ID: 1140476220

View in Genome Browser
Species Human (GRCh38)
Location 16:75240387-75240409
Sequence TGAGCAATCGGAAACTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476217_1140476220 -6 Left 1140476217 16:75240370-75240392 CCACCGTAATGAAGGCATGAGCA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1140476211_1140476220 19 Left 1140476211 16:75240345-75240367 CCCGCAGCCAGGTGTTACCGCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1140476214_1140476220 2 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1140476213_1140476220 12 Left 1140476213 16:75240352-75240374 CCAGGTGTTACCGCCGTGCCACC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1140476212_1140476220 18 Left 1140476212 16:75240346-75240368 CCGCAGCCAGGTGTTACCGCCGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1140476218_1140476220 -9 Left 1140476218 16:75240373-75240395 CCGTAATGAAGGCATGAGCAATC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1140476216_1140476220 -1 Left 1140476216 16:75240365-75240387 CCGTGCCACCGTAATGAAGGCAT 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476220 Original CRISPR TGAGCAATCGGAAACTGCCC AGG Intronic
915585170 1:156840465-156840487 TGAGCAATCAGAAGCAGGCCTGG - Exonic
916019128 1:160777264-160777286 TGAGGACTGGGAAACTGCTCTGG + Intergenic
923731092 1:236550928-236550950 TCAGCAACTGGAAACTGTCCTGG - Exonic
1067023366 10:42821396-42821418 TGAGCAGATGGAATCTGCCCTGG + Intronic
1071371531 10:84956641-84956663 TGAGCAAGGGGAAAGTGGCCAGG - Intergenic
1072836798 10:98723592-98723614 TTAGCAATCAGAAAATGTCCAGG - Intronic
1073214022 10:101826790-101826812 TGAGCAATCATAATCTGTCCAGG + Intronic
1076033014 10:127175480-127175502 GGCGCCCTCGGAAACTGCCCTGG - Exonic
1078484570 11:11709680-11709702 TGAGCAAGCAGAAGCTGCACTGG + Intergenic
1084914999 11:72421970-72421992 TGAACACTAGGAAACTGGCCGGG + Intronic
1086667341 11:89499144-89499166 TGACCCATAGTAAACTGCCCAGG - Intergenic
1090081016 11:123612775-123612797 TGCGCTATCGAAAACAGCCCTGG + Exonic
1102058833 12:109916719-109916741 TGAGCCATCTGACAGTGCCCCGG - Exonic
1102467586 12:113138953-113138975 TCAGCGATCTGGAACTGCCCTGG - Intergenic
1104567547 12:129898895-129898917 TGATGAATACGAAACTGCCCAGG + Intronic
1109569748 13:64172126-64172148 TGAATAATCAGAAACTGCTCAGG + Intergenic
1112836103 13:103515907-103515929 TGAGCAAGCGGAAAGTCCACAGG - Intergenic
1118736496 14:68705027-68705049 TGACCAAGCAGAAAGTGCCCAGG - Intronic
1121434997 14:93913328-93913350 TGAGCAATGTGAAAATACCCTGG + Intergenic
1121986777 14:98514632-98514654 TGAAAAATCAGAAACTGCCAAGG + Intergenic
1132562162 16:600820-600842 TCAGCAAGCGGTGACTGCCCAGG + Intronic
1136879495 16:33889824-33889846 TGATCAGTCTGAAAATGCCCAGG - Intergenic
1140476220 16:75240387-75240409 TGAGCAATCGGAAACTGCCCAGG + Intronic
1158552667 18:58449758-58449780 TGAGTCATGGAAAACTGCCCAGG + Intergenic
942061111 2:172229486-172229508 TGGGCAATGGGAAATTGCCTGGG + Intergenic
943526217 2:189020673-189020695 TGAGCGATGGGGAACTTCCCGGG - Intergenic
945002962 2:205371240-205371262 TGAGCAATCTGTAACTTCACTGG - Intronic
947638842 2:231694589-231694611 TAACCTATGGGAAACTGCCCTGG + Intergenic
948890918 2:240906700-240906722 TGAGCAAGTGGAAAGTGCCCCGG - Intergenic
1170641152 20:18154146-18154168 TGAGCAAGTGGTAACTACCCAGG - Intronic
1170754047 20:19181891-19181913 TGAGGAATGGAAAACTGACCAGG + Intergenic
1170927280 20:20737039-20737061 TGAAGAATGGGAAACTGACCAGG + Intergenic
1176135870 20:63521759-63521781 AGAGCACTCGGAACCTCCCCAGG + Exonic
1179059301 21:37965056-37965078 TGGGCAATAGGAAACTGCAGAGG + Intronic
1183395866 22:37570460-37570482 TGAGCCATCAGGCACTGCCCTGG - Intronic
949542415 3:5043807-5043829 TGACCAATCAGAGACTTCCCTGG - Intergenic
950611833 3:14132083-14132105 TGATCAATGAGAACCTGCCCTGG - Intronic
952183656 3:30945288-30945310 TGAGTCATCAGAAAATGCCCAGG - Intergenic
956502487 3:69901566-69901588 TAAGCAATAGGAAACTTCCATGG - Intronic
961361938 3:126373491-126373513 TGTGCAACTGGAAACAGCCCTGG - Intergenic
963445908 3:145407448-145407470 TCAGAAATGGAAAACTGCCCAGG + Intergenic
963691925 3:148515240-148515262 TAAGAAATCAGAAACTGCCTTGG - Intergenic
967601656 3:191397698-191397720 TAAGGAATCTGAAAGTGCCCAGG - Intronic
967893763 3:194381735-194381757 TGGCCAGTGGGAAACTGCCCAGG + Intergenic
969975622 4:11098277-11098299 TGACCAATCAGAATCTCCCCTGG + Intergenic
972310970 4:37882052-37882074 TGAGCAAAAAGAGACTGCCCCGG + Intergenic
972772174 4:42207852-42207874 TGAAAAATCTGAAACTGACCAGG + Intergenic
975397347 4:73892124-73892146 TGAGCAATAAAAAACTTCCCAGG + Intergenic
978670320 4:111240863-111240885 TGAGCAATGGGAAACTACTGAGG + Intergenic
992343273 5:75848416-75848438 TTAGGACTCAGAAACTGCCCTGG + Intergenic
1001635962 5:173210769-173210791 TGGGCAATGGGGAACTGGCCGGG - Intergenic
1004897219 6:20160406-20160428 TGAGCAACAGGCAACTGTCCAGG + Intronic
1010409014 6:75539413-75539435 TAAACAATCTGAAACTGCCTTGG + Intergenic
1010770842 6:79828285-79828307 TGGGCAATTGTAAACTGCCATGG - Intergenic
1011980761 6:93374737-93374759 TCACCAATAGGAAACTGCCTTGG + Intronic
1013194597 6:107834080-107834102 TGAGCAAGAGGTAACTGACCTGG + Intergenic
1017334106 6:153234727-153234749 TGAGCAATTCCAAACTACCCAGG - Intergenic
1024750794 7:52462825-52462847 TGACTAATCAGAAACTGCCATGG - Intergenic
1029328125 7:99827289-99827311 TGAGCAGTTGGAAAATTCCCAGG + Intergenic
1031987481 7:128172466-128172488 TGACCAATAGGAAACTAGCCAGG + Intergenic
1032475310 7:132207746-132207768 TGAACAATTGGAAACAGCCTTGG - Intronic
1037528295 8:19749390-19749412 TAAGCAAACAGAACCTGCCCAGG - Intronic
1045936085 8:107680938-107680960 TCATCAATCACAAACTGCCCTGG - Intergenic
1048625255 8:136178296-136178318 TGAGCAATGGGAAGCTGCTGAGG - Intergenic
1056572077 9:87825068-87825090 AGAGGAATCGGAAAGGGCCCGGG - Intergenic
1057854921 9:98594539-98594561 TGAGCCATAGGAACCTTCCCTGG - Intronic
1061119639 9:128635064-128635086 TGGGCACCCGGAAACTGCCCTGG - Intronic
1062454501 9:136629287-136629309 TGAGCAAGCGGGAACTCCACAGG + Intergenic
1190953070 X:55164973-55164995 TGAGCAATTCAAAACTTCCCTGG - Intronic
1191927257 X:66326952-66326974 TGAGCACTGGAACACTGCCCTGG - Intergenic
1192259006 X:69492752-69492774 AGAGCAATGGGACACTTCCCTGG + Intergenic
1197321860 X:125042522-125042544 TGAGAAATCTGAAAATGACCTGG + Intergenic
1199683462 X:150243471-150243493 TGAGCAATTGGCAAGTGCCCAGG + Intergenic
1199996334 X:153028919-153028941 TGAGCACTCGGTACCTGCCCAGG - Intergenic
1200034850 X:153320530-153320552 TGAGCACTCGGTACCTGCCCAGG + Intergenic
1200045494 X:153398693-153398715 TGAGTACTCGGTACCTGCCCAGG + Intergenic