ID: 1140476225

View in Genome Browser
Species Human (GRCh38)
Location 16:75240405-75240427
Sequence CCAGGGCCCGCCCCAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 328}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476217_1140476225 12 Left 1140476217 16:75240370-75240392 CCACCGTAATGAAGGCATGAGCA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1140476225 16:75240405-75240427 CCAGGGCCCGCCCCAGCAGAGGG 0: 1
1: 0
2: 0
3: 36
4: 328
1140476216_1140476225 17 Left 1140476216 16:75240365-75240387 CCGTGCCACCGTAATGAAGGCAT 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1140476225 16:75240405-75240427 CCAGGGCCCGCCCCAGCAGAGGG 0: 1
1: 0
2: 0
3: 36
4: 328
1140476213_1140476225 30 Left 1140476213 16:75240352-75240374 CCAGGTGTTACCGCCGTGCCACC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1140476225 16:75240405-75240427 CCAGGGCCCGCCCCAGCAGAGGG 0: 1
1: 0
2: 0
3: 36
4: 328
1140476218_1140476225 9 Left 1140476218 16:75240373-75240395 CCGTAATGAAGGCATGAGCAATC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1140476225 16:75240405-75240427 CCAGGGCCCGCCCCAGCAGAGGG 0: 1
1: 0
2: 0
3: 36
4: 328
1140476214_1140476225 20 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476225 16:75240405-75240427 CCAGGGCCCGCCCCAGCAGAGGG 0: 1
1: 0
2: 0
3: 36
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476225 Original CRISPR CCAGGGCCCGCCCCAGCAGA GGG Intronic
900185335 1:1330758-1330780 CCAGGGCCCTCCCCAGCTGCAGG + Intergenic
900287153 1:1907240-1907262 CCAGGGGCAGTCCCAGGAGAAGG - Intergenic
900317952 1:2068821-2068843 CCAGGCGCCGGCCCAGCACATGG - Intronic
900344426 1:2204370-2204392 CCAGGGCACGTCCCAGAAGGGGG - Intronic
901492155 1:9602108-9602130 CCAGGTGCAGCCCCAGCAGCAGG - Exonic
901628097 1:10634923-10634945 CCAGGCCCCGCCCCAGAGGGTGG - Intergenic
902110506 1:14074459-14074481 CCAGGTCCATCCCCAGGAGAGGG - Intergenic
902333987 1:15744426-15744448 CCAGGGCACGGCCCAGCAGCTGG - Exonic
902373181 1:16017834-16017856 CCAGGACCCGCCCATGGAGAAGG - Exonic
902417657 1:16250992-16251014 CCAGGGCCTGCCCAAGGAGATGG - Exonic
902472277 1:16657229-16657251 CCAGGGCCCTTCCCTGCAGCTGG - Intergenic
902486526 1:16750217-16750239 CCAGGGCCCTTCCCTGCAGCTGG + Intronic
902504358 1:16929827-16929849 CCAGGGCCCTTCCCTGCAGCTGG + Exonic
902642224 1:17774347-17774369 CCAGGGCCAGACCCAGCACCAGG + Intronic
902837097 1:19054297-19054319 CCAGGGCCCGCCCGAGGGTAAGG + Intergenic
903165574 1:21518088-21518110 CCAGGGCCCACCCCAGGTGTGGG + Intronic
903165750 1:21519267-21519289 CCAGGGCCCACCCCAGGTGTGGG - Intronic
904325057 1:29722989-29723011 CCAGGTCTATCCCCAGCAGAAGG - Intergenic
904433965 1:30482240-30482262 CCAGGTCTATCCCCAGCAGAAGG + Intergenic
904949932 1:34228785-34228807 CAAGGTCCAGCCCCAGGAGAGGG + Intergenic
906142334 1:43541104-43541126 CCAGGGCCCTACAGAGCAGACGG - Intronic
906286536 1:44591546-44591568 CCAGGGACTGGCCCAGCACAAGG - Intronic
907248103 1:53120742-53120764 CCAGGGCCTGACCCAGCACCTGG + Intronic
907257951 1:53194365-53194387 CCAGGGCCATCCCCAGGAAAAGG + Intergenic
912713703 1:111967236-111967258 TCAGCACCCTCCCCAGCAGAGGG - Intronic
912727773 1:112074851-112074873 CCAGGGACAGGCCCAGCAGATGG + Intergenic
915461062 1:156070802-156070824 CCAGGGCCCTCAGCACCAGATGG - Intergenic
915529994 1:156497885-156497907 CCAGGGACGACCACAGCAGAGGG + Intronic
917965858 1:180178140-180178162 CCTGGGCCTGCCCCAGCACATGG + Intronic
919917000 1:202144856-202144878 CCAGGGGCCGCACCCGCAGGTGG + Intergenic
921479785 1:215650725-215650747 ACCGGGCCAGCCCCACCAGAAGG - Exonic
922538656 1:226402463-226402485 CCAGTCCCAGCCCCAGCAGTGGG + Intronic
922800939 1:228364499-228364521 GCAGGGCCTGGCCCAGGAGAAGG + Intronic
922881570 1:228985121-228985143 CCAGGGCCTGCACCAGCTGCTGG + Intergenic
923515513 1:234694834-234694856 CCACTGGCCGCTCCAGCAGATGG + Intergenic
924121855 1:240808284-240808306 CCAGCACTTGCCCCAGCAGAGGG - Intronic
1063064100 10:2591272-2591294 CCAAGGTACGCCCCTGCAGAAGG + Intergenic
1063623056 10:7666865-7666887 CCAGGCACAGCCCCAGCAGCAGG + Exonic
1065963111 10:30750279-30750301 CCAGAGCCCCCACCTGCAGATGG + Intergenic
1066186672 10:33016207-33016229 CCAGGGCCTGCCTCAAGAGAAGG - Intergenic
1067482633 10:46613641-46613663 CCTGGCCCTGCCCCAGCAGTAGG - Intergenic
1067612118 10:47728023-47728045 CCTGGCCCTGCCCCAGCAGTAGG + Intergenic
1067756284 10:49008278-49008300 CCTGGCCCCACCACAGCAGAGGG + Intergenic
1068589480 10:58838939-58838961 CAAGGCCCAGCCCTAGCAGAAGG - Intergenic
1069962648 10:72087744-72087766 CCCGGGCCTGCCCCAGCCGCTGG - Intronic
1071627540 10:87188266-87188288 CCTGGCCCTGCCCCAGCAGTAGG + Intronic
1074399054 10:113126786-113126808 CCAGGGCCCGCGCCGGCCGCGGG - Intronic
1075069884 10:119313767-119313789 ACAGGGCCCCTCCCAGCACATGG - Intronic
1075796516 10:125123855-125123877 CCAGGGCCACACCCAACAGAGGG + Intronic
1076642142 10:131925876-131925898 CCAGGCCCCTCCCCAGCATAAGG + Intronic
1076929427 10:133520303-133520325 CCCGGGCCCCGCCCACCAGAGGG - Intergenic
1077116938 11:889438-889460 GATGGGCCCACCCCAGCAGATGG - Intronic
1081616662 11:44595249-44595271 CCCAGACCCACCCCAGCAGATGG + Intronic
1081850674 11:46273167-46273189 CCAGGGCCTTCCACAGCAGCGGG - Intergenic
1082802666 11:57426142-57426164 CCAGGGCCTGCCCCTGCACGTGG - Exonic
1083073892 11:60017265-60017287 CCCTGGGCTGCCCCAGCAGAGGG + Intergenic
1083427316 11:62595002-62595024 CCAGGGGCAGCCGCACCAGAGGG + Exonic
1083628928 11:64085953-64085975 CCAGCCCCTGCCTCAGCAGATGG + Intronic
1084155997 11:67312802-67312824 CCAGGCCCTGCCCCAGGAGATGG - Intergenic
1084203856 11:67579645-67579667 CCAGTGCCTCACCCAGCAGAGGG - Intergenic
1088100698 11:106152369-106152391 CCAGGCTCCTCCCCAGCATAAGG - Intergenic
1091266247 11:134273299-134273321 GCAGGGCCACTCCCAGCAGAGGG - Intergenic
1091357184 11:134946156-134946178 CCTGGGCTGGCCCCAGCTGAGGG + Intergenic
1092182112 12:6453063-6453085 GCAGAGCCCCACCCAGCAGAGGG + Exonic
1092657466 12:10702096-10702118 CCACGACCTGCCCCAGCAGTTGG - Exonic
1092964783 12:13631098-13631120 CCAGGTCCCTCCCCAACACATGG + Intronic
1095501666 12:42846663-42846685 CAAGGGCAAGCCCCTGCAGAGGG - Intergenic
1096156101 12:49342345-49342367 CCTGGGCCCGGCCCGGGAGAGGG + Intergenic
1096292378 12:50352862-50352884 CCAGGGCCTGCGCCTGCTGAGGG + Exonic
1096292541 12:50353438-50353460 CCAGGGCCTGCGCCTGCTGAGGG + Exonic
1096610632 12:52798958-52798980 TCGGGGACCTCCCCAGCAGATGG + Intergenic
1096688929 12:53307623-53307645 CCTGGGCCCGCCCAAGCACTGGG + Exonic
1100187102 12:92150503-92150525 CCAGGGCCCGCCTCAGTTGCTGG - Intergenic
1101875419 12:108593882-108593904 CCCCTGCCCGGCCCAGCAGAGGG + Intronic
1103407597 12:120686968-120686990 CCAGGCGCCGGCCCAGCAGTCGG - Exonic
1103623124 12:122200811-122200833 CCAGGCCCCGGCCCAGCACCTGG - Exonic
1103969886 12:124663934-124663956 CCCGGGCCCACCCCCGGAGATGG - Intergenic
1104018330 12:124975237-124975259 CCAGGACCTGCCCAAGCAGGGGG - Intronic
1104934334 12:132356455-132356477 CCCTGCCCGGCCCCAGCAGAAGG + Intergenic
1104969987 12:132526861-132526883 CCAGGGCCTCCCCCAGCAGGAGG - Intronic
1105777634 13:23678034-23678056 CCAGGGCCAGCAGCTGCAGAGGG - Intergenic
1107467552 13:40664834-40664856 CCCGCGCCCGCCCCCGCCGAGGG + Intronic
1109679467 13:65730990-65731012 CCAGGTCCCTCCCCAACACATGG - Intergenic
1112013075 13:95308231-95308253 CCAGGCCCCTCCCCTGCATAAGG - Intergenic
1113255418 13:108499972-108499994 AGAGGGCCCGCCGGAGCAGAGGG - Intergenic
1113467161 13:110520470-110520492 CATGGGCCCCCCCCAGCACATGG - Intergenic
1113728365 13:112622551-112622573 CCGGCTCCCACCCCAGCAGAGGG - Intergenic
1113728384 13:112622607-112622629 CCAGCTCCCACCCCAGCAGAGGG - Intergenic
1113842627 13:113369094-113369116 GCAGGGCAGGCCCCAGAAGAAGG - Intergenic
1113877171 13:113601678-113601700 CCAGGCCCGGCCCCAGAGGAAGG + Intronic
1113992767 14:16041597-16041619 GCAGGGCCCTCCCCGGCAAAGGG - Intergenic
1115779981 14:36758406-36758428 CCAGGGCATGACCCAGGAGAGGG + Intronic
1115786991 14:36837396-36837418 CCAGGGCAAGACCAAGCAGAGGG + Intronic
1116950240 14:50872373-50872395 CTTGGGCCCGGGCCAGCAGAGGG - Intronic
1117019061 14:51550543-51550565 CCAGTGCCAGCCTCATCAGAGGG + Intronic
1118641744 14:67798889-67798911 CCAGGCCCCGCCCCCGGGGAGGG + Intronic
1119436204 14:74599516-74599538 GCCGGGCCCTGCCCAGCAGAGGG - Intronic
1121271574 14:92641395-92641417 CCAGGGGCCGCCTGTGCAGAGGG + Intronic
1122114956 14:99522991-99523013 CCCTGGCCCGGCCCAGCAGAAGG + Intronic
1122901119 14:104782699-104782721 TCAGGGCCTACCCCAGGAGACGG + Intronic
1122951908 14:105049905-105049927 CCAGTGCCCGGCACAGCACAGGG - Exonic
1125725712 15:41867160-41867182 CCAGGCCCTGCCCCAGCCCAGGG - Intronic
1126079556 15:44946078-44946100 CGAGGGCCTATCCCAGCAGATGG + Intergenic
1128241642 15:66105340-66105362 GCAGGGCCCGGCCTTGCAGAAGG - Intronic
1129248188 15:74292731-74292753 CCAGGGCCAGCCCCAGGGTAGGG + Intronic
1129424107 15:75452175-75452197 CCAGGCCCCGCCCCAAGAGTCGG + Intronic
1129741087 15:77989956-77989978 CCAGGGCCAGCCCTAGCAGTGGG - Intronic
1129844632 15:78762596-78762618 CCAGGGCCAGCCCTAGCAGTGGG + Intronic
1129900207 15:79141971-79141993 CCAGGTCCCTCCTCAGCAGGTGG + Intergenic
1130257195 15:82331270-82331292 CCAGGGCCAGCCCTAGCAGTGGG - Intergenic
1130597757 15:85258720-85258742 CCAGGGCCAGCCCTAGCAGTGGG + Intergenic
1131058607 15:89391022-89391044 GCAGGCCCTGGCCCAGCAGAAGG + Intergenic
1131560190 15:93432736-93432758 CCAGCCCCCGGCCCAGCTGACGG - Intergenic
1132110290 15:99097744-99097766 CCAGGGCCCAGCCCAGCACCAGG + Intergenic
1132302410 15:100784203-100784225 CCAGGGCAAGCTGCAGCAGAGGG + Intergenic
1132532224 16:458103-458125 ACAGGGCCAGCCCCAGCTAAGGG - Intronic
1132537292 16:488789-488811 CCAGGGCACCCCCGAGCTGAGGG - Intronic
1132570151 16:640995-641017 ACAGGGACCCCCCCAGCACAGGG + Intronic
1132570188 16:641076-641098 CCAGGGATCCCCCCAGCACAGGG + Intronic
1132576035 16:664607-664629 CCAGGGCCCTCCCGGGGAGATGG + Intronic
1132684041 16:1154836-1154858 CCAGGGGGCCCCCCAGCAGGTGG + Intronic
1132708881 16:1257879-1257901 CCAGGACCAGCCTCAGCGGAGGG + Intronic
1132809180 16:1789566-1789588 CCAGGGTCCTCCCCTGCTGAAGG - Intronic
1132814790 16:1820566-1820588 CCTGGGCCAGCTCCAGCAGGTGG + Intronic
1132833054 16:1938890-1938912 CCCAGGCCTGTCCCAGCAGAAGG + Exonic
1132872503 16:2122106-2122128 CCAGAGGCCACCCCAGCTGAGGG + Intronic
1133002641 16:2858792-2858814 CCAGGGCTCGGCCAAGCAGGGGG + Intergenic
1133847273 16:9466989-9467011 CCAGGCGCAGCCCCAGCAGCAGG + Intergenic
1134551600 16:15141306-15141328 CCAGAGGCCACCCCAGCTGAGGG + Intergenic
1136268118 16:29132545-29132567 TGAGGCCCTGCCCCAGCAGAAGG - Intergenic
1136514928 16:30762351-30762373 CCAGAGCCCTCACCAGCAGGAGG - Exonic
1136641377 16:31568586-31568608 CCACGACCTGCCCCAGCAGTTGG - Intergenic
1137620075 16:49870200-49870222 CCAGGGACCTGCCCAGGAGAGGG - Intergenic
1138199321 16:55077430-55077452 CCAGGGCCTGACCCAGCATCTGG - Intergenic
1138343684 16:56307159-56307181 CCAGTGCCCTCCCCAGGAGGGGG + Intronic
1138912097 16:61413312-61413334 CCAGTGACTGCCACAGCAGATGG + Intergenic
1139587231 16:67911808-67911830 CCAGCCCCCTCCCCAGCAGGAGG - Intronic
1140473250 16:75226410-75226432 CCAGGGTCCCCCCCACCACATGG - Intergenic
1140476225 16:75240405-75240427 CCAGGGCCCGCCCCAGCAGAGGG + Intronic
1141841886 16:86578909-86578931 CCAGGACGCGCCCGAGCAGAGGG + Exonic
1142049771 16:87950906-87950928 GCAGGACCCGCCGCAGCAGCAGG + Intronic
1142071428 16:88092883-88092905 TGAGGCCCTGCCCCAGCAGAAGG - Intronic
1142686130 17:1577922-1577944 CCAGGGCCAGCCCCAGGACTCGG + Intronic
1142867567 17:2799969-2799991 CCAGGGTCTGCCCCAGGAGCAGG + Intronic
1143007526 17:3846392-3846414 CCAGGTCCCGCCCGCGCAGCCGG - Intergenic
1143587334 17:7856799-7856821 CCATGGCCAGGCCCAGCACACGG + Exonic
1143588026 17:7861222-7861244 CCAGGGCCCAGCACAGGAGAAGG + Exonic
1144660174 17:17063026-17063048 CCAGGGCCTGCCCCCGCACATGG - Intronic
1144960012 17:19039607-19039629 CCAGAGCCAGCCCCATCAGCAGG - Intronic
1144975148 17:19134917-19134939 CCAGAGCCAGCCCCATCAGCAGG + Intronic
1147135270 17:38430410-38430432 CCAGGGTCAGCCCGAGGAGAGGG - Intronic
1147262520 17:39216970-39216992 CCAGGGCCCACCCCACAGGAAGG + Intronic
1148327108 17:46789765-46789787 CCAGGGCCAGGCCCAGCTGGAGG - Intronic
1148752373 17:49952633-49952655 GCAGAGCCTGCCCCAGCAGAAGG - Intergenic
1148798388 17:50208457-50208479 CCAGAGCTCTCCCCAGCACACGG - Intergenic
1150131608 17:62672203-62672225 CCAGGTGCCACCCCAGCTGAAGG + Intronic
1150212242 17:63447537-63447559 GCAGGGCCCACCCCCTCAGAGGG + Intergenic
1150244361 17:63662963-63662985 CCACGCCCGGCCCCAGAAGAGGG + Intronic
1151757101 17:76081360-76081382 CCAAGTCCCACCCCAGCAGCTGG + Exonic
1152039462 17:77893576-77893598 GCATGGCCTGCCCCAGCAAAAGG + Intergenic
1152107945 17:78341862-78341884 CCAGGGGCCGCCCCAGCTGCAGG + Intergenic
1152571636 17:81123701-81123723 GTAGGGCCCGCACCAGCAGGGGG + Intronic
1152676780 17:81645312-81645334 CCAGTGCCAGCCCCAGCATGGGG - Exonic
1152832074 17:82503593-82503615 CCAGGGCCCACTTGAGCAGAGGG - Intergenic
1152861254 17:82698112-82698134 CCAGCGCCCGGCCCAGCCGCGGG + Intronic
1153246081 18:3073774-3073796 CCAGGCCCCTCCCCTGCATAAGG - Intronic
1156104330 18:33639381-33639403 CCACCGCCCTCCCCAGCATAGGG + Intronic
1156965886 18:43091565-43091587 GCAGGCCCAGCCACAGCAGAGGG - Intronic
1157572621 18:48723175-48723197 CCAGGGAGGGGCCCAGCAGACGG - Intronic
1158597335 18:58827914-58827936 CCAGGGCCAGCAGCTGCAGAGGG - Intergenic
1158903037 18:61984134-61984156 CCAGGTCCCTCCCTAGCACATGG + Intergenic
1161000797 19:1909816-1909838 CCAGGGCCCACCACAGCTGCAGG + Intronic
1162524629 19:11200330-11200352 CCAGCGCCTGCCCCAGCTGATGG - Exonic
1162582191 19:11538294-11538316 ACAGTGCCCGGCACAGCAGAGGG - Intergenic
1163234164 19:16021339-16021361 CCAGGGCCAGCCCTAGCTCAGGG + Intergenic
1165075270 19:33276839-33276861 CAAGGGGCTGCCCCAGAAGAAGG - Intergenic
1165108978 19:33490207-33490229 CCAGGCCCGGCCCCAACACAAGG + Intronic
1165779773 19:38425708-38425730 GCAGGGCCTGGCCCAGGAGAGGG - Intronic
1166230952 19:41425644-41425666 CCAGGGGCCGTACCAGCAGCAGG + Exonic
1167155377 19:47735361-47735383 CCAGGGTGAGCCCCAGCAGGAGG + Intronic
1167464732 19:49644850-49644872 CCAGCGCCCACCCAAGCACAGGG + Intronic
1167696560 19:51018862-51018884 CCAGGGGCCGAGCCAGAAGAAGG + Intronic
1168316169 19:55485678-55485700 CCAGGCCCCGGCCCCCCAGAAGG - Exonic
1168344268 19:55642727-55642749 CCGGGGCCCGCCCCAGCGCGAGG + Exonic
1202704674 1_KI270713v1_random:14023-14045 CCAGGGCCCTTCCCTGCAGCTGG - Intergenic
925149236 2:1603157-1603179 CCCCAGCTCGCCCCAGCAGACGG - Intergenic
925358925 2:3263636-3263658 CCAGCGCCCTCCCCAGGAGGTGG + Intronic
927089625 2:19700650-19700672 CCAGGCCACCACCCAGCAGAAGG + Intergenic
927187480 2:20492202-20492224 CCAGGCCCAGCCCCCACAGAGGG - Intergenic
929017077 2:37508500-37508522 CCAGGAACTGCCCCAGCTGAAGG - Intergenic
929944486 2:46360283-46360305 CCTGGGCCTGCCCCAGGAAAGGG + Intronic
930051278 2:47218058-47218080 CCAGGTGAGGCCCCAGCAGAGGG + Intergenic
934477485 2:94603110-94603132 CCAGGAACTGCCCCAGCACATGG - Exonic
934521874 2:95025062-95025084 GCTGTGCCGGCCCCAGCAGAAGG - Intergenic
935068843 2:99676142-99676164 CCAGGCCCTACCCCAGCTGATGG + Intronic
935706918 2:105864994-105865016 CCAGAGCCCTCCCCAGCAGGAGG + Intronic
938109193 2:128552771-128552793 ACAATGCCAGCCCCAGCAGAGGG - Intergenic
942317601 2:174709798-174709820 CCTGGGCCAGCCCCTGCGGAGGG - Intergenic
942578644 2:177392918-177392940 CCCGGGGCCGGCCCAGCAGATGG - Exonic
946158520 2:217822160-217822182 CCAGGCCCCGCCTCAGAACATGG + Intronic
947199073 2:227598804-227598826 TAAGGGCCTCCCCCAGCAGAAGG + Intergenic
947213399 2:227728244-227728266 TAAGGGCCTCCCCCAGCAGAAGG + Intergenic
947749560 2:232525350-232525372 GCAGGGCCTGCACCAGCAGCCGG - Exonic
948197078 2:236104181-236104203 TGAGGGCCCGCTCCAGCAGCCGG + Intronic
948399961 2:237676790-237676812 ACAGTGCCCGGCCCAGGAGATGG + Intronic
948523617 2:238557560-238557582 CCAGGGTCTGTCCCAGCACAGGG + Intergenic
948530418 2:238600298-238600320 CCAGCGCCCTCCCCAGCATCTGG - Intergenic
948627100 2:239275983-239276005 ACAGGCTCCGCCCAAGCAGATGG + Intronic
948629145 2:239291049-239291071 CCCGGGCACGCACCAGCAGGTGG - Intronic
948686600 2:239674406-239674428 CCAGGGGCTGCCCCACCAGTGGG - Intergenic
948727970 2:239946282-239946304 CCGGCCCCAGCCCCAGCAGACGG + Intronic
1170573905 20:17648366-17648388 CCAGGGCCTGCCTCAGCTGTGGG - Intronic
1170596108 20:17806989-17807011 CTCGGGCTCTCCCCAGCAGAGGG - Intergenic
1171769087 20:29307730-29307752 GCAGGGCCCTCCCCGGCACAGGG + Intergenic
1171812264 20:29754166-29754188 TCAGGGCCCTCCCCGGCACAGGG + Intergenic
1173249004 20:41354759-41354781 CCAGGGCCAGGGCCAGCACAGGG + Intronic
1174402699 20:50284385-50284407 CAAGGGCCGGCCCAAGCAAAGGG - Intergenic
1174488353 20:50875042-50875064 CCACGGCCTGCACCAGAAGAAGG - Intronic
1174540432 20:51285152-51285174 CCAGGGCCAGCCCCAGGGGGAGG + Intergenic
1175267547 20:57711607-57711629 CCAGGCCCCGGCCCAGGAGTGGG + Intergenic
1175427898 20:58881521-58881543 CCAAGGCCAGCCCAAGCAAACGG - Intronic
1175522202 20:59609138-59609160 CCTGGACCCGGCCCTGCAGAAGG - Intronic
1175803345 20:61813573-61813595 CCAGGCCCAGCCCCAGAAGCTGG - Intronic
1175950048 20:62578510-62578532 TCATGGCCCGCCCCAGCAGGAGG - Intergenic
1176183725 20:63766779-63766801 CCAGGGGAGGCTCCAGCAGATGG + Intronic
1176263797 20:64197994-64198016 ACCGCGCCCGGCCCAGCAGAAGG - Intronic
1179921698 21:44510870-44510892 CCCGGCCCCGCCCCCGCCGAGGG - Intronic
1180057272 21:45365412-45365434 CCAGAGCCGGCCGCACCAGAAGG + Intergenic
1180136897 21:45867810-45867832 CCAGTGCCATCCACAGCAGAAGG + Intronic
1180314503 22:11265922-11265944 GCAGGGCCCTCCCCGGCAAAGGG + Intergenic
1180871180 22:19148209-19148231 CCAGGGTGCTCCCCAGCAGAGGG - Intergenic
1180968559 22:19803076-19803098 CCAGGGCTCGCTGCATCAGAAGG + Intronic
1181559675 22:23692809-23692831 CCAGGGCCAGCACCAGCACCAGG + Exonic
1181625515 22:24119839-24119861 GCAGGGCCAGCCCCAGGAGTGGG + Intronic
1181803077 22:25359782-25359804 CCAGGGCCAGGCCAAGCAGAGGG - Intronic
1181978939 22:26752485-26752507 CCCGGCCCCACCCCAGCAGAAGG - Intergenic
1182428457 22:30286981-30287003 CCAGGGGGCGCCCCAGCCCACGG - Intronic
1182810260 22:33110221-33110243 TCAGGCCCCACCCCTGCAGATGG - Intergenic
1183600142 22:38835344-38835366 CCAGGGACAGACCCAGCAGGTGG + Intronic
1183648909 22:39142514-39142536 ACAGGGTCTGCCCCAGCAGGAGG - Intronic
1184003302 22:41690809-41690831 CCAGGACCCGCTTCAGCACAAGG + Exonic
1184102547 22:42348393-42348415 CCAGGGCCCCCGCACGCAGAAGG + Intergenic
1184132682 22:42526865-42526887 ACCGCGCCCGGCCCAGCAGAGGG + Intergenic
1184189323 22:42884501-42884523 CCAGGGCACACCCCAGTACATGG - Exonic
1184225445 22:43126954-43126976 CCAGGGCCGGCCTCAGCTCAGGG + Intronic
1184273286 22:43396827-43396849 CCAGGCCCTGCCCCAGCCAAGGG - Intergenic
1184403434 22:44286782-44286804 CCAGGGCTTGCCACAGCAGCTGG + Intronic
1185015327 22:48339451-48339473 CCTGGGGCCGCCTCTGCAGAGGG + Intergenic
950487865 3:13283293-13283315 CCAGGGGCGGTCCCAGCAGGCGG - Intergenic
950492839 3:13316602-13316624 CCAGGGCCTGCCCATCCAGAAGG - Exonic
950663325 3:14480485-14480507 CCTGGGCCCTCCCAAGCAGGAGG - Intronic
953984460 3:47430786-47430808 GCAGGGCCCAGCCCAGCTGAGGG + Intronic
954124782 3:48521830-48521852 CCAGGGCCCCGCCCTGCTGATGG + Intronic
954373973 3:50184696-50184718 CCAGGGGCCGCCGCTGCAGAGGG - Exonic
954397814 3:50302377-50302399 GCAGTGCCCGCCCCAGCTGGAGG + Exonic
954442696 3:50530467-50530489 CCCGGCCCCGCCGCAGCAGCCGG - Intergenic
954635168 3:52067240-52067262 GCAGGGCCTTCCCCAGGAGATGG - Intergenic
954682105 3:52351400-52351422 TCAGGGCCCTGCCCAGGAGAGGG + Intronic
956264328 3:67380222-67380244 CCTGGGCCCTTCCCAGCAAAAGG - Intronic
956767013 3:72492400-72492422 CCAGGGCCTGCCCCAGCCCATGG + Intergenic
957040217 3:75330511-75330533 CCAGAGCCCTCCCCACCTGAAGG - Intergenic
961045012 3:123702091-123702113 CCAGAGCCCTCCCCACCTGAAGG - Intronic
961372854 3:126441808-126441830 CCAGGACCAGCTCCAGCAGCTGG - Exonic
961454822 3:127018700-127018722 CCAGGGCCTGGCCCTGCAGCAGG + Intronic
962891713 3:139677997-139678019 TTAGGGCCCGCCCCAGCGAAGGG - Exonic
965109424 3:164402111-164402133 CCCGGGCCAGCCGCTGCAGAGGG - Intergenic
968763974 4:2458648-2458670 CCTGGTCCCGCCCCAGCCCAGGG - Intronic
969724059 4:8908674-8908696 CCAGGCCCCCGCCCAGCACAGGG - Intergenic
971043364 4:22778857-22778879 CCAGGGCTGGCCGCAGCAGCCGG + Intergenic
971365270 4:25972124-25972146 CCAGGGCCTGGGCCACCAGAGGG - Intergenic
972427467 4:38947335-38947357 CCATGGCCCGCCTGTGCAGAAGG - Intergenic
973182398 4:47285570-47285592 CCAGGGCCAGCACCAACAGCAGG + Intronic
974865063 4:67570018-67570040 CCAGGCCCAGCCCCAGTGGATGG + Intronic
975183373 4:71372730-71372752 CCAGGTCCCTGCCCAGTAGATGG - Intronic
980077671 4:128310512-128310534 GCAGGGGCCACCCCAGCAGAGGG + Intergenic
983627482 4:169816299-169816321 CCACCGCCAGCCCCAGTAGATGG - Intergenic
984787028 4:183576665-183576687 CCAGGGCCTGTGCCTGCAGAAGG + Intergenic
985781822 5:1875637-1875659 CCTGGGTCCTCCCCAGGAGAGGG + Intergenic
993692393 5:91018323-91018345 CCAGGTCCCGGGACAGCAGAAGG - Intronic
996021371 5:118594397-118594419 CTTGGGCCAGCCCCAGCAGATGG + Intergenic
997359141 5:133283328-133283350 CAAGGGCCAGCCCCACCAGATGG - Intronic
998386663 5:141760973-141760995 CCAGGACCCGCCCCCTCGGAAGG - Intergenic
999079069 5:148826453-148826475 CCCGGGCCAGCCCCAGGAGAAGG + Exonic
999154879 5:149450923-149450945 CGAGGACCAGACCCAGCAGAAGG - Intergenic
999175141 5:149626910-149626932 ACAGGGCCCTCACTAGCAGATGG - Intronic
1000014838 5:157267098-157267120 CCAGGTGCCTCCCCAGCACAGGG + Intronic
1003100194 6:3170906-3170928 CCAGGGCCAGCGGCTGCAGAGGG + Intergenic
1003520026 6:6850526-6850548 TCAGGGCCAGCTCCAGCACAGGG - Intergenic
1003567628 6:7233984-7234006 CAAGGACCCACCACAGCAGAAGG - Intronic
1005496171 6:26389808-26389830 CCAGGGCCGGGCCCAGAAGGGGG - Intronic
1005594632 6:27367860-27367882 CCAGGGCCCGCAAGAGCACAGGG - Intergenic
1006211817 6:32401725-32401747 CCTCTGCCCTCCCCAGCAGAGGG - Intronic
1006912173 6:37570540-37570562 CCGGAGCTGGCCCCAGCAGACGG - Intergenic
1007477708 6:42130059-42130081 CCTGGGAGCGCCCCAGCAGCTGG + Intronic
1007655183 6:43447390-43447412 CCAGGGCCAGCCACTGCAGGTGG + Exonic
1008943259 6:57070327-57070349 CCAGGGTCAGACCCAGCAGGTGG + Intergenic
1011795363 6:90947224-90947246 CCAGGGTCCGAAGCAGCAGAGGG - Intergenic
1012528549 6:100206423-100206445 CCAGGTCCCTCCAGAGCAGAGGG - Intergenic
1013048457 6:106510417-106510439 CCAGTGCCCGCGCCAGAAGGCGG - Intergenic
1014468027 6:121780515-121780537 GCTGGCCCAGCCCCAGCAGATGG - Intergenic
1014747757 6:125219723-125219745 CCAAGGCCCGCCCATGGAGAGGG - Intronic
1015910015 6:138161189-138161211 ACAAGGGCCGCCGCAGCAGAGGG - Intergenic
1017288191 6:152702603-152702625 TTAGGGACCACCCCAGCAGATGG + Intronic
1018867630 6:167758507-167758529 CCAGAGCCTGTCCCTGCAGACGG + Intergenic
1019216515 6:170447357-170447379 GCAGGGCCCGCACCAGCAGCTGG - Intergenic
1019361008 7:604162-604184 CCTGGGCCCGTCCCAGGAGGTGG - Intronic
1019511764 7:1421247-1421269 CCAGGTCCCGTCCCAGGAGCCGG - Intergenic
1019705344 7:2494733-2494755 CCAGAGCCCCACCCAGCATAGGG - Intergenic
1019728582 7:2617143-2617165 CGAGGGCCAGCCCCATTAGATGG + Intergenic
1019750361 7:2725316-2725338 CCTGGGCCCGCGGCACCAGACGG + Intronic
1020642133 7:10768510-10768532 CCAGGGCCAGGCCCAGGAGTGGG + Intergenic
1022537420 7:31106768-31106790 CCAGGGCCTGCCCAAGGGGAGGG - Exonic
1023843153 7:44107836-44107858 CCAGGCCACCCCCAAGCAGAAGG + Exonic
1024258758 7:47558702-47558724 CTGGGGCCCCCCTCAGCAGAGGG + Intronic
1024263263 7:47587562-47587584 CCAAGGCCCGCCCAGGCTGACGG - Intergenic
1024354788 7:48403357-48403379 GCAGGGCCCTCCCTGGCAGAAGG + Intronic
1024517126 7:50268502-50268524 TCAGGTCCCCTCCCAGCAGATGG - Intergenic
1026675250 7:72423383-72423405 CCAGGGCAGGGACCAGCAGAGGG + Intronic
1028762414 7:94510232-94510254 CCACGGCCTGCCCGGGCAGAGGG - Intronic
1031958799 7:127969988-127970010 CCAGTGCCCTACGCAGCAGAAGG + Intronic
1032709103 7:134447105-134447127 CCAAGGCCTGCCCCTGCACACGG + Intronic
1033921962 7:146404767-146404789 CCAAGGCCAACTCCAGCAGAAGG - Intronic
1034276535 7:149826327-149826349 CCAGGCCCTGCCCCAGCTGTGGG + Intergenic
1034994720 7:155570629-155570651 CCAGCGCAGGCCCCAGCAGCAGG + Intergenic
1035168832 7:157006736-157006758 CCAAGGCCTGGCCCTGCAGAGGG + Intronic
1035670421 8:1412800-1412822 TCACAGCCCTCCCCAGCAGATGG + Intergenic
1035912698 8:3585076-3585098 GCAGGACCCGCCCCACCGGAAGG - Intronic
1036620631 8:10422783-10422805 CCAGGGCCTGCCTCTGCATAGGG - Intronic
1045290185 8:100826256-100826278 CCAGCTCCAGCCCCAGCAGGAGG - Intergenic
1048152077 8:131904035-131904057 CCCGGCCCCGCCCCCGCGGATGG - Intergenic
1048262256 8:132955039-132955061 CCAGGGTCCTTCCCAGCAGATGG - Intronic
1049098164 8:140560923-140560945 CCAGGCCCAGCCCCAGCCGTGGG + Intronic
1049175885 8:141192588-141192610 CCTGGCCCAGCCCCCGCAGAGGG + Exonic
1049199304 8:141332064-141332086 CCAGGGCCCTTCCCGGCAGCAGG - Intergenic
1049425241 8:142535256-142535278 CCAGGGCCAGCTGGAGCAGAGGG + Intronic
1049616212 8:143576811-143576833 CCAGGGCCCTCACCAGCTGCTGG + Exonic
1049787020 8:144455905-144455927 CCAGGGGCCGGCCCAGGAGCTGG - Intronic
1049788643 8:144462997-144463019 CGAAGGCCCGCCCCTGCAGAAGG + Intronic
1050913216 9:11100791-11100813 CCAGGCCCCTCCCCTGCATAAGG + Intergenic
1054809717 9:69425297-69425319 CGAGGGACCGGACCAGCAGAAGG + Intergenic
1057302897 9:93896718-93896740 CCATGGCTCCTCCCAGCAGAGGG + Intergenic
1057441183 9:95084822-95084844 CCAGGGCCCCTTCCAGCAGGGGG + Intronic
1057724379 9:97557687-97557709 CCAGAGCCAGCCCGAGCAGCTGG + Intronic
1058498811 9:105590142-105590164 CCAGGTCCCCCCCCAGCACATGG - Intronic
1058746319 9:107994658-107994680 TGAGGGCCCTCCCCAGCAAAGGG + Intergenic
1058957025 9:109958799-109958821 ACAGGGCCAGGCACAGCAGATGG - Intronic
1060940919 9:127542396-127542418 CCAGGCCCTGCCCCAGGAGCAGG - Intronic
1061075897 9:128341081-128341103 CCATAGCCCGCCATAGCAGAGGG - Intronic
1061903129 9:133683203-133683225 AAAGGGCCAGCCCCAGGAGAGGG + Intronic
1061989650 9:134152128-134152150 CCTGGGTCCGCCCCTGCAGGAGG + Intronic
1062651630 9:137580775-137580797 CCAGGCCTCACCCCAGCAGGTGG - Intergenic
1203362813 Un_KI270442v1:232031-232053 GCAGGGCCCTCCCCGGCAAAGGG + Intergenic
1185642361 X:1595536-1595558 CGAGGGCCCGCTCCCGCAGAAGG - Intronic
1185894084 X:3843234-3843256 GCAGGGCCCTCCCCAGGAGGCGG + Intronic
1185899202 X:3881658-3881680 GCAGGGCCCTCCCCAGGAGGCGG + Intergenic
1185904319 X:3920087-3920109 GCAGGGCCCTCCCCAGGAGGCGG + Intergenic
1186485044 X:9927829-9927851 CCAGGTCACGCCCCAGCAAGGGG - Intronic
1192050411 X:67719247-67719269 TCAAGGCCTGCCCCAGAAGATGG - Intronic
1194621734 X:96181536-96181558 CCAGGCCCCTCCCCTGCATAAGG - Intergenic
1195010929 X:100731765-100731787 GGAGGGACCGCCCAAGCAGACGG + Intronic
1199996945 X:153031554-153031576 CAGGGCCCTGCCCCAGCAGATGG + Intergenic
1200001093 X:153060153-153060175 CAGGGCCCTGCCCCAGCAGATGG + Intronic
1200234416 X:154461407-154461429 CCAGGGCCTGGGCCAGCAGCAGG - Exonic
1200392235 X:155956027-155956049 CCAGGTCCCTCCTGAGCAGAAGG - Intergenic
1200864068 Y:8023840-8023862 CCAGGGTCCTGCCCAGAAGATGG - Intergenic