ID: 1140476226

View in Genome Browser
Species Human (GRCh38)
Location 16:75240406-75240428
Sequence CAGGGCCCGCCCCAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 312}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476218_1140476226 10 Left 1140476218 16:75240373-75240395 CCGTAATGAAGGCATGAGCAATC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1140476226 16:75240406-75240428 CAGGGCCCGCCCCAGCAGAGGGG 0: 1
1: 0
2: 1
3: 32
4: 312
1140476214_1140476226 21 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476226 16:75240406-75240428 CAGGGCCCGCCCCAGCAGAGGGG 0: 1
1: 0
2: 1
3: 32
4: 312
1140476216_1140476226 18 Left 1140476216 16:75240365-75240387 CCGTGCCACCGTAATGAAGGCAT 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1140476226 16:75240406-75240428 CAGGGCCCGCCCCAGCAGAGGGG 0: 1
1: 0
2: 1
3: 32
4: 312
1140476217_1140476226 13 Left 1140476217 16:75240370-75240392 CCACCGTAATGAAGGCATGAGCA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1140476226 16:75240406-75240428 CAGGGCCCGCCCCAGCAGAGGGG 0: 1
1: 0
2: 1
3: 32
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476226 Original CRISPR CAGGGCCCGCCCCAGCAGAG GGG Intronic
900185336 1:1330759-1330781 CAGGGCCCTCCCCAGCTGCAGGG + Intergenic
900227891 1:1541196-1541218 CAGGGACAGCCACAGCGGAGTGG - Intergenic
900312710 1:2041878-2041900 CAGGGCCCTGCCCAGCAGGGAGG - Intergenic
900611757 1:3547214-3547236 CAGGGCTCCCCACAGCACAGGGG + Intronic
900635341 1:3662112-3662134 CAGGGGCTGCTCCAGGAGAGTGG - Intronic
900985850 1:6072530-6072552 CAGGGCCCGTGCCAGCAGCATGG + Intronic
901156324 1:7142038-7142060 AAGGGCCCTTCCCAGCACAGAGG - Intronic
901949216 1:12727949-12727971 CAGGGCCATGCCCAGTAGAGAGG + Exonic
902333986 1:15744425-15744447 CAGGGCACGGCCCAGCAGCTGGG - Exonic
902548870 1:17207670-17207692 CAGGCCCTGGCCCAGCGGAGGGG + Intronic
903165575 1:21518089-21518111 CAGGGCCCACCCCAGGTGTGGGG + Intronic
903165749 1:21519266-21519288 CAGGGCCCACCCCAGGTGTGGGG - Intronic
903273129 1:22204501-22204523 CAGGGCCAGCACCATCAAAGAGG - Intergenic
903724588 1:25431195-25431217 CAGGGCCCGCGCCCGCGGAGTGG - Intronic
903773632 1:25779402-25779424 CTGTGCCCGCCCCAGCTGAATGG + Intronic
904012844 1:27399580-27399602 CAGGGCCTACCCCAGCAGGAAGG - Intergenic
904360122 1:29965733-29965755 CAGGAGCAGCCCCAGCAGGGTGG + Intergenic
904591812 1:31619165-31619187 CAGGAGCCGCTGCAGCAGAGGGG - Exonic
904949933 1:34228786-34228808 AAGGTCCAGCCCCAGGAGAGGGG + Intergenic
905646963 1:39631881-39631903 CAGGGCCTGCTCCAGCACCGTGG - Intronic
905892435 1:41525851-41525873 CAGGGGGCGCGCCAGGAGAGGGG + Intronic
907051845 1:51334926-51334948 CTGGCCCAGCCCCAGCACAGGGG + Intronic
907245324 1:53104760-53104782 CAGGGCCCAGCCCAGGAAAGGGG + Intronic
910449908 1:87334514-87334536 CAGGGACCGCTGCAGAAGAGTGG + Intronic
911070134 1:93825743-93825765 AAGGGCCCGCAGCAGCAAAGAGG + Intronic
911370520 1:96989464-96989486 CAGTCACAGCCCCAGCAGAGGGG + Intergenic
912411616 1:109484137-109484159 CCGGGCCCCCGCCAGCTGAGGGG + Intronic
913615744 1:120558281-120558303 AGGGGCGCGCCCCTGCAGAGTGG - Intergenic
914574532 1:148952621-148952643 AGGGGCGCGCCCCTGCAGAGTGG + Intronic
915033313 1:152902433-152902455 CAGGGCCCTTCCCAGCACACTGG + Intergenic
919920917 1:202165957-202165979 CTGGGCCTGCCCCAGCAGGGAGG - Intergenic
920609687 1:207424489-207424511 CCCCGCCCGCCCCAGCAAAGTGG - Intergenic
920964194 1:210688800-210688822 CAGGGACCACACCAACAGAGAGG + Intronic
922724060 1:227914442-227914464 CAGAGGCCTCCCCAGCAGGGAGG - Intergenic
922800940 1:228364500-228364522 CAGGGCCTGGCCCAGGAGAAGGG + Intronic
923087052 1:230709962-230709984 TAGGGCCAGAGCCAGCAGAGAGG + Intronic
923471356 1:234293715-234293737 CAAGGCCAGCCCCAGGAGACTGG - Intronic
924121854 1:240808283-240808305 CAGCACTTGCCCCAGCAGAGGGG - Intronic
924383591 1:243483832-243483854 AAGGGCTCGCCCCAGGATAGGGG - Intronic
924449447 1:244164371-244164393 CAGGGACCACCCCAGAGGAGAGG - Intergenic
924552552 1:245091974-245091996 CAGGGCCCGGCCAAGCTGTGGGG - Intronic
924610068 1:245566248-245566270 CATGGCCAGCCCCAACAGAGAGG + Intronic
1063425473 10:5947001-5947023 CAGGGCCCGGCCCAGCCTTGGGG + Intronic
1067090730 10:43264764-43264786 CATGGCCCACCCCAGGGGAGGGG - Intronic
1067432730 10:46254523-46254545 CACGTGCCGCCCCAGCAGTGGGG + Intergenic
1067498097 10:46776380-46776402 CAGCCCCCGCCCCAGCTGCGCGG - Intergenic
1067596549 10:47564034-47564056 CAGCCCCCGCCCCAGCTGCGCGG + Intergenic
1067769870 10:49115438-49115460 CGGAGCCCGCGCCAGCAGCGCGG + Exonic
1070173840 10:73953845-73953867 CAGGGCCTGGCCCAGCACTGTGG - Intergenic
1070841514 10:79490972-79490994 CAGGTCCCGCCCCACCACACTGG - Intergenic
1070989395 10:80718311-80718333 GAGAGGCAGCCCCAGCAGAGAGG - Intergenic
1071954928 10:90747711-90747733 CAGGGACCACTCTAGCAGAGAGG - Intronic
1074531341 10:114300809-114300831 CAGTGGCCCCCCCAGCAGGGAGG - Intronic
1075069883 10:119313766-119313788 CAGGGCCCCTCCCAGCACATGGG - Intronic
1076989038 11:259918-259940 GAGGAGCCGCCCCAGCAGACAGG - Intergenic
1077036694 11:498846-498868 CAGGGCCAGCTCCCGCAGCGAGG + Exonic
1077069282 11:660556-660578 CAGAGCACCCCCCAGCAGCGTGG - Intronic
1077539646 11:3140532-3140554 CAGGGCCTCCCCCAGCAGAGAGG + Intronic
1077902150 11:6498098-6498120 CATGGGCCAGCCCAGCAGAGGGG - Exonic
1078079606 11:8194267-8194289 AAGGGCCCCAGCCAGCAGAGAGG - Intergenic
1080368612 11:31608603-31608625 CAGGGGCCGTACTAGCAGAGAGG + Intronic
1082004187 11:47410596-47410618 CAGGGCCTGCCCCTGGGGAGGGG + Intronic
1083365703 11:62140390-62140412 CAGGCCACACCCCAGCAGAGAGG - Intronic
1084014808 11:66371936-66371958 CGGGACCCGCCCCCGCGGAGAGG - Intronic
1084086796 11:66858637-66858659 CAGGGCCCGGCACCGCAGCGTGG - Exonic
1084155996 11:67312801-67312823 CAGGCCCTGCCCCAGGAGATGGG - Intergenic
1084296466 11:68215735-68215757 CAGAGCCCACCCCAGCATAGAGG + Intergenic
1084595746 11:70116067-70116089 CACGGACTGTCCCAGCAGAGTGG + Intronic
1084979642 11:72822327-72822349 AAGGCCCCGCCCCTGCAGGGAGG + Intronic
1085016491 11:73177479-73177501 CAGGGTCCACCCCAGCCCAGGGG + Intergenic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1088823439 11:113475183-113475205 CAGGGACCGGCCGAGGAGAGTGG - Exonic
1091274114 11:134338533-134338555 CAGGGCAGGCCCCAGCAGGCAGG - Intronic
1091293974 11:134459605-134459627 CAGGGCCTGCCCGGGCAGGGAGG + Intergenic
1092182113 12:6453064-6453086 CAGAGCCCCACCCAGCAGAGGGG + Exonic
1093975238 12:25414250-25414272 AAGGGCTCCCCACAGCAGAGGGG - Intronic
1096157537 12:49348902-49348924 CAGGGCCCCCCACAGCCCAGAGG - Exonic
1096292379 12:50352863-50352885 CAGGGCCTGCGCCTGCTGAGGGG + Exonic
1096292542 12:50353439-50353461 CAGGGCCTGCGCCTGCTGAGGGG + Exonic
1100274091 12:93055617-93055639 CTGGGACTGTCCCAGCAGAGGGG - Intergenic
1101570526 12:105949243-105949265 CATGGCCTTCCCCACCAGAGAGG - Intergenic
1102220485 12:111191069-111191091 CAGATCCAGCCCCTGCAGAGGGG - Intronic
1104035078 12:125092284-125092306 CAGGGCCTGGCCCAGAACAGAGG - Intronic
1104212893 12:126707143-126707165 CAGGGCACACACCTGCAGAGGGG + Intergenic
1104496528 12:129245688-129245710 CAGGGCAGGCCCCAGCACCGTGG + Intronic
1104866761 12:131960670-131960692 CAGGGCCTGCCCTGGCAGCGAGG + Exonic
1104969986 12:132526860-132526882 CAGGGCCTCCCCCAGCAGGAGGG - Intronic
1105890928 13:24681477-24681499 CAGGTCCTGACCCCGCAGAGGGG + Intronic
1106178775 13:27353173-27353195 GAGGCACCACCCCAGCAGAGAGG + Intergenic
1106770831 13:32959159-32959181 CAGGCACGGCCCCAGCAGCGTGG - Intergenic
1112302355 13:98241432-98241454 CAGGACACGACCCTGCAGAGAGG - Intronic
1113486236 13:110654215-110654237 TAGGGCCTGGCCCAGTAGAGAGG - Intronic
1113842626 13:113369093-113369115 CAGGGCAGGCCCCAGAAGAAGGG - Intergenic
1113877692 13:113604884-113604906 CAGGCCCCGTCCCAGGAGCGAGG + Intronic
1113992766 14:16041596-16041618 CAGGGCCCTCCCCGGCAAAGGGG - Intergenic
1115779982 14:36758407-36758429 CAGGGCATGACCCAGGAGAGGGG + Intronic
1115786992 14:36837397-36837419 CAGGGCAAGACCAAGCAGAGGGG + Intronic
1116950239 14:50872372-50872394 TTGGGCCCGGGCCAGCAGAGGGG - Intronic
1117489843 14:56235578-56235600 CAGGGCCAGCCCCTGCATACAGG - Intronic
1119424846 14:74528541-74528563 CACTGCCCGGGCCAGCAGAGAGG - Exonic
1119436202 14:74599515-74599537 CCGGGCCCTGCCCAGCAGAGGGG - Intronic
1121691219 14:95878108-95878130 CTGGGCCAGCCCCTGCACAGTGG - Intergenic
1122778013 14:104131341-104131363 CAGTGCCCTCCCCACCAGGGTGG - Intergenic
1122901120 14:104782700-104782722 CAGGGCCTACCCCAGGAGACGGG + Intronic
1122922996 14:104887607-104887629 CCGGGCCCGCCTCAGCCGGGAGG - Exonic
1122951907 14:105049904-105049926 CAGTGCCCGGCACAGCACAGGGG - Exonic
1123031924 14:105456028-105456050 CAGGCCGGGCCCCAGCACAGTGG - Intronic
1123031938 14:105456071-105456093 CAGGCCCAGACCCAGCACAGCGG - Intronic
1124584363 15:30991648-30991670 CAGCGCCCGCCCGAGCGGGGAGG + Intergenic
1128241641 15:66105339-66105361 CAGGGCCCGGCCTTGCAGAAGGG - Intronic
1128301063 15:66566495-66566517 CAGTGCCCTCCCCATCAGAAAGG + Intergenic
1129298909 15:74614690-74614712 CTGGGCCCGCCCCTGAAGCGGGG - Intronic
1129607440 15:77031728-77031750 GTGGGTCCTCCCCAGCAGAGAGG + Intronic
1129741086 15:77989955-77989977 CAGGGCCAGCCCTAGCAGTGGGG - Intronic
1129844633 15:78762597-78762619 CAGGGCCAGCCCTAGCAGTGGGG + Intronic
1130257194 15:82331269-82331291 CAGGGCCAGCCCTAGCAGTGGGG - Intergenic
1130597758 15:85258721-85258743 CAGGGCCAGCCCTAGCAGTGGGG + Intergenic
1131058608 15:89391023-89391045 CAGGCCCTGGCCCAGCAGAAGGG + Intergenic
1131368061 15:91856085-91856107 CAGGGCTGGCCCCAGGAGATAGG + Intronic
1132208492 15:100002995-100003017 CAGGGGCAGCCCCAGAGGAGGGG - Intronic
1132301975 15:100781669-100781691 CAGTGCCTGGCCCATCAGAGGGG - Intergenic
1132302411 15:100784204-100784226 CAGGGCAAGCTGCAGCAGAGGGG + Intergenic
1132522446 16:397748-397770 CAGCGAACGCCCCAGCGGAGCGG - Intronic
1132708882 16:1257880-1257902 CAGGACCAGCCTCAGCGGAGGGG + Intronic
1132791292 16:1690160-1690182 TAGGCCCCGCCGCAGCAGTGGGG + Intronic
1132872504 16:2122107-2122129 CAGAGGCCACCCCAGCTGAGGGG + Intronic
1133002642 16:2858793-2858815 CAGGGCTCGGCCAAGCAGGGGGG + Intergenic
1134456959 16:14401956-14401978 CAGGCCCCGCCCCAGCCCAATGG + Intergenic
1134551601 16:15141307-15141329 CAGAGGCCACCCCAGCTGAGGGG + Intergenic
1135186003 16:20316437-20316459 CAGGGTGTGCCCCAGCCGAGAGG - Intronic
1138346988 16:56326175-56326197 CAGGGTGTGCACCAGCAGAGTGG - Intronic
1138505517 16:57476470-57476492 CAGTGCCAGCCACAACAGAGGGG + Intronic
1140460865 16:75138714-75138736 CAGAGCCAGCCGCAGCAGCGAGG + Intergenic
1140476226 16:75240406-75240428 CAGGGCCCGCCCCAGCAGAGGGG + Intronic
1142212672 16:88815957-88815979 CCAGGCCAGCCCCAGGAGAGGGG - Intronic
1142582638 17:951744-951766 CAGGGCCAGCCCCAGAGGGGCGG + Intronic
1142885880 17:2911868-2911890 CAGGTCAAGTCCCAGCAGAGTGG - Intronic
1143019790 17:3911455-3911477 CAGGGGCCGCCCCAGGCGTGAGG + Intronic
1144931971 17:18866937-18866959 CAGAACCCCCCCAAGCAGAGGGG + Intronic
1145868436 17:28255498-28255520 TTGGGCCACCCCCAGCAGAGAGG - Intergenic
1145912921 17:28552681-28552703 CAGGGCCCACCCCAGGGGCGGGG - Intronic
1147135269 17:38430409-38430431 CAGGGTCAGCCCGAGGAGAGGGG - Intronic
1148087033 17:45000544-45000566 CAGGGCCAGATCCAGGAGAGGGG - Intergenic
1148755830 17:49972458-49972480 CAGGGTGCGCCTGAGCAGAGGGG + Intronic
1150292227 17:63988506-63988528 CACGGCCCACCCCAGCAGGGAGG + Intergenic
1151319403 17:73343509-73343531 CAGGGACCGGCCCAGCACAAAGG + Intronic
1151786167 17:76276044-76276066 CATGGCCGGCCTCAGCTGAGTGG + Intronic
1152039463 17:77893577-77893599 CATGGCCTGCCCCAGCAAAAGGG + Intergenic
1152434998 17:80271084-80271106 CAGGGCCCGCCCCTGGTGGGAGG + Intronic
1152570814 17:81120540-81120562 CAGGGCCGGCCCCACAAAAGCGG - Exonic
1152630790 17:81409925-81409947 CAGCGCCTGCCCGAGCTGAGGGG + Intronic
1152832073 17:82503592-82503614 CAGGGCCCACTTGAGCAGAGGGG - Intergenic
1152876382 17:82788831-82788853 CAGCGCCCGCCCCACCTGGGAGG + Intronic
1154355244 18:13619677-13619699 CCGGCCCCGCCCCAGCCAAGGGG - Intronic
1156403137 18:36758851-36758873 CAGGGACAGCCCCAGAAGATTGG + Intronic
1159395136 18:67846578-67846600 AAAGGCAAGCCCCAGCAGAGAGG + Intergenic
1159469130 18:68826547-68826569 CAGGGCCAGCCCCCACTGAGAGG + Intronic
1160720539 19:595257-595279 CAGGGCCCGGCCCAAGTGAGTGG - Intronic
1161150044 19:2702721-2702743 TCGGCCCCGCCCCCGCAGAGGGG - Intergenic
1161354047 19:3809392-3809414 TGGGGCCCGCCTCAGCTGAGGGG + Intronic
1161925097 19:7294029-7294051 CTGGGCCCTCCCCGGCAGGGGGG - Exonic
1162478582 19:10915282-10915304 TGGGGACAGCCCCAGCAGAGAGG + Intronic
1162559031 19:11405303-11405325 CAGGTCCCGCCCCAGCTCACCGG + Exonic
1163234165 19:16021340-16021362 CAGGGCCAGCCCTAGCTCAGGGG + Intergenic
1163382901 19:16980393-16980415 CAAGGCAAGACCCAGCAGAGAGG - Intronic
1163420131 19:17209738-17209760 CAGGCTCCGCCCCACCAAAGAGG - Intronic
1163655158 19:18541692-18541714 CAGCCCCGGCCCCAGAAGAGTGG - Exonic
1163797346 19:19345258-19345280 CAGGGCCGGCCCCTGGGGAGGGG - Intronic
1165779772 19:38425707-38425729 CAGGGCCTGGCCCAGGAGAGGGG - Intronic
1165935370 19:39385470-39385492 CAGGGTCCTGCCCATCAGAGTGG - Intronic
1166649441 19:44560696-44560718 CAGGGCCAGGCCCAGCACAGTGG - Intergenic
1166707509 19:44916187-44916209 CAGGCCCAGCCCCAGCCCAGGGG + Exonic
1166709536 19:44927792-44927814 CAGGCCCAGCCCCAGCCTAGGGG + Intergenic
1167352754 19:48985889-48985911 CAGGTAGCGCCCCAGCAGCGTGG + Exonic
1167473655 19:49688504-49688526 CAGTGCCAGCCTCAGCAGTGGGG + Intronic
1167610975 19:50507600-50507622 CAGGCCCAGCCCCTGCAGAGCGG + Exonic
1167638425 19:50667889-50667911 CAGGGCCAGCCCCAGCGGGGAGG + Exonic
1167705359 19:51078335-51078357 CAGAGCCAGACCCAGCGGAGAGG - Intronic
1167916367 19:52743240-52743262 CTGGGCTCGCCCCATCTGAGTGG - Intergenic
1168267917 19:55232285-55232307 CAGGGTCAGCCCAAGGAGAGCGG + Intronic
1168722744 19:58563229-58563251 CCGGGGCCGCCCCAGCACTGGGG - Exonic
930614755 2:53582032-53582054 CAGGGCTCTACCCAGCAGAGAGG - Intronic
932733235 2:74235203-74235225 CAGGGCCCGGACCTGCAGACAGG + Exonic
935593672 2:104863588-104863610 CAGGGCCCTGGGCAGCAGAGAGG - Intergenic
936445118 2:112588934-112588956 CACGCCCCTCCCCTGCAGAGTGG + Exonic
937203835 2:120223415-120223437 CAGGGCCCGCCCCGGCCGGCAGG - Intergenic
944986584 2:205184099-205184121 CAAGGCCCACCCCATTAGAGGGG + Intronic
945986878 2:216362032-216362054 TGGGGCCCTTCCCAGCAGAGTGG - Intronic
947749559 2:232525349-232525371 CAGGGCCTGCACCAGCAGCCGGG - Exonic
948197079 2:236104182-236104204 GAGGGCCCGCTCCAGCAGCCGGG + Intronic
948868047 2:240785221-240785243 CAGTGCCAGGCCCAGCAGGGCGG - Intronic
948885863 2:240884273-240884295 CAGGGCCAGGCCAAGCAGGGTGG - Intergenic
1171769088 20:29307731-29307753 CAGGGCCCTCCCCGGCACAGGGG + Intergenic
1171795228 20:29561250-29561272 CAGGCCCAGGCCCAGGAGAGAGG + Intergenic
1171812265 20:29754167-29754189 CAGGGCCCTCCCCGGCACAGGGG + Intergenic
1171853228 20:30323015-30323037 CAGGCCCAGGCCCAGGAGAGAGG - Intergenic
1171974841 20:31587878-31587900 CAGGAACCGCCCCAGGGGAGCGG - Intergenic
1172184204 20:33021236-33021258 ATGGGCCCGTCCCAGCCGAGGGG - Intronic
1172650376 20:36497991-36498013 CAGGGCCCCCCCAAGCCCAGGGG + Intronic
1172916396 20:38446955-38446977 AGGGGCCCACCCCGGCAGAGGGG - Intergenic
1174392878 20:50228800-50228822 CAGGGCCCGCCACCCCAGACTGG + Intergenic
1175267548 20:57711608-57711630 CAGGCCCCGGCCCAGGAGTGGGG + Intergenic
1175518334 20:59583527-59583549 CAGGGCCGGCCCCAGGAGGGAGG + Intronic
1175934364 20:62508258-62508280 GCAGGTCCGCCCCAGCAGAGGGG + Intergenic
1176152226 20:63597712-63597734 CAGGGCCCCTTCCAGCAGGGAGG + Intronic
1176269849 20:64230654-64230676 CTGGGCCATCCCCATCAGAGGGG + Intronic
1178832695 21:36069945-36069967 CAGGCCCCGCCCTAGCGGGGCGG - Exonic
1180095072 21:45552639-45552661 CAGCCCCAGCCCCAGCAGAGAGG + Intergenic
1180182542 21:46124428-46124450 CAGAGCCTGGCCCACCAGAGGGG - Intronic
1180314504 22:11265923-11265945 CAGGGCCCTCCCCGGCAAAGGGG + Intergenic
1180866868 22:19124688-19124710 CAGAGCCTGGCACAGCAGAGGGG + Intergenic
1180871179 22:19148208-19148230 CAGGGTGCTCCCCAGCAGAGGGG - Intergenic
1181978937 22:26752484-26752506 CCGGCCCCACCCCAGCAGAAGGG - Intergenic
1182942223 22:34287742-34287764 CAGAGCCAGCCCTGGCAGAGTGG + Intergenic
1183380661 22:37489070-37489092 CAGGGCCCTCCCCTGTGGAGTGG - Intergenic
1183648908 22:39142513-39142535 CAGGGTCTGCCCCAGCAGGAGGG - Intronic
1183715786 22:39532709-39532731 CAGGCCCCGCCGCAGCAGGGCGG + Exonic
1183787163 22:40036387-40036409 CAGGTCCCTGCCAAGCAGAGTGG - Exonic
1183966753 22:41446878-41446900 CTGGCCCCGCCCCTGCAGGGCGG - Exonic
1184037620 22:41926201-41926223 CAGTGCCAGGCCCAGCAGCGCGG + Exonic
1184606922 22:45579566-45579588 CAGGGGCCTCCCCAGCACACAGG - Intronic
1184670655 22:46010975-46010997 CTGGCCCCTCCCCAGGAGAGTGG + Intergenic
1185015328 22:48339452-48339474 CTGGGGCCGCCTCTGCAGAGGGG + Intergenic
1185207400 22:49548006-49548028 CAGGGCCCCCGCCAGAACAGGGG - Intronic
1185280818 22:49969146-49969168 CAGAGCCAGCCTCAGCACAGTGG - Intergenic
952964090 3:38610436-38610458 TAGAGCCAGCCCCAGCAGTGGGG - Intronic
953340571 3:42131087-42131109 CAGGGCTCATCCCAGGAGAGTGG + Intronic
953461028 3:43081282-43081304 CAGAGCCAGCCCCAGCACTGAGG - Exonic
953563769 3:44014104-44014126 CAGAGCCCGGCCCAGCAGCCTGG + Intergenic
954397815 3:50302378-50302400 CAGTGCCCGCCCCAGCTGGAGGG + Exonic
954424769 3:50437571-50437593 CAGGGCCCACCCTAGAAGACAGG - Intronic
954635167 3:52067239-52067261 CAGGGCCTTCCCCAGGAGATGGG - Intergenic
954712313 3:52511302-52511324 CAAGGCCAGCCCCAGGATAGTGG - Intronic
955333354 3:58065586-58065608 CAGGGTCTGGCCCAGGAGAGGGG + Intronic
956162185 3:66366849-66366871 CAGGTCCCGCACCAGCTGTGTGG + Intronic
956767014 3:72492401-72492423 CAGGGCCTGCCCCAGCCCATGGG + Intergenic
958727905 3:97928392-97928414 CAGGGCCTGCTTGAGCAGAGAGG + Intronic
961459934 3:127043832-127043854 CAGTGCCCTCCCCTGCAGGGTGG + Intergenic
961512231 3:127410075-127410097 CAGGGCCAACCCCAGCTCAGTGG - Intergenic
962891712 3:139677996-139678018 TAGGGCCCGCCCCAGCGAAGGGG - Exonic
963854825 3:150242752-150242774 CAGAGCCCTTCCCAGCACAGTGG - Intergenic
967685198 3:192409626-192409648 CAGCCCCCGCCCCACCCGAGCGG - Intronic
968048210 3:195635563-195635585 CAGGGGCGGCCCCAGGAGACCGG - Intergenic
968099194 3:195954057-195954079 CAGGGGCGGCCCCAGGAGACCGG + Intergenic
968225210 3:196968806-196968828 CCGGGCGCGCCTCAGCAGCGCGG + Exonic
968306401 3:197654358-197654380 CAGGGGCGGCCCCAGGAGACCGG + Intergenic
968952659 4:3702795-3702817 CAGGGCCTGCCCCAGGTCAGGGG + Intergenic
969290223 4:6234158-6234180 CAGGGCCCAGTGCAGCAGAGAGG + Intergenic
969513222 4:7631569-7631591 CAGGGCAGCCCCGAGCAGAGAGG - Intronic
969716914 4:8872112-8872134 CAGGCCCCGCCCCCACGGAGCGG - Intergenic
971244030 4:24912740-24912762 CCGGGCCCGCGCCCCCAGAGAGG - Intronic
971304432 4:25467324-25467346 CAGCCCCAGCCCCAGCAGTGGGG + Intergenic
971365269 4:25972123-25972145 CAGGGCCTGGGCCACCAGAGGGG - Intergenic
972586173 4:40438685-40438707 GAGGGCCCGCACCCGCAGCGTGG - Exonic
973330391 4:48906313-48906335 GAGGGCGCGCCCCAGCATGGGGG + Intronic
984432317 4:179664816-179664838 GAGGTACTGCCCCAGCAGAGTGG - Intergenic
984724928 4:183011715-183011737 CAGGCTCAGCCCCTGCAGAGGGG - Intergenic
984828256 4:183947753-183947775 CAGGGTTCTCCCAAGCAGAGTGG + Intronic
984862470 4:184253045-184253067 CACTGCCAGCCCCAGCAGTGAGG + Intergenic
985504702 5:272056-272078 CAGGGGCGGCCCCAGGAGACCGG - Intronic
985532979 5:444451-444473 CACCGCGTGCCCCAGCAGAGCGG + Intronic
985666394 5:1183617-1183639 CAGGGCCGGCCCCAGGGAAGAGG + Intergenic
985743411 5:1633539-1633561 CAGGGGCGGCCCCAGGAGACCGG + Intergenic
992332353 5:75730284-75730306 CAGTGCCTGCATCAGCAGAGTGG - Intergenic
993885336 5:93409265-93409287 CAGGGCCCAGGGCAGCAGAGTGG + Intergenic
995255999 5:110047645-110047667 CATGGCCCAGCCCAACAGAGTGG - Intergenic
996021372 5:118594398-118594420 TTGGGCCAGCCCCAGCAGATGGG + Intergenic
999263358 5:150250951-150250973 TAGGGCCCTCCCCTGCAGTGAGG - Intronic
1000486260 5:161848299-161848321 CCGGGCGCGCCAGAGCAGAGGGG - Exonic
1001304411 5:170561229-170561251 CAGGGGCCAGCCAAGCAGAGCGG - Intronic
1002107743 5:176888543-176888565 CACGGGCTGCCCCAGTAGAGGGG + Exonic
1002645199 5:180649409-180649431 CAGCGCCCGCCCCAGGTGCGCGG + Intronic
1003520025 6:6850525-6850547 CAGGGCCAGCTCCAGCACAGGGG - Intergenic
1005947203 6:30603179-30603201 CAGGGCCAGCCCCAGGGGACTGG - Intronic
1006743717 6:36326721-36326743 CAGGGCCACCCCCAGCTGTGAGG + Exonic
1006856550 6:37137683-37137705 CAGGGCTCCCCCTAGAAGAGAGG + Intergenic
1006986706 6:38180292-38180314 CACGCCCAGCCCCAGCAGCGTGG - Intronic
1012436451 6:99219973-99219995 TAGGGGCGGTCCCAGCAGAGAGG - Intergenic
1012528548 6:100206422-100206444 CAGGTCCCTCCAGAGCAGAGGGG - Intergenic
1013987986 6:116219561-116219583 CAGAGCACTCCCCAGCAAAGAGG + Intronic
1014747756 6:125219722-125219744 CAAGGCCCGCCCATGGAGAGGGG - Intronic
1015958382 6:138621858-138621880 CAGGGCCAGCCCTAGCAAGGAGG + Intronic
1017288192 6:152702604-152702626 TAGGGACCACCCCAGCAGATGGG + Intronic
1019010101 6:168838081-168838103 AAGGGCCAGCCACAGCTGAGGGG - Intergenic
1019112186 6:169724712-169724734 CAGGGCGACCCCCGGCAGAGAGG - Intronic
1019335749 7:481673-481695 CAGGACCAGCCCCAGCGGTGGGG - Intergenic
1019430703 7:997658-997680 CTGGGCCCTCCCCGGCAGGGGGG + Exonic
1019916191 7:4134340-4134362 CAGGGCCTGGCCCGGCGGAGAGG + Intronic
1020138164 7:5598078-5598100 CAGGCCACACCCCAGCAGGGAGG - Intronic
1023979770 7:45061988-45062010 TAGAGCCAGCACCAGCAGAGAGG - Intronic
1025987568 7:66467259-66467281 CAGGGCCCGCTCAAGGATAGAGG - Intergenic
1026003900 7:66585177-66585199 CAGGGCCCGCTCAAGGATAGAGG - Intergenic
1026675251 7:72423384-72423406 CAGGGCAGGGACCAGCAGAGGGG + Intronic
1028762413 7:94510231-94510253 CACGGCCTGCCCGGGCAGAGGGG - Intronic
1029159358 7:98540829-98540851 CAGGGCCAGACCAGGCAGAGAGG + Intergenic
1029444394 7:100604425-100604447 CAGGGCCCCCCCCAGGCGCGAGG + Intronic
1034276536 7:149826328-149826350 CAGGCCCTGCCCCAGCTGTGGGG + Intergenic
1034445926 7:151114498-151114520 CAGGGGCTGCCCCAGCAGGCCGG + Intronic
1034902037 7:154913933-154913955 CAGGGCCCGGCCCAGCCGGGAGG - Intergenic
1035039846 7:155919707-155919729 CAGGTCTCGCCCCTGCAGACTGG + Intergenic
1035912697 8:3585075-3585097 CAGGACCCGCCCCACCGGAAGGG - Intronic
1037758640 8:21727534-21727556 CACGGCCCCCCCCAGGAGACAGG + Intronic
1040872471 8:52114707-52114729 GTGGGCCCGGCCCTGCAGAGTGG - Intronic
1041918257 8:63157621-63157643 CAGAGCCTGCTCCATCAGAGGGG - Intergenic
1042877725 8:73455190-73455212 CAGAGCCAGCCCAAGCAGAGCGG - Intronic
1043159925 8:76833675-76833697 CACTGCCCTCCCCACCAGAGTGG + Intronic
1044528870 8:93285063-93285085 GAGGTCCTGCCCAAGCAGAGAGG + Intergenic
1048703076 8:137116001-137116023 GAGGGGCCACCACAGCAGAGCGG + Intergenic
1049098165 8:140560924-140560946 CAGGCCCAGCCCCAGCCGTGGGG + Intronic
1049402370 8:142434138-142434160 TTGTGCCAGCCCCAGCAGAGAGG - Intergenic
1049679813 8:143913127-143913149 CAGGGCCAGCCCAAGTGGAGTGG - Intergenic
1049827862 8:144681668-144681690 CACAGCCCATCCCAGCAGAGAGG + Intergenic
1053791022 9:41686314-41686336 CAGGCCCAGGCCCAGGAGAGAGG - Intergenic
1054154128 9:61628458-61628480 CAGGCCCAGGCCCAGGAGAGAGG + Intergenic
1054179368 9:61898008-61898030 CAGGCCCAGGCCCAGGAGAGAGG - Intergenic
1054473915 9:65559578-65559600 CAGGCCCAGGCCCAGGAGAGAGG + Intergenic
1054658170 9:67682813-67682835 CAGGCCCAGGCCCAGGAGAGAGG + Intergenic
1056578814 9:87875635-87875657 CAGGGGCAGCCCAGGCAGAGAGG + Intergenic
1056790021 9:89619213-89619235 CAGGGACTGCACCAGCAGGGAGG + Intergenic
1057302898 9:93896719-93896741 CATGGCTCCTCCCAGCAGAGGGG + Intergenic
1057872905 9:98731653-98731675 TGGGGCCCTGCCCAGCAGAGTGG - Intronic
1058202052 9:102055840-102055862 CTGGGCCTGCTGCAGCAGAGTGG - Intergenic
1058498810 9:105590141-105590163 CAGGTCCCCCCCCAGCACATGGG - Intronic
1060826780 9:126692246-126692268 GCTGGCCAGCCCCAGCAGAGGGG + Intronic
1061075896 9:128341080-128341102 CATAGCCCGCCATAGCAGAGGGG - Intronic
1061091521 9:128429042-128429064 CAGGGCCCCCCCCACCAGGCAGG - Intronic
1061196124 9:129108187-129108209 CAGGGCCAGCCCCACCCAAGAGG - Intronic
1061903130 9:133683204-133683226 AAGGGCCAGCCCCAGGAGAGGGG + Intronic
1062577422 9:137215192-137215214 CAGGCCCCTCACCAGCAGCGAGG - Exonic
1062678010 9:137759747-137759769 CACGGCCAGCACCAGCACAGTGG - Intronic
1203362814 Un_KI270442v1:232032-232054 CAGGGCCCTCCCCGGCAAAGGGG + Intergenic
1185493522 X:537235-537257 CAGGCCCTGCCCCACCAGAATGG - Intergenic
1185775428 X:2799358-2799380 AAGGGCGCGCCCCAGGAGACAGG + Intronic
1185877525 X:3712982-3713004 CAGGGCCCTCCCCAGGAGGTCGG + Intronic
1185894085 X:3843235-3843257 CAGGGCCCTCCCCAGGAGGCGGG + Intronic
1185899203 X:3881659-3881681 CAGGGCCCTCCCCAGGAGGCGGG + Intergenic
1185904320 X:3920088-3920110 CAGGGCCCTCCCCAGGAGGCGGG + Intergenic
1188782453 X:34302423-34302445 CAGGGCCCTATCCAGCAGAAAGG + Intergenic
1190456831 X:50635260-50635282 CAGGGCCCGCCAAAGCAGTCAGG - Exonic
1195010930 X:100731766-100731788 GAGGGACCGCCCAAGCAGACGGG + Intronic
1199753733 X:150845492-150845514 CAGGGCACTCCCCCACAGAGTGG - Intronic
1199846294 X:151694957-151694979 CAGGGGCGGCGCCGGCAGAGTGG + Intergenic
1199862199 X:151811218-151811240 CAGAGACCACCCCAGCTGAGCGG - Intergenic
1200148568 X:153940219-153940241 CATGGCCCACTCCAGCTGAGGGG + Exonic
1201075445 Y:10184174-10184196 CAGGGCCCTGCCCAGCACGGGGG - Intergenic
1201274485 Y:12285290-12285312 CAGGGGCCGGACTAGCAGAGAGG + Intergenic