ID: 1140476221

View in Genome Browser
Species Human (GRCh38)
Location 16:75240388-75240410
Sequence GAGCAATCGGAAACTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476214_1140476221 3 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1140476218_1140476221 -8 Left 1140476218 16:75240373-75240395 CCGTAATGAAGGCATGAGCAATC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1140476216_1140476221 0 Left 1140476216 16:75240365-75240387 CCGTGCCACCGTAATGAAGGCAT 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1140476217_1140476221 -5 Left 1140476217 16:75240370-75240392 CCACCGTAATGAAGGCATGAGCA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1140476212_1140476221 19 Left 1140476212 16:75240346-75240368 CCGCAGCCAGGTGTTACCGCCGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1140476211_1140476221 20 Left 1140476211 16:75240345-75240367 CCCGCAGCCAGGTGTTACCGCCG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1140476213_1140476221 13 Left 1140476213 16:75240352-75240374 CCAGGTGTTACCGCCGTGCCACC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476221 Original CRISPR GAGCAATCGGAAACTGCCCA GGG Intronic
903305474 1:22409959-22409981 GAGCAAGCGGGAGCAGCCCAGGG + Intergenic
907595557 1:55716400-55716422 GAGCAAATGGAAACTGCTCCTGG - Intergenic
917600427 1:176568431-176568453 GAGAAATAGGATACTGTCCAAGG + Intronic
1063231814 10:4072706-4072728 GTGCCATTTGAAACTGCCCAAGG + Intergenic
1066294274 10:34040743-34040765 GAGAAATCAGAAACTAACCATGG + Intergenic
1068916760 10:62441278-62441300 GAGCAAAAAGAAACTGCCAATGG - Intronic
1078544523 11:12237384-12237406 GAGGAAGCGGAGACTGCACAAGG + Intronic
1078901721 11:15648858-15648880 GAGCAGGAGGAAACTTCCCAAGG - Intergenic
1084201736 11:67563642-67563664 AGGAAATCGGAAGCTGCCCATGG - Intergenic
1084590216 11:70085918-70085940 GTGCAGCCGGAAGCTGCCCAGGG + Intronic
1084601813 11:70150146-70150168 GAGGAAATGGACACTGCCCATGG + Intronic
1084898753 11:72294304-72294326 GAGTAAGAGGGAACTGCCCATGG - Exonic
1087081993 11:94179862-94179884 GAGCAACTGGAAGATGCCCACGG - Exonic
1098987570 12:77028960-77028982 TAGCAATGGAAAACTGGCCATGG + Intronic
1101111602 12:101491852-101491874 TAGTAATGGGAAGCTGCCCACGG - Intergenic
1102979272 12:117228645-117228667 CAGCAATCAGAGACTGCCTAGGG - Intronic
1112414496 13:99192979-99193001 GAGCAGGCTGAAAGTGCCCAGGG + Intergenic
1112836102 13:103515906-103515928 GAGCAAGCGGAAAGTCCACAGGG - Intergenic
1120673912 14:87396550-87396572 GAGCTATTAGAAACTGGCCAAGG - Intergenic
1121691710 14:95882728-95882750 GAGCAAACAGAGAATGCCCAGGG + Intergenic
1121986778 14:98514633-98514655 GAAAAATCAGAAACTGCCAAGGG + Intergenic
1136879494 16:33889823-33889845 GATCAGTCTGAAAATGCCCAGGG - Intergenic
1138291040 16:55847002-55847024 GAGCAACCGGGACCTGTCCAAGG + Intronic
1139840514 16:69874783-69874805 GAAGAATCGGAATCTGACCACGG - Intronic
1140476221 16:75240388-75240410 GAGCAATCGGAAACTGCCCAGGG + Intronic
1143610544 17:8015434-8015456 GCGCATGCGGAAAGTGCCCACGG - Exonic
1146539214 17:33680194-33680216 GAGCAATTGGAAGAGGCCCATGG + Intronic
1158748502 18:60229179-60229201 GAGGAAGCGGAAACTTTCCATGG + Intergenic
1163588128 19:18174983-18175005 GAGAAGTGGGGAACTGCCCAGGG + Intronic
925722341 2:6841335-6841357 AAAGAATGGGAAACTGCCCAGGG - Intronic
926757979 2:16251324-16251346 CAGCAATTAGAAAGTGCCCAGGG - Intergenic
927075668 2:19574524-19574546 GAGAAATGGGAAAATGCCCAAGG + Intergenic
927178934 2:20430148-20430170 GTGCCATGGGAAACTTCCCAAGG - Intergenic
929321728 2:40551790-40551812 AAGCATTCAGAAAATGCCCATGG + Intronic
942188338 2:173445917-173445939 GAGAAACTGGAAACAGCCCAGGG - Intergenic
946667080 2:222062006-222062028 AAGCAATAGGAAACTGCAGAAGG + Intergenic
948890917 2:240906699-240906721 GAGCAAGTGGAAAGTGCCCCGGG - Intergenic
1170641151 20:18154145-18154167 GAGCAAGTGGTAACTACCCAGGG - Intronic
1170927281 20:20737040-20737062 GAAGAATGGGAAACTGACCAGGG + Intergenic
1174419829 20:50392168-50392190 CAGCAATAGGAAACATCCCAGGG + Intergenic
1181361976 22:22344538-22344560 GAGCAATGGGTAACTGTCCCAGG + Intergenic
1181832335 22:25570795-25570817 GAGCAATCAAAAAGGGCCCAGGG - Intronic
960293289 3:115912807-115912829 CAGCAATCTGAAAATGCCAATGG - Intronic
961379985 3:126490770-126490792 GAGCCGTCGGACACTGCACAGGG + Intronic
966778871 3:183566307-183566329 AAGCAATGGGAAACTACCAAGGG + Intergenic
971288706 4:25314782-25314804 GAGCAATCTGTATCTGCCAACGG - Intronic
971927337 4:33029852-33029874 GAGCACTAGGAAACTTTCCATGG + Intergenic
976553322 4:86421813-86421835 GAGCAATGGGAAGCCACCCATGG - Intronic
1002762192 6:210651-210673 GAGAAATGGGAAACGGCGCAGGG - Intergenic
1003641435 6:7878652-7878674 GAGCATTTTGAAACTGCACAGGG - Intronic
1010794668 6:80105576-80105598 CAGCAATTGAAAACTGCCAAAGG - Intergenic
1012016590 6:93860250-93860272 TAGCAATCTGTATCTGCCCAGGG - Intergenic
1017544534 6:155436958-155436980 GAGCATTCAGAAACAACCCAAGG - Intronic
1018601431 6:165547407-165547429 GTGCAATCTGCAAATGCCCATGG + Intronic
1024534338 7:50417662-50417684 GAGCACTTGGTAAATGCCCAAGG + Intergenic
1025251129 7:57352319-57352341 CAGCAATAGGAAACATCCCAGGG - Intergenic
1026441873 7:70452069-70452091 AAGCATTAGTAAACTGCCCAAGG - Intronic
1029100089 7:98122333-98122355 GAGAACTGGGAAACTGCCTATGG - Intronic
1029530677 7:101123205-101123227 GAGAAATCGGAAACTTCACATGG + Intergenic
1033053565 7:138029065-138029087 GAGAAATCGGAAACTGTCCATGG + Intronic
1035224671 7:157426680-157426702 GAGCAGACGGACACGGCCCAAGG + Intergenic
1036564176 8:9924245-9924267 GGACAATAGGAAGCTGCCCATGG + Intergenic
1037333455 8:17767830-17767852 GAGCAATGGGAGTCTGCCAAAGG + Intronic
1037826341 8:22162797-22162819 GGGCGATAGGAAACTGTCCAAGG + Intronic
1040716919 8:50266892-50266914 GAGCAAGTGGAAAATACCCAAGG - Intronic
1040903674 8:52442544-52442566 GAGGAATTGGAAAGTACCCAAGG + Intronic
1048625254 8:136178295-136178317 GAGCAATGGGAAGCTGCTGAGGG - Intergenic
1051108920 9:13612623-13612645 CATCAAAGGGAAACTGCCCAAGG + Intergenic
1056572076 9:87825067-87825089 GAGGAATCGGAAAGGGCCCGGGG - Intergenic
1056576506 9:87859117-87859139 GAGGAATCGGTAACAGCCCAAGG + Intergenic
1062648828 9:137565071-137565093 CAGCAAAAGGTAACTGCCCAAGG - Exonic
1189994987 X:46629579-46629601 GAGCAATGGGAAACAGCAAAGGG + Intronic
1199996333 X:153028918-153028940 GAGCACTCGGTACCTGCCCAGGG - Intergenic
1200034851 X:153320531-153320553 GAGCACTCGGTACCTGCCCAGGG + Intergenic
1200045495 X:153398694-153398716 GAGTACTCGGTACCTGCCCAGGG + Intergenic