ID: 1140476223

View in Genome Browser
Species Human (GRCh38)
Location 16:75240404-75240426
Sequence CCCAGGGCCCGCCCCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 424}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476217_1140476223 11 Left 1140476217 16:75240370-75240392 CCACCGTAATGAAGGCATGAGCA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1140476223 16:75240404-75240426 CCCAGGGCCCGCCCCAGCAGAGG 0: 1
1: 0
2: 4
3: 62
4: 424
1140476213_1140476223 29 Left 1140476213 16:75240352-75240374 CCAGGTGTTACCGCCGTGCCACC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1140476223 16:75240404-75240426 CCCAGGGCCCGCCCCAGCAGAGG 0: 1
1: 0
2: 4
3: 62
4: 424
1140476218_1140476223 8 Left 1140476218 16:75240373-75240395 CCGTAATGAAGGCATGAGCAATC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1140476223 16:75240404-75240426 CCCAGGGCCCGCCCCAGCAGAGG 0: 1
1: 0
2: 4
3: 62
4: 424
1140476214_1140476223 19 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476223 16:75240404-75240426 CCCAGGGCCCGCCCCAGCAGAGG 0: 1
1: 0
2: 4
3: 62
4: 424
1140476216_1140476223 16 Left 1140476216 16:75240365-75240387 CCGTGCCACCGTAATGAAGGCAT 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1140476223 16:75240404-75240426 CCCAGGGCCCGCCCCAGCAGAGG 0: 1
1: 0
2: 4
3: 62
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476223 Original CRISPR CCCAGGGCCCGCCCCAGCAG AGG Intronic
900095687 1:939255-939277 CCCCGGGTCCTCCCCAGCAGAGG + Exonic
900105416 1:978936-978958 CCCAGGCCCCGCCCCCTCGGAGG + Exonic
900146411 1:1160756-1160778 CCCAGGGCCACCCTCAGGAGCGG + Intergenic
900284579 1:1892942-1892964 CCGAGGCCCCGCCCCCACAGGGG + Intergenic
900313917 1:2047859-2047881 CCGAGGGCCTGACCCAGCAGGGG + Intergenic
900344428 1:2204371-2204393 CCCAGGGCACGTCCCAGAAGGGG - Intronic
900374374 1:2346831-2346853 CCCAGGGCAGACCCCAGCAGGGG - Intronic
900395810 1:2452804-2452826 CCCGGGGCCAGGCCCAGCGGCGG - Intronic
901462843 1:9401875-9401897 GGCAGGACCCGCCCCAGCCGAGG + Intergenic
901672578 1:10864850-10864872 CCCAGTGTCCGCTCCAGGAGGGG + Intergenic
902110508 1:14074460-14074482 CCCAGGTCCATCCCCAGGAGAGG - Intergenic
902371020 1:16006877-16006899 CCCAGGGCAGGCCAGAGCAGTGG + Exonic
902538908 1:17138557-17138579 CCCAGGGCCTGACACAGGAGAGG - Intergenic
903165572 1:21518087-21518109 ACCAGGGCCCACCCCAGGTGTGG + Intronic
903165752 1:21519268-21519290 ACCAGGGCCCACCCCAGGTGTGG - Intronic
903229839 1:21915007-21915029 CCCAGGGCCCAGCCCAGGACCGG + Intronic
903387397 1:22936486-22936508 CCCAGGCCCAGCCCCAGCCTTGG + Intergenic
904364093 1:29999595-29999617 CCCAGGTCCCACCCCAGCTGTGG + Intergenic
904788996 1:33003871-33003893 CCCAGGGCCCGGCACAGAGGAGG - Intergenic
905688027 1:39922638-39922660 CGCGGGCCCTGCCCCAGCAGCGG - Intergenic
906258462 1:44368198-44368220 CCCAGGGCTCATCCCTGCAGTGG - Intergenic
906716440 1:47973220-47973242 CACAGGGCCTGGGCCAGCAGGGG + Intronic
910257181 1:85259696-85259718 CCCAGGGCCCGCCCCTCGCGTGG + Intergenic
912726065 1:112059843-112059865 CCCAGCACCCGTCCCAGGAGTGG - Intergenic
914667260 1:149841782-149841804 CTCAGGGCCCTCCCCATCGGGGG + Intergenic
914668507 1:149852008-149852030 CTCAGGGCCCTCCCCATCGGGGG - Intronic
914846459 1:151286461-151286483 TCCAGGGCCATCCCCAGCAGAGG - Exonic
914919554 1:151838246-151838268 CCGAGGGCCTGCCCCGGCCGCGG - Exonic
916090618 1:161305646-161305668 CCCAGGCCCTGCCAGAGCAGGGG - Exonic
916272898 1:162963045-162963067 CCCATGGCCCCACCCAGAAGTGG + Intergenic
919785211 1:201254300-201254322 CCCAGAGCTTCCCCCAGCAGAGG - Intergenic
920431822 1:205923677-205923699 CTCTGCCCCCGCCCCAGCAGGGG - Intronic
920522170 1:206635756-206635778 CCGGGCTCCCGCCCCAGCAGCGG + Exonic
922538654 1:226402462-226402484 CCCAGTCCCAGCCCCAGCAGTGG + Intronic
924552554 1:245091976-245091998 CACAGGGCCCGGCCAAGCTGTGG - Intronic
1062941692 10:1426712-1426734 CCCAGGGGCTGGCCCAGGAGAGG + Intronic
1063380016 10:5578456-5578478 CTGAGGGGCAGCCCCAGCAGAGG + Intergenic
1063665671 10:8058820-8058842 CCCAAGGCCCGGTCCAGCACAGG + Exonic
1067732277 10:48820792-48820814 CCCAGGGCCGGCCCCACCTGTGG + Intronic
1067756282 10:49008277-49008299 CCCTGGCCCCACCACAGCAGAGG + Intergenic
1070548560 10:77473030-77473052 CCCAGGGCAGGCCACAGCCGTGG - Intronic
1070765013 10:79051364-79051386 TCCAGCGCTGGCCCCAGCAGAGG - Intergenic
1070778674 10:79125112-79125134 CCCAGCGCCTGGTCCAGCAGAGG - Intronic
1070827674 10:79400726-79400748 CCCAGGGTCCACACCTGCAGGGG - Intronic
1071567706 10:86680287-86680309 CCCAGGGTCAGCTGCAGCAGGGG - Intronic
1072700937 10:97640920-97640942 CCCCGGGCCCGATCCAACAGTGG - Exonic
1074399056 10:113126787-113126809 CCCAGGGCCCGCGCCGGCCGCGG - Intronic
1074764262 10:116689113-116689135 GCCATAGCCTGCCCCAGCAGAGG + Intronic
1075140460 10:119829632-119829654 CTCAAGGCCCGCCCAGGCAGCGG - Exonic
1075334037 10:121596449-121596471 CCCAGTGGCCGAGCCAGCAGTGG - Intronic
1075440450 10:122475871-122475893 CCCAGAGCCCGGCCCAGCACTGG - Intronic
1075796514 10:125123854-125123876 CCCAGGGCCACACCCAACAGAGG + Intronic
1076242326 10:128917685-128917707 ACCAGGGCCAGCCCCTGCACTGG + Intergenic
1076598368 10:131639797-131639819 CAAAGGGCCCTACCCAGCAGGGG + Intergenic
1076782041 10:132729693-132729715 GCCAGTGCCCTCCCCAGCACTGG - Intronic
1077046740 11:550028-550050 GCCAGGGCCCGGCCCAGCCCAGG - Intronic
1077102141 11:827152-827174 CCCGGGGCCGGCCCAAGCGGGGG + Intronic
1077298842 11:1838108-1838130 CCCAGGCCCCCGCCCTGCAGAGG - Intergenic
1077335197 11:2000332-2000354 GCCTGAGCCCGCCCCAGCTGGGG - Intergenic
1077335288 11:2000738-2000760 GCCCGAGCCCGCCCCAGCTGGGG - Intergenic
1077392447 11:2306459-2306481 CCCAGGGCCTTCACCATCAGAGG - Intronic
1077551130 11:3200789-3200811 CCCAGAGCCCTTCCCTGCAGGGG - Intergenic
1078249773 11:9607462-9607484 ACCAGGGCCAGGCCCTGCAGAGG - Intergenic
1078823535 11:14905927-14905949 CCCAGCGGGCTCCCCAGCAGTGG - Intronic
1078928087 11:15892235-15892257 CGCAGAGCCCGCCACAGGAGAGG + Intergenic
1081549109 11:44095918-44095940 CCCTTGTCCCGACCCAGCAGCGG - Intronic
1081793531 11:45804975-45804997 CCGAGGTCCCCCGCCAGCAGCGG + Exonic
1081850676 11:46273168-46273190 TCCAGGGCCTTCCACAGCAGCGG - Intergenic
1083302524 11:61746423-61746445 CCCAGGACCCACCCTGGCAGAGG - Exonic
1083432598 11:62622027-62622049 CGCAGGCCCCGCCCCTGCAGCGG + Exonic
1083609671 11:63998914-63998936 CCCACGGCCCGCCCCTGCCCCGG - Intronic
1083667649 11:64284588-64284610 CCCAGGCCCCGCCCCGCCCGTGG + Exonic
1084033729 11:66495522-66495544 CCCAGGGCTGGCCACTGCAGCGG - Intronic
1084156763 11:67317500-67317522 CCGAGGCCCCGCCCCAGCCTGGG - Intergenic
1084203858 11:67579646-67579668 CCCAGTGCCTCACCCAGCAGAGG - Intergenic
1084271597 11:68032170-68032192 GCCAGGGCCCGCAGCAGCATAGG - Exonic
1084418571 11:69049025-69049047 CCGCGGGCCCCGCCCAGCAGGGG - Exonic
1085037350 11:73308389-73308411 CCCAGGCCCAGCCCCCGCCGCGG - Exonic
1087507825 11:99049620-99049642 TCCAGGACCCTCCCCAGCAATGG + Intronic
1089442874 11:118531154-118531176 CGCAGCCCCCGCCCCTGCAGCGG + Exonic
1091266248 11:134273300-134273322 CGCAGGGCCACTCCCAGCAGAGG - Intergenic
1202818180 11_KI270721v1_random:55514-55536 GCCTGAGCCCGCCCCAGCTGGGG - Intergenic
1202818271 11_KI270721v1_random:55920-55942 GCCCGAGCCCGCCCCAGCTGGGG - Intergenic
1096292376 12:50352861-50352883 CCCAGGGCCTGCGCCTGCTGAGG + Exonic
1096292539 12:50353437-50353459 CCCAGGGCCTGCGCCTGCTGAGG + Exonic
1096688927 12:53307622-53307644 TCCTGGGCCCGCCCAAGCACTGG + Exonic
1096744451 12:53716263-53716285 CCCTAGGCCAGGCCCAGCAGCGG - Exonic
1096809231 12:54159159-54159181 CCCAGCCCCAGCCCCAGCGGAGG + Intergenic
1097172742 12:57126823-57126845 CCCAGGGCCCCTCCCAGTATTGG - Intronic
1098550278 12:71754816-71754838 CGCAGGGGCCGCCCCGGCACCGG + Intergenic
1100819809 12:98420490-98420512 CCCAGGACCCCCCACAACAGTGG + Intergenic
1101595711 12:106163057-106163079 CCCAGGGGCCACCTCAGAAGGGG + Intergenic
1102020225 12:109677253-109677275 TCCAGGGCCTGTCCCATCAGTGG + Intergenic
1102029393 12:109731301-109731323 CCCAGCGCCTACCCCAGGAGCGG + Intronic
1102207280 12:111099185-111099207 ACCAGGTCCTGCCCCAGCAGAGG + Intronic
1102672611 12:114632882-114632904 CCCAGGGCCTGGCACAGAAGAGG - Intergenic
1102677553 12:114668834-114668856 CCCAGGGCCCGTCTCAGCTCAGG + Intergenic
1104018332 12:124975238-124975260 TCCAGGACCTGCCCAAGCAGGGG - Intronic
1104908443 12:132228073-132228095 GCCATGTGCCGCCCCAGCAGGGG + Intronic
1105014167 12:132776101-132776123 ACCAGGGGCTGCCCCAGAAGTGG + Intronic
1106100939 13:26694856-26694878 CCCAGCGCCCTCTCCATCAGGGG + Intergenic
1106552910 13:30787191-30787213 CCCAGGGCCATCACCAGAAGAGG + Intergenic
1107851505 13:44576860-44576882 CCCAGGGACCGCTCCATCACTGG + Intronic
1108571383 13:51755180-51755202 CCCAGGGCCTGCCACAGAATAGG + Intronic
1109378165 13:61524574-61524596 CCCAGAGGCACCCCCAGCAGAGG - Intergenic
1112344381 13:98577350-98577372 CCCGGCGCCCGCCCCAGCCGAGG - Intronic
1113255419 13:108499973-108499995 CAGAGGGCCCGCCGGAGCAGAGG - Intergenic
1113728367 13:112622552-112622574 CCCGGCTCCCACCCCAGCAGAGG - Intergenic
1113728386 13:112622608-112622630 CCCAGCTCCCACCCCAGCAGAGG - Intergenic
1113825697 13:113251524-113251546 CCCGGGCCCTCCCCCAGCAGTGG - Intronic
1113848034 13:113403567-113403589 CCCAGGCCCCGGCCCAGGAGGGG - Intergenic
1115224396 14:31088031-31088053 CCCAGGGCCTTCTCCAGCATGGG + Intronic
1115779979 14:36758405-36758427 CCCAGGGCATGACCCAGGAGAGG + Intronic
1116950241 14:50872374-50872396 CCTTGGGCCCGGGCCAGCAGAGG - Intronic
1118610232 14:67533663-67533685 CCGAGGGCCCTTCCCAGGAGCGG - Intronic
1118806408 14:69241009-69241031 CCAAGCACCTGCCCCAGCAGTGG + Exonic
1119704670 14:76776311-76776333 CCCCTCCCCCGCCCCAGCAGAGG + Intronic
1121271572 14:92641394-92641416 CCCAGGGGCCGCCTGTGCAGAGG + Intronic
1121318121 14:92974185-92974207 CTCAGTGCCAGCCCCTGCAGGGG - Intronic
1121418441 14:93795499-93795521 CCTAGGACCAGCCACAGCAGTGG + Intergenic
1121599279 14:95191128-95191150 CCCAGGCCAAGCCCCAGCTGGGG - Exonic
1121803868 14:96797515-96797537 CCCAGTGCCGGCCCCAGCCCCGG - Intronic
1122526646 14:102390640-102390662 CCCAGAGCCAGCCACACCAGCGG - Intronic
1122844148 14:104481578-104481600 CCCAGGACCCGGGGCAGCAGGGG - Intronic
1122858484 14:104571600-104571622 TTCAGGCCCCTCCCCAGCAGAGG + Intronic
1122903745 14:104792567-104792589 CCCAGGCCCAGCCCTGGCAGCGG + Intronic
1122905819 14:104800980-104801002 CCCGGGACCCGCCCCCGCGGCGG + Exonic
1122951910 14:105049906-105049928 CCCAGTGCCCGGCACAGCACAGG - Exonic
1123069061 14:105632291-105632313 CCCAGGTCCAGTCCCAGCTGGGG + Intergenic
1124212766 15:27776909-27776931 ACCAGGGCCCGCAGCAGCAGCGG + Intronic
1124559163 15:30756036-30756058 CCAAGGGCAGGACCCAGCAGTGG - Intronic
1125741482 15:41967916-41967938 CCCAGGGCCTGCCACAGGCGAGG - Intronic
1125921584 15:43528580-43528602 CCCAGGCCCTGCCCCAGCCAAGG + Exonic
1127289806 15:57560067-57560089 TCCAGGGCCCCACCCATCAGTGG + Intergenic
1127960624 15:63887784-63887806 CCCAGGCCTAGCCCCAGCACTGG - Intergenic
1127967019 15:63930109-63930131 CCGTGGGCCTGCCCCAGCTGGGG - Intronic
1128455241 15:67828150-67828172 CCCCGCGCCCGCCCCGCCAGTGG + Intronic
1129161583 15:73751075-73751097 CCCAGTGACGACCCCAGCAGTGG - Exonic
1129200298 15:73994672-73994694 CTCAGGGCCCGCCTCTGGAGAGG - Intronic
1129741089 15:77989957-77989979 TCCAGGGCCAGCCCTAGCAGTGG - Intronic
1129844630 15:78762595-78762617 TCCAGGGCCAGCCCTAGCAGTGG + Intronic
1130064987 15:80595777-80595799 CCCAGGGCCAGCCCCAGAATGGG + Exonic
1130257197 15:82331271-82331293 TCCAGGGCCAGCCCTAGCAGTGG - Intergenic
1130597755 15:85258719-85258741 TCCAGGGCCAGCCCTAGCAGTGG + Intergenic
1131252570 15:90839955-90839977 CCCAGGGGACGTCCCTGCAGTGG - Intergenic
1132330977 15:101012567-101012589 CTCAGGGCCAACCCCAGAAGGGG + Intronic
1132570150 16:640994-641016 CACAGGGACCCCCCCAGCACAGG + Intronic
1132570186 16:641075-641097 CCCAGGGATCCCCCCAGCACAGG + Intronic
1132573730 16:655486-655508 CCCACGGCCTGCCCCGGCATGGG + Intronic
1132604585 16:788425-788447 CCCCCGGCCCGCCCCCGCCGCGG + Intergenic
1132708879 16:1257878-1257900 CCCAGGACCAGCCTCAGCGGAGG + Intronic
1132731732 16:1366243-1366265 GCAAGGGCCAGCCCCTGCAGTGG - Intronic
1132761712 16:1511682-1511704 ACCAGCGCCCACCCCAGCTGAGG - Intronic
1132933868 16:2471517-2471539 CCCCGGGCCCAGCACAGCAGCGG - Exonic
1133002639 16:2858791-2858813 ACCAGGGCTCGGCCAAGCAGGGG + Intergenic
1133168210 16:3964041-3964063 CCCAGGCACCGCCCCTGGAGAGG + Exonic
1133188192 16:4115453-4115475 CCCGGGGCCTGCCCCGGCCGGGG + Exonic
1133229296 16:4359169-4359191 CCCAGGCCCAGCCCCAGCCCAGG + Intronic
1133259308 16:4538207-4538229 CCCGGGCCCCGCCACCGCAGCGG + Intronic
1135077986 16:19410733-19410755 CCGAGGGCCAGCGCAAGCAGCGG + Exonic
1136466173 16:30445459-30445481 ACCAGGCCCCGGCCCAGCGGGGG + Exonic
1137612241 16:49826367-49826389 GCCAGGGCACGCAGCAGCAGGGG + Intronic
1137677003 16:50308724-50308746 GCCAGGGTCAGCCTCAGCAGGGG - Exonic
1137686561 16:50390745-50390767 CCCAGGGCCCCCGCCAGGTGAGG + Intergenic
1137713060 16:50580317-50580339 GCCAGGGCCTGCCCAAGGAGAGG + Intronic
1138343682 16:56307158-56307180 CCCAGTGCCCTCCCCAGGAGGGG + Intronic
1138423741 16:56916657-56916679 CCCAGTGGCCACCCCAGCAGGGG + Intergenic
1138530431 16:57631568-57631590 CACAGGGCCACCCCCAGCATGGG - Intronic
1138552092 16:57753708-57753730 GCCTGGGCACTCCCCAGCAGCGG + Intronic
1139281590 16:65775086-65775108 CCCACGGCCCGCCACACCTGGGG + Intergenic
1139512804 16:67436973-67436995 CCCCGGCCCTTCCCCAGCAGTGG + Exonic
1139596229 16:67959905-67959927 CCCAGGGCAGGCCCGAGCAGGGG - Intronic
1140224415 16:73066668-73066690 CCGGGGGACCGCCCCAGCAGTGG + Intergenic
1140419613 16:74807616-74807638 ACCAGTGCCCTCCCCAGGAGAGG + Intergenic
1140476223 16:75240404-75240426 CCCAGGGCCCGCCCCAGCAGAGG + Intronic
1140478451 16:75250480-75250502 CCCGGGGCCCGCCGCAGCTTTGG - Intronic
1141430594 16:83968709-83968731 CCCAGCGCCCGGCCCTGCTGCGG - Exonic
1141719986 16:85750799-85750821 CCCGGGCCGCGCCCCTGCAGCGG + Intronic
1141720253 16:85751628-85751650 CCCAGGGTTCGCCCCCGAAGTGG - Intergenic
1141722249 16:85763021-85763043 GCCCAGGCCAGCCCCAGCAGGGG - Intergenic
1141841884 16:86578908-86578930 TCCAGGACGCGCCCGAGCAGAGG + Exonic
1142317752 16:89359388-89359410 CCTGGAGCCAGCCCCAGCAGAGG + Intronic
1142377644 16:89714580-89714602 GCCAGGCCCCGCCAGAGCAGGGG + Intronic
1143881764 17:10035362-10035384 CCCAGGTCCTGCCCCAGCACCGG + Intronic
1144888181 17:18477910-18477932 GCCAGGGGCCACCTCAGCAGAGG + Intronic
1145144025 17:20466393-20466415 GCCAGGGGCCACCTCAGCAGAGG - Intronic
1145274484 17:21421650-21421672 TCCAGGGCAGGCCCCAGCTGGGG - Intergenic
1145312341 17:21707549-21707571 TCCAGGGCAAGCCCCAGCTGGGG - Intergenic
1145791840 17:27632314-27632336 GCCATGGCCCACCTCAGCAGAGG + Intronic
1145812202 17:27771142-27771164 CCCAGGGCCCGGCACAGGCGTGG + Intronic
1145910652 17:28540276-28540298 CCCAGCACCCGCCCCAGCAGAGG + Intronic
1145912923 17:28552683-28552705 CGCAGGGCCCACCCCAGGGGCGG - Intronic
1146000648 17:29128362-29128384 CCCAGGGCCTGTCCCGGAAGCGG - Intronic
1146373837 17:32281344-32281366 CCCACGGCCCTCCCCAGCCTGGG + Intronic
1146824399 17:36010384-36010406 CCCAGAGGCATCCCCAGCAGAGG + Intergenic
1147944152 17:44070836-44070858 CCCAGGCCCCGCCCCGCCAGCGG - Exonic
1148109375 17:45136127-45136149 CCCAGGGCTCGCAGCAGCATGGG + Exonic
1148132002 17:45267619-45267641 CCCAGGGCCCCGGCCAGCTGAGG - Exonic
1148759242 17:49991027-49991049 CCGAGGGGCCGCTCGAGCAGGGG + Exonic
1148760066 17:49995019-49995041 CCCAGGGCTGGCCTCCGCAGAGG + Exonic
1148892373 17:50817415-50817437 CGCGGGGCTCCCCCCAGCAGGGG + Intergenic
1149685076 17:58530666-58530688 CCCAGTGCCAAGCCCAGCAGGGG - Intronic
1149865752 17:60150145-60150167 CCCAGCTCCCGCCCCTGCAGAGG + Intronic
1150390025 17:64784695-64784717 CACAGGCCCTGTCCCAGCAGTGG + Intergenic
1150830129 17:68511893-68511915 CCCGGGGCCCTCCCTTGCAGGGG + Intronic
1151259887 17:72908127-72908149 TCCAGGGCCCGTCCCTTCAGTGG + Intronic
1152066975 17:78117438-78117460 CCCAGGGCCGCCCCCACCTGCGG + Intronic
1152084955 17:78212321-78212343 CCTGGGGGCCACCCCAGCAGAGG + Intergenic
1152366176 17:79857839-79857861 CCCTGGGCGAGCCCCAGCAGAGG - Intergenic
1152571635 17:81123700-81123722 AGTAGGGCCCGCACCAGCAGGGG + Intronic
1152583756 17:81180193-81180215 CCCAGGGGCACCCCCAGCACTGG + Intergenic
1152633105 17:81419538-81419560 CACAGGGCCCGCCCAGGCGGGGG - Intronic
1152676782 17:81645313-81645335 CCCAGTGCCAGCCCCAGCATGGG - Exonic
1152694805 17:81738758-81738780 CCCAGGAGCTGACCCAGCAGCGG + Intergenic
1152861252 17:82698111-82698133 CCCAGCGCCCGGCCCAGCCGCGG + Intronic
1152867380 17:82732340-82732362 CCCTGGGCCACCCCAAGCAGAGG - Intergenic
1152872830 17:82767128-82767150 CCCAGGGCCGGCCTCGTCAGGGG + Intronic
1152888797 17:82868116-82868138 CCCAGAGCCCGCCCCAACTGCGG - Intronic
1152899805 17:82934013-82934035 CCCCGGCACTGCCCCAGCAGCGG - Intronic
1153732460 18:8028609-8028631 CCCAGAGCCCGACTTAGCAGTGG + Intronic
1156542294 18:37926092-37926114 TCCAGGGACCTCCCCAACAGAGG - Intergenic
1157329379 18:46692354-46692376 CCAAGGGCCAGCCCCAGGACTGG - Intronic
1157368169 18:47085612-47085634 CCCATGGCCGCCCCCAGAAGAGG + Intronic
1157404925 18:47414664-47414686 CCCAGGGCCAGCCTCAACTGTGG - Intergenic
1157587941 18:48817167-48817189 CCCAGGCCCCTCCCCAGCCCCGG + Intronic
1157781225 18:50440980-50441002 CTGAGGGCCTGCCCCAACAGTGG - Intergenic
1159040326 18:63318528-63318550 CCCGGGGGCCGCCCCCGCACCGG - Exonic
1159198572 18:65151151-65151173 CCCAGGGACCTCCACAGAAGAGG - Intergenic
1160256404 18:77251381-77251403 CCAATGGCACGCTCCAGCAGCGG - Intronic
1160412374 18:78683733-78683755 CCCAGGGCACCCCCCTCCAGGGG + Intergenic
1160823347 19:1068169-1068191 CGCAGGCCCCGCCCCGGCTGTGG + Intronic
1160858679 19:1228549-1228571 CTCAGGGCCGGCGGCAGCAGCGG + Exonic
1161313292 19:3606718-3606740 ACCAGGGGCGGGCCCAGCAGAGG + Intronic
1161515785 19:4695519-4695541 TCCTGGACCGGCCCCAGCAGTGG - Exonic
1161619372 19:5290283-5290305 CCCAAGTCCCACCCCAGCTGGGG - Intronic
1161698169 19:5781947-5781969 CCCAGGGCCTCCCCAAGCAGAGG + Intergenic
1161726706 19:5933516-5933538 CCCAGGCCCAGCCCCAGCCCAGG - Intronic
1161925099 19:7294031-7294053 CTCTGGGCCCTCCCCGGCAGGGG - Exonic
1162194008 19:8969796-8969818 CACGTGGCCTGCCCCAGCAGAGG - Exonic
1162582192 19:11538295-11538317 CACAGTGCCCGGCACAGCAGAGG - Intergenic
1162790444 19:13060130-13060152 CCCAGAGCCTGCCAAAGCAGAGG - Intronic
1162798240 19:13097660-13097682 CCCCGGCCCCTCCCCCGCAGAGG + Intronic
1163003099 19:14381366-14381388 CCCAGGGCCCTCCCCGGAACTGG - Intronic
1163034397 19:14562823-14562845 CCCAGGCCCGGCCTCAGCAGGGG - Intronic
1163063596 19:14776897-14776919 CCCAGGGCCCTCCCCGGAACTGG + Exonic
1163362105 19:16853220-16853242 CCCTGGGCCTGCCCCAGGATTGG + Intronic
1163607136 19:18281565-18281587 CCCTGCGCCCGCCCCGGCCGCGG + Exonic
1163613022 19:18310746-18310768 CCCAGGGCCCCCTCCAGCCTGGG + Intronic
1163815507 19:19462447-19462469 CGCAGGGCCCCGCCCCGCAGTGG + Intronic
1164687259 19:30175453-30175475 ACCGGGGCCTGCCCCAGCAGGGG - Intergenic
1164860799 19:31560831-31560853 CTCAGGGACCACCCCAGCAACGG - Intergenic
1165090952 19:33388218-33388240 CCCATGGCCCAGCACAGCAGGGG - Intronic
1165777091 19:38411075-38411097 CCCAGGCCCCTTCCCAGCACCGG + Intronic
1166048939 19:40246795-40246817 CCCTGGACCCACCCCAGCTGGGG + Intronic
1166270250 19:41709129-41709151 CCCAGGGCCCTCCACAGCCTGGG - Intronic
1166700286 19:44878255-44878277 CCCACGGCCCCCCACACCAGCGG - Intronic
1167072774 19:47230538-47230560 CCCAGGGCGCGCGCCCGCTGGGG - Intronic
1167096095 19:47375759-47375781 CCCTGGGACCCCCCCAGGAGAGG - Intronic
1167521433 19:49958394-49958416 CCCAGGGCCCGGCTGAGCTGGGG + Exonic
1167523941 19:49972325-49972347 CCCAGGGCCCGGCTGAGCTGGGG - Intergenic
1167526513 19:49987612-49987634 CCCAGGCCCTGCCTCAGCACTGG - Intronic
1167615135 19:50528865-50528887 CTCAGGACCCGCACCTGCAGAGG - Intronic
1167756122 19:51414932-51414954 CCCAGGGCCCGGCTGAGCTGGGG + Exonic
1167941142 19:52946623-52946645 CCCAGGCCCCGCCCCCACAGCGG + Intronic
1168665784 19:58203995-58204017 CCCTGGGCCCGTGCCAGCGGTGG + Intronic
925942230 2:8831549-8831571 CCCAGGGCCTGGCCCAGCTTGGG - Intronic
927935079 2:27071775-27071797 CCGAGGCCCCGCCCCAGCCGCGG - Intergenic
928088140 2:28358423-28358445 GCCAGGGCTTTCCCCAGCAGTGG + Intergenic
928434899 2:31248621-31248643 CCCAGCCCCAGCCCCAGAAGTGG - Intronic
929465078 2:42137039-42137061 CCAAGGGCCCACCCCAGGATAGG + Intergenic
930051276 2:47218057-47218079 CCCAGGTGAGGCCCCAGCAGAGG + Intergenic
933141147 2:78793925-78793947 CCCAGAGGCATCCCCAGCAGAGG - Intergenic
934553195 2:95274613-95274635 CCCAGGCCCAGGCCCAGCAGGGG - Exonic
934862964 2:97779730-97779752 CCCAGGGCTGGGCGCAGCAGTGG + Intronic
936021296 2:108996928-108996950 CTCAGGACCAGGCCCAGCAGTGG + Intergenic
937398665 2:121562213-121562235 CCCAGCGCCAGCCACAGCACAGG + Intronic
938109194 2:128552772-128552794 CACAATGCCAGCCCCAGCAGAGG - Intergenic
938931985 2:136094758-136094780 CCTAGGGGTTGCCCCAGCAGGGG - Intergenic
938948537 2:136236401-136236423 ACCAGGGCCAGCCACTGCAGAGG - Intergenic
947499881 2:230664255-230664277 CCCAGGGCCACCCCCAGGACTGG + Intergenic
947754321 2:232550791-232550813 CCCCGCGCCCGCCCCCGCTGGGG + Intronic
948505726 2:238426087-238426109 CCCAGGGCCAGCCTCAGCAGGGG + Intergenic
948523615 2:238557559-238557581 CCCAGGGTCTGTCCCAGCACAGG + Intergenic
948686602 2:239674407-239674429 CCCAGGGGCTGCCCCACCAGTGG - Intergenic
1169116390 20:3069065-3069087 CCAAGGGCCTGACCCAGCAGTGG - Intergenic
1170573907 20:17648367-17648389 CCCAGGGCCTGCCTCAGCTGTGG - Intronic
1170596109 20:17806990-17807012 CCTCGGGCTCTCCCCAGCAGAGG - Intergenic
1171011509 20:21511869-21511891 CCCAGGCCCCACCCCGGCGGCGG - Exonic
1171011528 20:21511932-21511954 CCCTGGTCCAGGCCCAGCAGTGG - Exonic
1171407132 20:24918947-24918969 CCCAGGCCTGGGCCCAGCAGGGG + Intergenic
1171420842 20:25016563-25016585 CCCACAGCCTGTCCCAGCAGTGG + Intronic
1172694533 20:36812997-36813019 CCCAGACCCAGCCCCAGCTGGGG + Intronic
1172764829 20:37345927-37345949 CCCAGGGGCGGCCCGAGCTGGGG - Intronic
1173808743 20:45943253-45943275 CCCAGGGTCATCCCCAGCTGTGG - Intronic
1174647028 20:52095238-52095260 CCCATGGCCACCCCCAGCTGTGG - Intronic
1175267545 20:57711606-57711628 CCCAGGCCCCGGCCCAGGAGTGG + Intergenic
1176018816 20:62952517-62952539 CCCTGGCTCAGCCCCAGCAGAGG - Intergenic
1176178993 20:63740884-63740906 GCCAGGGCCCGCCCCTGCCCTGG - Intronic
1176243280 20:64084823-64084845 GCCACGGCCAGCCCCAGCGGCGG + Intronic
1176297862 21:5083751-5083773 CCCAGGTGAGGCCCCAGCAGGGG + Intergenic
1178872047 21:36385363-36385385 CGCAGGCCCCGCCCCCGCATGGG - Exonic
1179859167 21:44178198-44178220 CCCAGGTGAGGCCCCAGCAGGGG - Intergenic
1179903364 21:44406516-44406538 CCCAGAGGCAGGCCCAGCAGCGG - Intronic
1179921700 21:44510871-44510893 CCCCGGCCCCGCCCCCGCCGAGG - Intronic
1180109959 21:45643123-45643145 CCTGGGCCCCGCCCCAGCAAGGG + Intergenic
1180201696 21:46228624-46228646 CCCAGGCCCCGCCCCAACGCCGG + Intronic
1180216062 21:46324472-46324494 GCCAGGTCCCGCCCCCGCCGCGG + Intronic
1180871182 22:19148210-19148232 ACCAGGGTGCTCCCCAGCAGAGG - Intergenic
1181029641 22:20143596-20143618 CCGGGGCCCCGGCCCAGCAGTGG + Exonic
1181168814 22:20997052-20997074 CCCAGGGCCCACCACTGCAGGGG - Intronic
1181222939 22:21373644-21373666 CCCATTTCCTGCCCCAGCAGAGG - Intergenic
1181255802 22:21561976-21561998 CCCATTTCCTGCCCCAGCAGAGG + Intronic
1181306987 22:21922674-21922696 CCCTGGGTCAGGCCCAGCAGCGG - Exonic
1181511920 22:23393112-23393134 CCCAGCCCCAGCCCCAGGAGCGG + Intergenic
1181625514 22:24119838-24119860 GGCAGGGCCAGCCCCAGGAGTGG + Intronic
1181772844 22:25139242-25139264 CCCAGGGTGAGCCCCATCAGGGG - Intronic
1181803079 22:25359783-25359805 GCCAGGGCCAGGCCAAGCAGAGG - Intronic
1182096602 22:27630278-27630300 CCCAGGGCCCAGCCCAGATGGGG + Intergenic
1182325749 22:29511395-29511417 CCCTGGCCCAGCCCCTGCAGAGG - Intronic
1182347221 22:29674746-29674768 CCCAGGTCCCTCCTCTGCAGGGG + Intronic
1183179777 22:36252273-36252295 CCCAGCATCCTCCCCAGCAGAGG - Intergenic
1183347745 22:37317305-37317327 CCCAATGCCAGCCCCAGCAGGGG - Intergenic
1184132681 22:42526864-42526886 CACCGCGCCCGGCCCAGCAGAGG + Intergenic
1184225443 22:43126953-43126975 CCCAGGGCCGGCCTCAGCTCAGG + Intronic
1184273288 22:43396828-43396850 CCCAGGCCCTGCCCCAGCCAAGG - Intergenic
1184612309 22:45612626-45612648 ACCGGCCCCCGCCCCAGCAGCGG + Intergenic
1184901441 22:47448827-47448849 CCGTGGGCCTGCCCCAGCGGAGG + Intergenic
1185015325 22:48339450-48339472 CCCTGGGGCCGCCTCTGCAGAGG + Intergenic
1185108080 22:48885515-48885537 CCCAGGGTCAGGCCCAGCCGTGG - Intergenic
1185138879 22:49089319-49089341 TCCAGGGTCTGCCCCAGCAGAGG + Intergenic
1185245600 22:49771292-49771314 CCCAGGGCGCGCCCTCGCCGCGG - Intergenic
1185323128 22:50211011-50211033 CCCTGGGCCCACCCCAGCCCTGG + Intronic
1185347065 22:50315111-50315133 CCCAGGGCCAGGCCCAGCACAGG - Intronic
951462678 3:22968390-22968412 CCCAGGGACACCCCCAGCTGTGG + Intergenic
953469404 3:43154329-43154351 CCCAGGTACCCCCTCAGCAGTGG + Intergenic
953607581 3:44421608-44421630 CCCAGGGCCCGCCTGCACAGAGG - Intergenic
954124798 3:48521896-48521918 TCCAGGGCCAGGCCCAGCTGCGG - Intronic
954373975 3:50184697-50184719 ACCAGGGGCCGCCGCTGCAGAGG - Exonic
954446868 3:50551528-50551550 CTCAGGCCCCTCCCCAGCTGAGG - Intergenic
954812319 3:53255835-53255857 CCCAGAGCCCGCCGCAGTGGTGG + Exonic
954960915 3:54564127-54564149 CCCAGGGGCTTCCCAAGCAGAGG - Intronic
961343378 3:126245342-126245364 CCCAGAGGCACCCCCAGCAGAGG - Intergenic
962350935 3:134655178-134655200 CCCAGAGCAGGACCCAGCAGGGG - Intronic
962737451 3:138338610-138338632 CCCAGGCCCAGCCACTGCAGTGG - Intergenic
962891714 3:139677998-139678020 CTTAGGGCCCGCCCCAGCGAAGG - Exonic
965320774 3:167249398-167249420 CCCAGGGGCAACCCCAGCAGAGG + Intronic
966108179 3:176362313-176362335 CCCAAGCCTCGCCCCCGCAGTGG - Intergenic
968480169 4:829785-829807 CCCAGGTCCTGCCCCAGCTCTGG - Intergenic
968521249 4:1035766-1035788 GCCAGGGCCCGGCCCTGCAGAGG + Intergenic
968663193 4:1807224-1807246 CCCCCGGCCCCACCCAGCAGTGG + Exonic
968846063 4:3042173-3042195 CCCACCGCCGGCTCCAGCAGGGG + Intergenic
968935498 4:3608069-3608091 CCCAGGGCCCGCCCTCGCCCCGG + Intergenic
969059683 4:4424930-4424952 ACCTGGGCCCCCCGCAGCAGTGG + Intronic
969619065 4:8269881-8269903 CCCGGCGCCCGGCCCCGCAGCGG + Exonic
969670704 4:8588573-8588595 CCCAGGGCCATCCCCTGCAGAGG + Intronic
970394975 4:15655953-15655975 CCCAGGCCCCGCGCCCGCTGTGG - Intronic
971365272 4:25972125-25972147 CCCAGGGCCTGGGCCACCAGAGG - Intergenic
980077670 4:128310511-128310533 AGCAGGGGCCACCCCAGCAGAGG + Intergenic
980393276 4:132172852-132172874 CTCAGGGTCAGCTCCAGCAGTGG + Intergenic
982288833 4:153760067-153760089 GCCAGCGTCCTCCCCAGCAGCGG + Exonic
982317115 4:154043275-154043297 AACAGGGCCCGGCCCAGCATAGG - Intergenic
984024107 4:174522459-174522481 CCCACCGCCCGCCCCAGCAGTGG - Exonic
984776240 4:183483465-183483487 CGCAGGCCGCGCTCCAGCAGCGG - Intergenic
984795866 4:183659413-183659435 CCCCGGGCCCGCTGCAGCTGAGG - Exonic
985445881 4:190021197-190021219 CCCAGGGCCCGCCCAGGTACCGG - Intergenic
985504586 5:271743-271765 CCCAGGGCCGGCCCCAGGGCCGG - Exonic
985685008 5:1277372-1277394 CCCAGGAGCCTCCACAGCAGCGG + Intronic
985781820 5:1875636-1875658 CCCTGGGTCCTCCCCAGGAGAGG + Intergenic
985824389 5:2181773-2181795 CCCAGGGCCTGGCACCGCAGGGG + Intergenic
986015981 5:3757461-3757483 CCCACGCCCAGCCCCAGCACTGG - Intergenic
986858809 5:11903727-11903749 CCCAGGACCACCCCCACCAGCGG + Intronic
995492465 5:112707577-112707599 CGCAGGTCCCCCCCGAGCAGCGG - Intronic
996628994 5:125605488-125605510 CCCAGGACCCTACCCAGCTGAGG - Intergenic
997981484 5:138470222-138470244 CACAGGGATTGCCCCAGCAGTGG - Intergenic
998054509 5:139062886-139062908 CCCAGTGCCCAACACAGCAGTGG - Intronic
998539969 5:142971465-142971487 CCCTGGGGCCTCCCCAGCTGAGG - Intronic
1000014836 5:157267097-157267119 CCCAGGTGCCTCCCCAGCACAGG + Intronic
1001781431 5:174372174-174372196 CCCCGGGCCCAGCCCAGCAGAGG + Intergenic
1002327825 5:178420997-178421019 CGCAGGGCCCAGCCCAGGAGGGG + Intronic
1002339280 5:178504398-178504420 CCCAGGGTCCGCCCCACCATGGG - Intronic
1002416026 5:179121438-179121460 ACCAGGTTCGGCCCCAGCAGAGG + Intronic
1002563916 5:180099650-180099672 CCCGAGGCTCACCCCAGCAGGGG - Intergenic
1002935802 6:1671349-1671371 CCCAGAGAGCACCCCAGCAGGGG - Intronic
1003078023 6:2999705-2999727 CCCAGGCCCCGCCTCCACAGCGG - Intronic
1004620792 6:17328591-17328613 CACTGTGCCCGGCCCAGCAGTGG - Intergenic
1004701947 6:18087618-18087640 CCCAGGACCCAACCCTGCAGGGG + Intergenic
1005496173 6:26389809-26389831 GCCAGGGCCGGGCCCAGAAGGGG - Intronic
1006396001 6:33788346-33788368 CCCAGGGCCCTCCCCTGCGCCGG + Intronic
1006453963 6:34121638-34121660 CCCTGGCCCTGGCCCAGCAGAGG - Intronic
1006908254 6:37547277-37547299 CCCCGCGCCCGGCCCAGCTGTGG - Intergenic
1007369543 6:41417310-41417332 CCCAGGGCAAGTCCCAGCAGGGG + Intergenic
1007590387 6:43017352-43017374 CCCAGGGACAGCCCCAGCATTGG - Intronic
1007722361 6:43892541-43892563 CCCAGGGCCTGGCCCAGGTGGGG + Intergenic
1008544910 6:52576242-52576264 CCCTGGCCCCATCCCAGCAGTGG - Intronic
1012113120 6:95261308-95261330 CCCAGAGGCACCCCCAGCAGGGG - Intergenic
1012528551 6:100206424-100206446 CCCAGGTCCCTCCAGAGCAGAGG - Intergenic
1012874847 6:104713986-104714008 TCCAGGGCCTGCCCAAGCCGGGG + Intergenic
1014747759 6:125219724-125219746 CCCAAGGCCCGCCCATGGAGAGG - Intronic
1015244792 6:131063378-131063400 CCCAGGCCCCGCCCCTGCGCGGG + Intergenic
1015525784 6:134174901-134174923 CGCAGGCCCCGCCCCCGCGGCGG - Intronic
1015910016 6:138161190-138161212 CACAAGGGCCGCCGCAGCAGAGG - Intergenic
1018463396 6:164020390-164020412 CCCTGCTCCCGCCCCAGCTGGGG - Intergenic
1018935618 6:168272091-168272113 CACAGGGACAGCCCCAGCGGTGG + Intergenic
1019430701 7:997656-997678 CGCTGGGCCCTCCCCGGCAGGGG + Exonic
1019606006 7:1910581-1910603 CCCTGGGCCACCCCCACCAGTGG + Intronic
1019705346 7:2494734-2494756 CCCAGAGCCCCACCCAGCATAGG - Intergenic
1019735140 7:2646779-2646801 CCCACGCCCCGCCCCAGCAGGGG - Intronic
1019868610 7:3737196-3737218 CCTATGGCCCTGCCCAGCAGGGG - Intronic
1020642131 7:10768509-10768531 GCCAGGGCCAGGCCCAGGAGTGG + Intergenic
1022192825 7:28033570-28033592 CACAGGGCACACCCCAGCTGAGG + Intronic
1022537422 7:31106769-31106791 CCCAGGGCCTGCCCAAGGGGAGG - Exonic
1023035653 7:36129288-36129310 CCCGGGGCCCGGCCCAGATGTGG - Intergenic
1023912903 7:44568038-44568060 CACAGGGGCTGACCCAGCAGTGG + Intronic
1024065312 7:45727268-45727290 CCCAGCGCGGGCCCGAGCAGGGG - Intergenic
1024117717 7:46209255-46209277 CCCATGTCCATCCCCAGCAGTGG - Intergenic
1024258757 7:47558701-47558723 CCTGGGGCCCCCCTCAGCAGAGG + Intronic
1024556500 7:50607719-50607741 CCCAGTGCCCTCCCTAGCTGAGG + Intronic
1025745599 7:64239932-64239954 CCCAGGGCCCAGCCCACAAGTGG + Intronic
1026675248 7:72423382-72423404 CCCAGGGCAGGGACCAGCAGAGG + Intronic
1026880094 7:73902342-73902364 CCCATGTCCCTCTCCAGCAGGGG + Intergenic
1028762416 7:94510233-94510255 CCCACGGCCTGCCCGGGCAGAGG - Intronic
1029849310 7:103446009-103446031 CCGCGGGCCCACCCGAGCAGGGG - Intronic
1034276533 7:149826326-149826348 CCCAGGCCCTGCCCCAGCTGTGG + Intergenic
1034716998 7:153252784-153252806 CCCATGGCACTCCCCAGCATGGG + Intergenic
1034879171 7:154750519-154750541 CCCAGGGAGCGCCCCCGCCGTGG - Intronic
1034935416 7:155196971-155196993 CCCAAGGCCAGCTCCAGCTGTGG - Exonic
1035184042 7:157111950-157111972 CCCATGGCCCGCCTCACCAGTGG - Intergenic
1035469147 7:159098563-159098585 CCAAGGGGCCGCACCAGCCGTGG - Intronic
1035589236 8:800500-800522 CACAGGCCCCGGCCCAGCTGTGG - Intergenic
1035715108 8:1748007-1748029 CCCAGAGGCCTCCCCAGAAGCGG + Intergenic
1036620633 8:10422784-10422806 CCCAGGGCCTGCCTCTGCATAGG - Intronic
1036691824 8:10949149-10949171 CCTAGAGCCGGCCCCTGCAGAGG - Intronic
1037588555 8:20294784-20294806 CCCATGGTCATCCCCAGCAGAGG - Intronic
1038319713 8:26514944-26514966 ACCACCGCCCGCCCCAGCAGGGG - Intronic
1039478556 8:37854947-37854969 CTCAGGGCCCGCCCCTGCCCTGG + Intergenic
1040603198 8:48904365-48904387 CCCAGGGCCCGCTCCTGTGGAGG + Intergenic
1041935122 8:63324870-63324892 CCCAGAGGCACCCCCAGCAGAGG + Intergenic
1042360910 8:67882220-67882242 CCCAGAGTGTGCCCCAGCAGGGG - Intergenic
1043666784 8:82825255-82825277 CCCAGAGCAGGCACCAGCAGTGG - Intergenic
1044527962 8:93273526-93273548 CCCAGAGACTGCCCCAGCCGTGG - Intergenic
1046099986 8:109603078-109603100 CCCAGTGTCCGCCCCAGGAGGGG + Intronic
1046138666 8:110062322-110062344 CCCAGAGGCACCCCCAGCAGAGG + Intergenic
1048345322 8:133571263-133571285 CCCACGGGCGGCCCCAGCGGAGG + Intronic
1049098162 8:140560922-140560944 GCCAGGCCCAGCCCCAGCCGTGG + Intronic
1049198763 8:141329724-141329746 GCCAGGGCGGCCCCCAGCAGCGG + Intergenic
1049281843 8:141753423-141753445 CCCAGGGCCTGTCTCAGCAGGGG - Intergenic
1049337324 8:142093437-142093459 CCCAGAGCCCGCCCCTGCCCAGG + Intergenic
1049379359 8:142304339-142304361 CTCAGGTTCCGGCCCAGCAGTGG + Intronic
1049425239 8:142535255-142535277 CCCAGGGCCAGCTGGAGCAGAGG + Intronic
1049487663 8:142874925-142874947 CCCAGGCCCCTCCCCAGCCCGGG + Intronic
1049587715 8:143439828-143439850 CCCAGGGCCCCCCTCACCAAGGG - Intronic
1049665536 8:143841100-143841122 CCCAGGCCCCGCCCCCCCGGAGG + Intergenic
1049709821 8:144058447-144058469 CCCAGGCCCAGGCCCAGGAGTGG + Intronic
1056561237 9:87731794-87731816 CACAGGGCCTTCACCAGCAGTGG - Intergenic
1056764698 9:89437536-89437558 CTCAGGGCGCACCGCAGCAGTGG - Intronic
1056793290 9:89639903-89639925 GCCTGGGCCCACCACAGCAGAGG + Intergenic
1056921014 9:90789393-90789415 CCCAAGGCCTGCCCCTGCTGGGG - Intergenic
1057280385 9:93706862-93706884 CCCAAGGCCCAGCCCTGCAGTGG - Intergenic
1057441181 9:95084821-95084843 CCCAGGGCCCCTTCCAGCAGGGG + Intronic
1057441812 9:95088972-95088994 TCCAGGGGCAGCCCCAGCACGGG - Intergenic
1057776968 9:98019175-98019197 CCCAGCGCCAGCCCTGGCAGAGG + Intergenic
1058746318 9:107994657-107994679 CTGAGGGCCCTCCCCAGCAAAGG + Intergenic
1060225289 9:121786574-121786596 CCCAGGGTGGGCCCCAGGAGTGG - Intergenic
1060966030 9:127712854-127712876 CCCATGGCCCACCCAAGGAGAGG + Exonic
1061075899 9:128341082-128341104 CCCATAGCCCGCCATAGCAGAGG - Intronic
1061191495 9:129085202-129085224 CCCAGGCCCCCACACAGCAGTGG + Exonic
1061419391 9:130464904-130464926 CCCAGGGCAGGGCCGAGCAGTGG + Intronic
1061540786 9:131277107-131277129 CCCCGCGCCCGCCCCGTCAGTGG + Intergenic
1062173289 9:135147339-135147361 GCCAGGGCCAGCCCCATCAGCGG - Intergenic
1062338175 9:136081711-136081733 CCCAGGGCCCGAGCCAGGAGGGG - Intronic
1062339995 9:136089628-136089650 CCCAGGGCCTCCCCCAACTGTGG - Intronic
1062548996 9:137077429-137077451 CCCGGGGCCCGCCCCACTGGGGG + Intergenic
1062632247 9:137468525-137468547 TCCAGGGTCCCCCCCAGCTGTGG - Intronic
1186485046 X:9927830-9927852 TCCAGGTCACGCCCCAGCAAGGG - Intronic
1187152949 X:16697934-16697956 CCCAGGCCCCGGCACAGAAGAGG + Intronic
1187225997 X:17375811-17375833 CCCTGCGCCCGGCCCAGCAGTGG + Exonic
1187226125 X:17376373-17376395 CCTCGCGCCCTCCCCAGCAGCGG + Intronic
1187907375 X:24079999-24080021 CACCGTGCCCGGCCCAGCAGAGG - Intergenic
1189325257 X:40107724-40107746 CCCAGGGCCCGCGCCGGCTCGGG - Intronic
1190218586 X:48496269-48496291 CCCAGTCCCCGCCACAGCATAGG + Intergenic
1192178627 X:68901622-68901644 CCCAGGGCCTGACTCAGGAGGGG + Intergenic
1192561768 X:72131975-72131997 CCCAAGGCCCGCCCCTGCGTGGG - Intergenic
1192848609 X:74930377-74930399 CCCTGAGCCTGCCCCAGGAGTGG + Intergenic
1195732554 X:107981382-107981404 GGCAGGGCCTGCCCCCGCAGAGG - Exonic
1198031914 X:132761412-132761434 CCAGGAGCCCACCCCAGCAGGGG + Intronic
1199769384 X:150964667-150964689 CCCAGAGGCCACCGCAGCAGTGG + Intergenic
1200251688 X:154557490-154557512 CTCCGTTCCCGCCCCAGCAGAGG + Intronic
1200253895 X:154569174-154569196 CTCCGTTCCCGCCCCAGCAGAGG + Intergenic
1200263874 X:154635234-154635256 CTCCGTTCCCGCCCCAGCAGAGG - Intergenic
1200266079 X:154646926-154646948 CTCCGTTCCCGCCCCAGCAGAGG - Intergenic
1200792570 Y:7312719-7312741 CCTTGGGCTCCCCCCAGCAGGGG + Intergenic