic
1097172363 12:57124006-57124028 GTGATGAAGGCATGTGCAGAAGG - Intronic
1098312911 12:69165363-69165385 GTGAGCAATGCATGAGCAATGGG - Intergenic
1098723902 12:73938421-73938443 TTAAAGAGGGCATGAGTAATGGG - Intergenic
1098865143 12:75753785-75753807 GTATTGCAGGCATGAGCCACCGG - Intergenic
1099915657 12:88889432-88889454 ATGATGAAGATATGAGCAATGGG + Intergenic
1100055679 12:90506091-90506113 GTCATAGAGGCATGAGAAATAGG + Intergenic
1106717289 13:32404771-32404793 TAAAGGAAGGCATGAGGAATAGG - Intronic
1107418723 13:40225366-40225388 GTGATGTTGACATGAGCAATTGG + Intergenic
1108725047 13:53171413-53171435 GTAATGAAGGCATCAACAAGTGG + Intergenic
1108984054 13:56560102-56560124 GTGATGCAGGCTTGACCAATCGG + Intergenic
1109351439 13:61187636-61187658 GAAATGACGTCATGAGTAATTGG + Intergenic
1109805261 13:67431261-67431283 GTAATTAAGGTATCATCAATAGG - Intergenic
1111801570 13:92987338-92987360 ATAATGAAAGAATGAGCACTTGG - Intergenic
1113302378 13:109036173-109036195 GAACTGAAAGCAAGAGCAATTGG - Intronic
1114636024 14:24187347-24187369 GACATGAAGGCATGAGGAAAGGG + Intronic
1114743116 14:25118564-25118586 TGAATGAAGTCATAAGCAATGGG + Intergenic
1116214277 14:41990975-41990997 GGAATGAGAGAATGAGCAATTGG + Intergenic
1116342005 14:43735717-43735739 GTGAGGAATGCATGAGCACTTGG + Intergenic
1119824407 14:77645228-77645250 GTAATGACAGCCTGAGCTATGGG - Intergenic
1120974963 14:90240355-90240377 GGATTGAAGGCATGAGCCACTGG + Intergenic
1121661271 14:95636869-95636891 GAAATGGAGGCATGAGCATGTGG - Intergenic
1124880904 15:33641756-33641778 GTCATGGATGCAAGAGCAATGGG - Intronic
1125906394 15:43396923-43396945 GTGATGTAGGCATGATCAAATGG - Intronic
1126736352 15:51735660-51735682 GTAATGAGGTTATGAGTAATAGG + Intronic
1129111858 15:73341833-73341855 GTCATGAACGCATGTGCCATAGG - Intronic
1129151862 15:73694196-73694218 GCACTGAAGGCTTGAGCAATGGG - Intronic
1129911991 15:79235570-79235592 GCAATGAAGGCCCAAGCAATTGG - Intergenic
1131422599 15:92319767-92319789 GTCATGGAGGCATGAGGAAAAGG - Intergenic
1131866326 15:96714794-96714816 TTATTGAAGGCTTGAGCAAGAGG + Intergenic
1134284886 16:12852235-12852257 CTAATGAATGAATGAGCAATTGG - Intergenic
1134795387 16:17030961-17030983 GTCAGGAATTCATGAGCAATGGG + Intergenic
1135864950 16:26092567-26092589 TTATTGAATGCATGAGCAAGTGG + Intronic
1137583660 16:49650844-49650866 GAAATGATGCCCTGAGCAATGGG + Intronic
1139609419 16:68044667-68044689 GTATTAAAAGCATGAGCCATTGG + Intronic
1139788194 16:69411165-69411187 GTCATGTAGCCATGAGCAAATGG + Intergenic
1140476219 16:75240375-75240397 GTAATGAAGGCATGAGCAATCGG + Intronic
1142966758 17:3586412-3586434 GTAATGATGGCATGAGGCACTGG - Intronic
1143428093 17:6856287-6856309 GGAAGGAAGGCTTGAGCTATAGG + Intergenic
1146631048 17:34469567-34469589 CTAATGAAGTCATGAGCAATAGG - Intergenic
1148261275 17:46185748-46185770 GTATTACAGGCATGAGCCATGGG - Intronic
1148960562 17:51389198-51389220 GGATTACAGGCATGAGCAATCGG - Intergenic
1149115700 17:53093514-53093536 GAAATGTAGGCTTGAGAAATAGG - Intergenic
1150903724 17:69314611-69314633 GTAAACAAGGCATGTGAAATAGG + Intronic
1151298107 17:73200568-73200590 GTAATGAAGACATTAAAAATGGG + Exonic
1152002980 17:77658408-77658430 GTACTGAAGACATCAGCAACAGG - Intergenic
1153460911 18:5332223-5332245 GAAACTAAGGCATGAGGAATGGG + Intergenic
1155862081 18:30914566-30914588 GTAATCAAGGCATGTGGTATTGG + Intergenic
1156928946 18:42617704-42617726 ATAATGAGAACATGAGCAATAGG - Intergenic
1157387571 18:47271203-47271225 GGAATGCAGGCATGAGCCACCGG + Intergenic
1157763254 18:50280434-50280456 GTAGTGAGGGCAAGAGAAATGGG - Intronic
1158448597 18:57543064-57543086 CTAATGCAGGCAGGAGCATTTGG + Intergenic
1158891437 18:61875810-61875832 GTAATGAAGACCTGAGCCCTTGG - Intronic
1161500540 19:4612325-4612347 GTATTATAGGCATGACCAATTGG + Intergenic
1164876019 19:31689900-31689922 GAAATAAAGGCATGAACACTGGG - Intergenic
925181048 2:1817101-1817123 GTAATCAAGTCATGAGAAAATGG - Intronic
926812541 2:16768813-16768835 GCAATAAAGGCCTGAGCAATAGG + Intergenic
928926359 2:36583940-36583962 GTTAAGAAGGAATGTGCAATTGG - Intronic
931527911 2:63178317-63178339 CTAATGAAGGCATGAGGTCTTGG + Intronic
936471334 2:112801372-112801394 GTAATGAAGGAATGAGTCCTAGG - Intergenic
936651815 2:114436398-114436420 GAAATGAAAGCAGGAGAAATGGG + Intergenic
940148966 2:150578289-150578311 GCAATGGAGGCATAAGCATTGGG + Intergenic
940931792 2:159441268-159441290 TTAAAGATGGCATGAGAAATGGG + Intronic
942038081 2:172030616-172030638 GTAATAAAGTCATGAGCAATAGG + Intronic
942150132 2:173068001-173068023 TTAATTTAGGCATGTGCAATAGG - Intergenic
945494074 2:210488779-210488801 GGAATGAAGGAATGAGGAAGAGG - Intronic
945547621 2:211175819-211175841 GAAAAGAAGGCAAGAGGAATAGG + Intergenic
948203407 2:236146447-236146469 TTAAGCAAGGCATCAGCAATAGG + Intergenic
1174202156 20:48814186-48814208 GAAATGAATGCATGAGCAAAAGG - Intronic
1175646763 20:60680854-60680876 GGAATGAAGGCAGCAGCAACAGG + Intergenic
1178635087 21:34295353-34295375 CCAAGGAAGCCATGAGCAATTGG - Intergenic
1182007145 22:26970343-26970365 TTAAAGAAGGCATGAGTATTAGG + Intergenic
1182939655 22:34263396-34263418 GAAGTGAAGTAATGAGCAATGGG - Intergenic
1184672282 22:46020893-46020915 ATTTTGAAGGAATGAGCAATAGG - Intergenic
949207548 3:1458275-1458297 GTAATGGAGACATTCGCAATTGG - Intergenic
950460498 3:13119395-13119417 ATGATGAAGGAATGAGCAAGGGG + Intergenic
957146161 3:76426473-76426495 GTAAGGAAGGCATGACCACTGGG + Intronic
958599584 3:96278275-96278297 GTAATGAAGACATGAGAAACAGG - Intergenic
960764930 3:121115812-121115834 ATAATGAAAGCAGGAGCAAGAGG + Intronic
963973838 3:151458975-151458997 TTAATGAATGCCTGAGTAATAGG - Intergenic
966327637 3:178774664-178774686 GTAATGAAGGCAAAAGCGTTAGG + Intronic
967328261 3:188264220-188264242 CTAATGAAGGCAAGAACAATAGG + Intronic
967438044 3:189473974-189473996 GAAATGATGGCCTGAGCAAAGGG - Intergenic
969381065 4:6798351-6798373 GTACTTAAGGCATGAGCCAGGGG + Intronic
969908153 4:10416896-10416918 GGATTACAGGCATGAGCAATGGG - Intergenic
969977688 4:11121186-11121208 GTACTGAAGACAAGAGCAAGAGG - Intergenic
972857644 4:43126371-43126393 GTAATGAAAGGATTAGAAATGGG + Intergenic
974042619 4:56870567-56870589 GTAATGAAGGCATTTGTATTTGG + Intergenic
975638561 4:76476400-76476422 ATAATGAATGTATGAGCATTTGG - Intronic
977238687 4:94540585-94540607 CTAATGAAGGCCTGGGCACTAGG + Intronic
978125595 4:105131437-105131459 TAAATGAAGGCATGAGAAAATGG + Intergenic
979635008 4:122947093-122947115 GTAATGAAAGCGTAAGAAATAGG + Intronic
982925120 4:161327379-161327401 GTAAAGAAGGTAAGAGCAAGTGG + Intergenic
983007935 4:162508196-162508218 ATAATGGTGGCATGAGCAAGGGG + Intergenic
984930462 4:184842657-184842679 GGATTACAGGCATGAGCAATAGG + Intergenic
987401631 5:17483795-17483817 GTACTAAAGGCATGATCAGTAGG - Intergenic
990114152 5:52368170-52368192 GTGGTGAAGGCAGGAGCAAAAGG - Intergenic
991461460 5:66863563-66863585 GAAAAGAAAGCATGAGAAATGGG - Intronic
993698162 5:91086728-91086750 GTAATGAAGGCCTGAGGTAGGGG - Intronic
993827657 5:92711975-92711997 GAAATGAAGGCAAGAGGAGTGGG + Intergenic
994814369 5:104566320-104566342 GTAATGGAGGTACGAGTAATTGG + Intergenic
998600064 5:143576160-143576182 TTAATGAAGGAATTATCAATAGG - Intergenic
1001216217 5:169858419-169858441 GTATTGAAGGCAGGAGGAACAGG + Intronic
1001869250 5:175136289-175136311 GCAAAGAAGGAAGGAGCAATAGG - Intergenic
1002141451 5:177142970-177142992 AGAATAAAGGCATGAGCAAGGGG - Intronic
1002335513 5:178475382-178475404 GAAGTGAAGGAATGAGCCATGGG + Intronic
1002933265 6:1649611-1649633 GTAATTAGGGCAGGAGCATTTGG - Intronic
1003706328 6:8535374-8535396 GAAATGAAGCAAGGAGCAATGGG + Intergenic
1008306940 6:49914738-49914760 GAAATGAATGCTTGAGAAATAGG - Intergenic
1009548764 6:65058492-65058514 CTAATAAAGCCATGAGTAATGGG + Intronic
1011254053 6:85403069-85403091 GGAATGAATACATGAACAATTGG + Intergenic
1012300518 6:97581854-97581876 GTCATGAATGCTTGGGCAATAGG + Intergenic
1014164798 6:118211568-118211590 TTAAAGAATGCATGATCAATTGG + Intronic
1016231335 6:141808714-141808736 GGAAGGAAGGAATGAGCAATAGG - Intergenic
1017650164 6:156573499-156573521 GAAACTGAGGCATGAGCAATTGG - Intergenic
1018345981 6:162899691-162899713 GTAATGAGGGCCTGAGCTACAGG + Intronic
1027701422 7:81474492-81474514 GAAGAGAAGGCATGAGCAATGGG + Intergenic
1029942703 7:104496996-104497018 GGAATGATGGAATGAGCAAAGGG - Intronic
1030555872 7:111023002-111023024 CTACTGAGGGCATGAGCAGTTGG - Intronic
1030737305 7:113064941-113064963 GTGATGAAGGCATGAGGGAGAGG - Intergenic
1032577755 7:133073528-133073550 GTAAGGAAGGCAGGAGAAAGAGG - Intronic
1033917303 7:146342970-146342992 GCACTGGAGTCATGAGCAATAGG + Intronic
1037243259 8:16802327-16802349 GGAAAGAAGGGATCAGCAATGGG - Intergenic
1041379147 8:57234740-57234762 GGAAGGAAGCCATGAGCCATGGG + Intergenic
1041792299 8:61710704-61710726 GTAATGGAGGATTAAGCAATTGG + Intronic
1044055960 8:87569912-87569934 GTAATGAAGCCATGAGAAGAGGG + Intronic
1048842580 8:138578713-138578735 GCAGTGAAGGAATGAGCCATAGG + Intergenic
1048910576 8:139130930-139130952 AAAATGAAGCCAGGAGCAATAGG - Intergenic
1051560621 9:18436890-18436912 GTAAGGAAGGCAGGAGCAGTAGG + Intergenic
1051844496 9:21436095-21436117 GTAATGTTGCCATGAGCAAATGG + Intronic
1056187204 9:84147106-84147128 GTGATGAGGGCCTGAGCACTGGG + Intergenic
1057745940 9:97751082-97751104 TTTATGAAGGCATGAACAGTAGG - Intergenic
1058322213 9:103647096-103647118 GGAATGAAAACATAAGCAATTGG + Intergenic
1058896270 9:109403273-109403295 TTGAGGAAGGCATGAGTAATAGG - Intronic
1059540781 9:115128273-115128295 CAAATGAAGGCATGCGCAAGAGG + Intergenic
1059678631 9:116564704-116564726 GTAATGAAGGAAAGAAGAATGGG - Intronic
1059962004 9:119574672-119574694 GTAAAGAATGCCAGAGCAATGGG - Intergenic
1185752743 X:2627182-2627204 GGAATGATGACATTAGCAATGGG - Intergenic
1186120231 X:6352711-6352733 GAAATGAAAGAAGGAGCAATAGG + Intergenic
1186521412 X:10209662-10209684 GTAATGAAGGCATGTGCTGTTGG - Intronic
1187213249 X:17250271-17250293 GTAATGAGAGCATGAGCAGGTGG - Intergenic
1187727356 X:22217084-22217106 GAATTGAAGGCATGAACAATGGG - Intronic
1190265426 X:48825044-48825066 GTAATGAAGGAATGAGGGAGTGG + Intergenic
1192177651 X:68895829-68895851 GGGATGAAGGCATGAGCAGCGGG - Intergenic
1192245407 X:69367738-69367760 GGAGTGAAGCAATGAGCAATAGG - Intergenic
1192774333 X:74226382-74226404 GTAATGAAGACATAAGACATGGG + Intergenic
1194426900 X:93749827-93749849 TTAATGAATGCCTGACCAATTGG + Intergenic
1196761293 X:119203004-119203026 GGAGTGAAGGCATAAGAAATTGG + Intergenic
1197554878 X:127940765-127940787 AGAATGAAAGCATGAGCGATTGG + Intergenic
1198633650 X:138671946-138671968 GTAGTGAGGGAGTGAGCAATGGG + Intronic
1199611741 X:149623142-149623164 ATAAAGAGGGGATGAGCAATGGG - Intronic