ID: 1140476227

View in Genome Browser
Species Human (GRCh38)
Location 16:75240407-75240429
Sequence AGGGCCCGCCCCAGCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140476214_1140476227 22 Left 1140476214 16:75240362-75240384 CCGCCGTGCCACCGTAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1140476227 16:75240407-75240429 AGGGCCCGCCCCAGCAGAGGGGG 0: 1
1: 0
2: 1
3: 29
4: 231
1140476218_1140476227 11 Left 1140476218 16:75240373-75240395 CCGTAATGAAGGCATGAGCAATC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1140476227 16:75240407-75240429 AGGGCCCGCCCCAGCAGAGGGGG 0: 1
1: 0
2: 1
3: 29
4: 231
1140476217_1140476227 14 Left 1140476217 16:75240370-75240392 CCACCGTAATGAAGGCATGAGCA 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1140476227 16:75240407-75240429 AGGGCCCGCCCCAGCAGAGGGGG 0: 1
1: 0
2: 1
3: 29
4: 231
1140476216_1140476227 19 Left 1140476216 16:75240365-75240387 CCGTGCCACCGTAATGAAGGCAT 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1140476227 16:75240407-75240429 AGGGCCCGCCCCAGCAGAGGGGG 0: 1
1: 0
2: 1
3: 29
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476227 Original CRISPR AGGGCCCGCCCCAGCAGAGG GGG Intronic
900136885 1:1121557-1121579 AGGGCCTGCCTCCGCAGAGCAGG - Intergenic
900270635 1:1785683-1785705 AGGGCCCTCCACATCTGAGGTGG - Exonic
901066541 1:6497221-6497243 AGGGCCCGCTCCAGGCAAGGGGG - Intronic
901668020 1:10837441-10837463 AGTGCCAGCCGCTGCAGAGGTGG + Intergenic
902333985 1:15744424-15744446 AGGGCACGGCCCAGCAGCTGGGG - Exonic
903500794 1:23799300-23799322 AGGGCCCGCCACAGCAGAGCTGG + Intronic
903724587 1:25431194-25431216 AGGGCCCGCGCCCGCGGAGTGGG - Intronic
904364095 1:29999598-29999620 AGGTCCCACCCCAGCTGTGGAGG + Intergenic
905296385 1:36957015-36957037 GTGGCCTGCTCCAGCAGAGGGGG - Intronic
906281863 1:44559964-44559986 AGGGCCCCCCTCAGCCCAGGAGG + Intronic
913450198 1:118987875-118987897 CGGGCCCGGCCCGGGAGAGGCGG + Intronic
913615743 1:120558280-120558302 GGGGCGCGCCCCTGCAGAGTGGG - Intergenic
913644962 1:120847147-120847169 AGGACCTGGCCCAGAAGAGGTGG + Intergenic
914006670 1:143738338-143738360 AGGACCCGGCCCAGAGGAGGCGG + Intergenic
914081766 1:144416418-144416440 AGGACCTGGCCCAGAAGAGGTGG - Intergenic
914095679 1:144542919-144542941 AGGACCCGGCCCAGAGGAGGCGG + Intergenic
914099337 1:144570437-144570459 AGGACCTGGCCCAGAAGAGGTGG + Intergenic
914176673 1:145284930-145284952 AGGACCTGGCCCAGAAGAGGTGG - Intergenic
914299648 1:146367231-146367253 AGGACCTGGCCCAGAAGAGGTGG - Intergenic
914302841 1:146391050-146391072 AGGACCCGGCCCAGAGGAGGCGG - Intergenic
914531401 1:148526409-148526431 AGGACCTGGCCCAGAAGAGGTGG - Intergenic
914574533 1:148952622-148952644 GGGGCGCGCCCCTGCAGAGTGGG + Intronic
914636992 1:149561331-149561353 AGGACCTGGCCCAGAAGAGGTGG + Intergenic
914645494 1:149648823-149648845 AGGACCCGGCCCAGAGGAGGCGG + Intergenic
914667261 1:149841785-149841807 AGGGCCCTCCCCATCGGGGGTGG + Intergenic
914668506 1:149852005-149852027 AGGGCCCTCCCCATCGGGGGTGG - Intronic
920522171 1:206635759-206635781 GGCTCCCGCCCCAGCAGCGGAGG + Exonic
922153402 1:223023332-223023354 AGGGCTGGCCCCAGGAGAGAAGG - Intergenic
922566034 1:226602376-226602398 GTGGCCCGGCCCAGCAGACGTGG - Exonic
922698366 1:227743284-227743306 CAGGCCCTCCCCAGAAGAGGAGG + Intronic
922800941 1:228364501-228364523 AGGGCCTGGCCCAGGAGAAGGGG + Intronic
1062941694 10:1426715-1426737 AGGGGCTGGCCCAGGAGAGGCGG + Intronic
1063126982 10:3144060-3144082 AGGGCCCTCCTCGGCACAGGAGG + Intronic
1063375131 10:5550187-5550209 TGGGCCCGGCCAAGCAGAGCAGG - Intergenic
1063381151 10:5587175-5587197 AGCGGCTGCCCCAGCAGAGATGG - Intergenic
1063407820 10:5813484-5813506 AGGCCCCGCCCCGGCTGCGGAGG - Exonic
1064777570 10:18795882-18795904 AGGTCAAGCCCCAGCAGAGCTGG - Intergenic
1067079211 10:43203939-43203961 AGGCCCCGCCCCTGCTGATGGGG - Intronic
1067261959 10:44700569-44700591 AGAGCCAGCCCCAGGGGAGGAGG + Intergenic
1067432731 10:46254524-46254546 ACGTGCCGCCCCAGCAGTGGGGG + Intergenic
1069019169 10:63466087-63466109 AGTGCCCGGCCCTGCGGAGGCGG + Intergenic
1069744494 10:70706487-70706509 AGGGCAGCCCCCAGCAGGGGAGG - Intronic
1071563735 10:86661209-86661231 AGGGCCTGGCCCAGAAGAGAAGG + Intronic
1073111790 10:101066940-101066962 CGGGTCCGCTGCAGCAGAGGCGG - Intronic
1074233527 10:111561822-111561844 GGTTCCCGCCCCACCAGAGGAGG - Intergenic
1074685214 10:115955607-115955629 AGGGAAAGCCCCAGCAGAGGAGG - Intergenic
1075069882 10:119313765-119313787 AGGGCCCCTCCCAGCACATGGGG - Intronic
1076611271 10:131727233-131727255 AGGCCCTTCCCCAGCAGGGGCGG - Intergenic
1077026269 11:441407-441429 AGGACCCCGCCCAGCACAGGTGG - Intronic
1077048305 11:555672-555694 AGGCCCCGACCCAGCAGAAACGG - Intronic
1077062524 11:624155-624177 AGGGCAGAGCCCAGCAGAGGTGG + Intronic
1077142678 11:1031303-1031325 AGAGCCCTCCACAGCAGATGAGG - Intronic
1077192175 11:1260178-1260200 TGGGGCCTCCCCAGCAGGGGTGG - Intronic
1077539647 11:3140533-3140555 AGGGCCTCCCCCAGCAGAGAGGG + Intronic
1078079605 11:8194266-8194288 AGGGCCCCAGCCAGCAGAGAGGG - Intergenic
1078132250 11:8622514-8622536 AGGGCCTGGCCATGCAGAGGTGG - Intronic
1079118335 11:17655306-17655328 AGGGCATGTCCCAGCAGAGCAGG + Intergenic
1079346849 11:19660265-19660287 AGGGGCTGCCCCAGCAGGGCTGG + Intronic
1081809331 11:45906359-45906381 AGGCCCTGTCCCAGCAGAAGAGG + Exonic
1081871677 11:46385560-46385582 AGGGCCCGCGGCTGCAGGGGAGG + Exonic
1082004188 11:47410597-47410619 AGGGCCTGCCCCTGGGGAGGGGG + Intronic
1082099759 11:48162747-48162769 AGGACTCGCCCCAGCTGGGGTGG + Intronic
1083302522 11:61746420-61746442 AGGACCCACCCTGGCAGAGGAGG - Exonic
1084155995 11:67312800-67312822 AGGCCCTGCCCCAGGAGATGGGG - Intergenic
1084161683 11:67353627-67353649 AGGGCCCCGCCCCGCATAGGCGG - Intronic
1088522170 11:110712062-110712084 AGGGCGCGCGCCGGCAGTGGGGG + Intronic
1088527725 11:110774659-110774681 AGGGCCCAGCCCAGAATAGGAGG - Intergenic
1097145940 12:56939380-56939402 AGGACCCTCCCCAGCTTAGGAGG + Intergenic
1097938292 12:65278092-65278114 CGGGCCCTCTCTAGCAGAGGAGG - Intergenic
1103347297 12:120259789-120259811 AGGGCCCATCCCAGGTGAGGAGG + Intronic
1103488073 12:121296372-121296394 AGGGCGCGGCCCAGCCGAGGAGG + Intronic
1103976590 12:124706660-124706682 GGGACCCCCCCCAGCAGGGGTGG + Intergenic
1104908445 12:132228076-132228098 ATGTGCCGCCCCAGCAGGGGTGG + Intronic
1104969985 12:132526859-132526881 AGGGCCTCCCCCAGCAGGAGGGG - Intronic
1107430266 13:40334225-40334247 CGAGCCCACCCCAGCAGAGGTGG + Intergenic
1107753310 13:43592766-43592788 AGGGCCTTCCTCTGCAGAGGAGG - Intronic
1113842625 13:113369092-113369114 AGGGCAGGCCCCAGAAGAAGGGG - Intergenic
1122693627 14:103542699-103542721 AGGGGCAGCCCCTCCAGAGGGGG - Intergenic
1125719429 15:41838267-41838289 AGGGACAGCCCCAGGAGAGGCGG - Intronic
1125733007 15:41904599-41904621 AGGGACAGCCCCACCAGAGACGG - Intronic
1129108020 15:73322556-73322578 AGGGGGCCCCCCAGAAGAGGTGG + Exonic
1129607441 15:77031729-77031751 TGGGTCCTCCCCAGCAGAGAGGG + Intronic
1129741085 15:77989954-77989976 AGGGCCAGCCCTAGCAGTGGGGG - Intronic
1129844634 15:78762598-78762620 AGGGCCAGCCCTAGCAGTGGGGG + Intronic
1130257193 15:82331268-82331290 AGGGCCAGCCCTAGCAGTGGGGG - Intergenic
1130597759 15:85258722-85258744 AGGGCCAGCCCTAGCAGTGGGGG + Intergenic
1131148853 15:90034571-90034593 AGGGCCCTCCCTAGCAGCAGGGG + Intronic
1132148997 15:99446699-99446721 AGAGCTCTTCCCAGCAGAGGAGG + Intergenic
1132293112 15:100716872-100716894 AGAGCAGGACCCAGCAGAGGAGG + Intergenic
1133168212 16:3964044-3964066 AGGCACCGCCCCTGGAGAGGTGG + Exonic
1133232095 16:4371779-4371801 AGGCCCCGCCCCTGCCGCGGCGG + Intronic
1133232099 16:4371784-4371806 CGGGCCCGCCGCGGCAGGGGCGG - Intronic
1136235513 16:28911249-28911271 AGGGCACCTCCCTGCAGAGGTGG - Intronic
1138562519 16:57810383-57810405 AGGGCCACCCCCAGAGGAGGAGG - Intronic
1140476227 16:75240407-75240429 AGGGCCCGCCCCAGCAGAGGGGG + Intronic
1141725026 16:85782299-85782321 AGGGCCAGAGCCAGCAGTGGAGG - Intronic
1142674539 17:1505560-1505582 AGGGCCGTCCACAGAAGAGGAGG - Intronic
1144380605 17:14693744-14693766 GGGGGCAGCCCCAGCAGAGCTGG + Intergenic
1144733077 17:17539976-17539998 AGGGCCCACCCCAGGAGTGCAGG + Intronic
1146736314 17:35242179-35242201 GGGCCCCGCCGCAGCACAGGGGG - Intergenic
1148754424 17:49965270-49965292 ACCGCACGCCCTAGCAGAGGAGG - Intergenic
1149868229 17:60162205-60162227 AGGGCCAGTCACAGCAGAAGTGG + Intronic
1151485117 17:74394199-74394221 ATTGCCGGCCCCAGCAGAGCAGG + Intergenic
1152039464 17:77893578-77893600 ATGGCCTGCCCCAGCAAAAGGGG + Intergenic
1152438066 17:80288224-80288246 ATGGCCTTCACCAGCAGAGGTGG - Exonic
1152838215 17:82549153-82549175 AGGGCCACACCCAGAAGAGGAGG - Intronic
1154355243 18:13619676-13619698 CGGCCCCGCCCCAGCCAAGGGGG - Intronic
1155164869 18:23223943-23223965 AGGGCCACCCCAAGCAGAAGTGG - Intronic
1156275697 18:35581400-35581422 TGGGCTCGCCGCAGCGGAGGGGG + Intronic
1158165874 18:54539521-54539543 AGTGCCCGGCTCAGCAGAGGTGG - Intergenic
1160523069 18:79520031-79520053 AGGGCACACACCAGGAGAGGGGG + Intronic
1160843959 19:1158580-1158602 AAGGCCTGCGCCAGCAAAGGCGG + Intronic
1160857815 19:1225192-1225214 AGGGTCTGCCCCACCAGAGACGG + Intronic
1160858680 19:1228552-1228574 AGGGCCGGCGGCAGCAGCGGTGG + Exonic
1161220975 19:3117999-3118021 AGGGCCCGCACCAGCAGCTGTGG - Intronic
1162376786 19:10309722-10309744 AGGCCCCGCCCCGGCAGCTGCGG - Exonic
1162478583 19:10915283-10915305 GGGGACAGCCCCAGCAGAGAGGG + Intronic
1163533383 19:17863459-17863481 AGGGCCCACTCCAGGACAGGAGG - Intronic
1163797345 19:19345257-19345279 AGGGCCGGCCCCTGGGGAGGGGG - Intronic
1164594996 19:29526623-29526645 AGGGCATGCAGCAGCAGAGGCGG - Exonic
1166478723 19:43151673-43151695 AGGGCCAGCCTCAGCAGTGCAGG - Intronic
1166501395 19:43344009-43344031 AGGGCCAGCCTCAGCAGTGCAGG - Intergenic
1166508716 19:43389439-43389461 AGGGCCAGCCTCAGCAGTGCAGG + Intergenic
1166709537 19:44927793-44927815 AGGCCCAGCCCCAGCCTAGGGGG + Intergenic
1167473656 19:49688505-49688527 AGTGCCAGCCTCAGCAGTGGGGG + Intronic
1167637329 19:50662455-50662477 GGGGCCCGGCGGAGCAGAGGGGG + Exonic
1168142620 19:54399335-54399357 AGGACCCACCCCAGCAGGTGTGG + Intergenic
1168722743 19:58563228-58563250 CGGGGCCGCCCCAGCACTGGGGG - Exonic
927979979 2:27369020-27369042 AAGGCCAGCCCCAGCACAGCTGG - Exonic
929961551 2:46500232-46500254 AGAGCCCGACCCAGCGGCGGCGG - Intronic
933803848 2:85983941-85983963 ACGGGCTGCCCCAGGAGAGGGGG - Intergenic
934077022 2:88437180-88437202 AGGTCCGGGCCCTGCAGAGGAGG - Intergenic
936463294 2:112726761-112726783 AGGGACAGGCCCAGCAGGGGCGG + Intronic
937017092 2:118616362-118616384 AAGGCCCGTTCCAGCAGATGTGG - Intergenic
937883573 2:126885815-126885837 CGGGCCCGCTCCAGCCCAGGAGG - Intergenic
946190765 2:218006652-218006674 AGGACAGGCCCCAGCTGAGGGGG + Intergenic
947749558 2:232525348-232525370 AGGGCCTGCACCAGCAGCCGGGG - Exonic
948197080 2:236104183-236104205 AGGGCCCGCTCCAGCAGCCGGGG + Intronic
948544131 2:238714338-238714360 AGACCCCGCCCCAGCAGCAGGGG + Intergenic
1170786623 20:19472890-19472912 AGGGCCGGCATCAGCAGTGGTGG + Intronic
1171105721 20:22430613-22430635 AGGCACGGCCTCAGCAGAGGTGG - Intergenic
1171275688 20:23855182-23855204 AGGGCCTGCACCAGGAGACGGGG - Intergenic
1171277184 20:23867385-23867407 AGAGCCCGCCCCAGCCTAGGCGG - Intergenic
1171848793 20:30293547-30293569 AGGTCGTGCCACAGCAGAGGTGG + Intergenic
1172246714 20:33450474-33450496 AGGGACTGCCCTTGCAGAGGAGG + Intergenic
1172604624 20:36206328-36206350 AGGGACCAGGCCAGCAGAGGTGG + Intronic
1174453885 20:50636367-50636389 AATGCCAGCCCCAGCAGGGGTGG - Intronic
1174665799 20:52256696-52256718 AGGGCACGCCACAGCAGTGTTGG + Intergenic
1175098973 20:56564675-56564697 ATGCTCAGCCCCAGCAGAGGTGG + Intergenic
1175466594 20:59194001-59194023 AGGCCCCTCCCCAGGTGAGGCGG + Exonic
1175888591 20:62306034-62306056 AGGACCCGGCCCAGCAGGTGAGG - Intronic
1175900799 20:62359221-62359243 GGGGCTCTCCCCAGCAGAGGAGG - Intronic
1175934365 20:62508259-62508281 CAGGTCCGCCCCAGCAGAGGGGG + Intergenic
1176110148 20:63407406-63407428 AGGGCCCGTCCCAGGAGATGTGG + Intronic
1176249145 20:64112020-64112042 AGGGCCAGCCCCACGAGAGCAGG - Intergenic
1176269850 20:64230655-64230677 TGGGCCATCCCCATCAGAGGGGG + Intronic
1178872046 21:36385360-36385382 AGGCCCCGCCCCCGCATGGGCGG - Exonic
1180004604 21:45014559-45014581 AGGGGCCGCCCCCGCCGAGCAGG + Intergenic
1180095073 21:45552640-45552662 AGCCCCAGCCCCAGCAGAGAGGG + Intergenic
1180855559 22:19042651-19042673 AGGACCTGCCGCAGCAGAGAAGG + Intronic
1181032218 22:20154187-20154209 TGGGGCCTCCCCAGCAGAGGCGG + Intergenic
1181511244 22:23389544-23389566 TGGGGCCTCCCCAGCAGAGGCGG - Intergenic
1181572034 22:23772949-23772971 AGAGCCCGGGCCAGCAGCGGCGG - Exonic
1183604742 22:38861692-38861714 AGGTGCCGCCCCAGCATGGGGGG - Exonic
1184021939 22:41826803-41826825 ATGCCCCTCCCAAGCAGAGGAGG + Intergenic
1184424255 22:44400008-44400030 GGGACCCGCCCCAGCTCAGGAGG + Intergenic
1184639318 22:45860750-45860772 AGGGCCCTCCCCAACGGGGGCGG + Intergenic
1184865654 22:47200608-47200630 AGGGCTCGGGCCAGCAGATGTGG + Intergenic
1185004645 22:48268572-48268594 AGGGCCCGCCCCACAAGCGCTGG - Intergenic
1185015329 22:48339453-48339475 TGGGGCCGCCTCTGCAGAGGGGG + Intergenic
1185207399 22:49548005-49548027 AGGGCCCCCGCCAGAACAGGGGG - Intronic
1185347063 22:50315108-50315130 AGGGCCAGGCCCAGCACAGGTGG - Intronic
950096393 3:10333263-10333285 TGGGGACTCCCCAGCAGAGGAGG - Intronic
955333355 3:58065587-58065609 AGGGTCTGGCCCAGGAGAGGGGG + Intronic
956926211 3:73991433-73991455 GGGGCACCCCCCAGTAGAGGCGG + Intergenic
957039599 3:75327152-75327174 AGGGGCTGAGCCAGCAGAGGTGG + Intergenic
960478763 3:118162748-118162770 AGGGCAAGCCAAAGCAGAGGGGG + Intergenic
961743507 3:129047924-129047946 AGTCCCCACCCCAGCAGAGGAGG + Intergenic
962198000 3:133380056-133380078 AGGGCCCGCTCCAGCAGCCATGG + Exonic
962944299 3:140153446-140153468 AGGGCCTGCCCCAGAACTGGAGG - Intronic
963123773 3:141797213-141797235 AGGGCGCATCCCATCAGAGGCGG - Intronic
966117641 3:176484899-176484921 ATTGCCTGTCCCAGCAGAGGTGG + Intergenic
968099374 3:195954551-195954573 TGGCCCTGCCCCGGCAGAGGCGG - Intergenic
968234937 3:197025986-197026008 AGGCACCGGCCAAGCAGAGGTGG + Intronic
968266387 3:197366656-197366678 AGGGCAGCCCCCATCAGAGGAGG + Intergenic
968595308 4:1479243-1479265 GCTGCCAGCCCCAGCAGAGGAGG + Intergenic
970025706 4:11622064-11622086 ATGGCCAGCCTCAGCAGAGCTGG - Intergenic
971304433 4:25467325-25467347 AGCCCCAGCCCCAGCAGTGGGGG + Intergenic
971400157 4:26268743-26268765 AGGGGCAGCTGCAGCAGAGGCGG + Intronic
973330392 4:48906314-48906336 AGGGCGCGCCCCAGCATGGGGGG + Intronic
977419483 4:96780005-96780027 AGAGCCACTCCCAGCAGAGGAGG - Intergenic
982310808 4:153983478-153983500 AAGGCACCCCCCAGCAGGGGTGG - Intergenic
984432316 4:179664815-179664837 AGGTACTGCCCCAGCAGAGTGGG - Intergenic
985695171 5:1336000-1336022 AGTGCCCGCCATAGCAGAGCAGG - Intronic
985754504 5:1705012-1705034 ATGGCCCTGCCCAGGAGAGGTGG + Intergenic
986098710 5:4585544-4585566 GGGCCTCGCCCCAGCAGTGGCGG + Intergenic
988823952 5:34915831-34915853 GCGGCACGCCACAGCAGAGGAGG + Exonic
990053893 5:51545722-51545744 AGGGCCCTCCCCAGTGTAGGTGG + Intergenic
994140548 5:96336130-96336152 AGGGACAGCCCCAGGAAAGGAGG - Intergenic
996628992 5:125605485-125605507 AGGACCCTACCCAGCTGAGGAGG - Intergenic
997340523 5:133141112-133141134 AGGCCACCCCCAAGCAGAGGAGG - Intergenic
997473507 5:134129786-134129808 GGGGCCTGCCACAGCGGAGGTGG - Intronic
998290239 5:140907843-140907865 ACGGCTGGCCTCAGCAGAGGAGG - Intronic
999351466 5:150875542-150875564 ACGGGCCACCTCAGCAGAGGAGG + Intronic
1002047969 5:176552726-176552748 GGGGCCAACCCCAGCAGAGCAGG + Intronic
1002060192 5:176621205-176621227 AGGACCCACCCCAGGTGAGGGGG - Exonic
1002331296 5:178442777-178442799 AGGCCCTTCCCCAGCAGGGGTGG - Intronic
1002416349 5:179122815-179122837 AGGGCCCGCACTGGCAGAGCTGG + Intronic
1002427531 5:179185097-179185119 AAGGGATGCCCCAGCAGAGGAGG + Intronic
1003107465 6:3227463-3227485 TGGGCGCGCCGCAGCGGAGGGGG - Intronic
1005529328 6:26686999-26687021 AGGGCACGTCCTAGCAAAGGAGG - Intergenic
1005541468 6:26814647-26814669 AGGGCACGTCCTAGCAAAGGAGG + Intergenic
1005841757 6:29748504-29748526 AGGGCCGCCCCCAGCACCGGGGG + Intergenic
1007369545 6:41417313-41417335 AGGGCAAGTCCCAGCAGGGGTGG + Intergenic
1007528940 6:42522889-42522911 AGGCTCTGCCCCAGCAGGGGTGG + Intergenic
1007689208 6:43687828-43687850 AGCGCCCGCCGCCGCAGTGGTGG + Intergenic
1009012273 6:57856709-57856731 AGGGCACGTCCCAGCAAAGGAGG + Intergenic
1013174079 6:107662522-107662544 GGCGCCTGCCCCAGCAGGGGAGG - Intergenic
1015732241 6:136360936-136360958 ACGCCCCAGCCCAGCAGAGGAGG - Intronic
1018743039 6:166744680-166744702 AGGGCAGGCCCCAGGAGAGGAGG + Intronic
1019139656 6:169935452-169935474 GGGGCCCGCCCCTGCTGAGCTGG + Intergenic
1019430704 7:997659-997681 TGGGCCCTCCCCGGCAGGGGGGG + Exonic
1019728584 7:2617145-2617167 AGGGCCAGCCCCATTAGATGGGG + Intergenic
1020097766 7:5378004-5378026 AGGGCACGGCCGAGCAGATGAGG - Exonic
1024564940 7:50673228-50673250 AGGGGCAGTCCCAGCAGAGATGG + Intronic
1026978969 7:74515647-74515669 CGGTCCCCACCCAGCAGAGGGGG + Intronic
1034276537 7:149826329-149826351 AGGCCCTGCCCCAGCTGTGGGGG + Intergenic
1035578673 8:725714-725736 AGGGTCGGCCCCAGCAGGGAAGG - Intronic
1035685864 8:1523170-1523192 TGGGCCCGGACCACCAGAGGGGG - Intronic
1035823687 8:2621606-2621628 AGGCCCCAGCACAGCAGAGGAGG + Intergenic
1035912696 8:3585074-3585096 AGGACCCGCCCCACCGGAAGGGG - Intronic
1041384039 8:57279937-57279959 ATGGCGCGCGGCAGCAGAGGTGG + Intergenic
1042877724 8:73455189-73455211 AGAGCCAGCCCAAGCAGAGCGGG - Intronic
1043738975 8:83784302-83784324 AGGGCCCCTCCCACAAGAGGTGG - Intergenic
1044528871 8:93285064-93285086 AGGTCCTGCCCAAGCAGAGAGGG + Intergenic
1045507462 8:102788863-102788885 AAGGCCTGCCCCATCAGAGCTGG + Intergenic
1045509713 8:102805374-102805396 AAAGACTGCCCCAGCAGAGGTGG + Intergenic
1047213573 8:122859060-122859082 AGAGCCCTGCCCAGCTGAGGAGG + Intronic
1049387948 8:142353753-142353775 AGGAACCACCCCAGCAGAGAAGG + Intronic
1049402369 8:142434137-142434159 TGTGCCAGCCCCAGCAGAGAGGG - Intergenic
1049469519 8:142769181-142769203 AGGGCCAGCCGTAGCAGACGTGG + Intronic
1049658982 8:143811341-143811363 AGGGCCTGGCCAAGAAGAGGAGG + Exonic
1050351202 9:4741888-4741910 AGGGCGCTCGGCAGCAGAGGAGG - Intronic
1055090874 9:72364416-72364438 AGAGGCCGGCCCCGCAGAGGCGG + Intronic
1055397445 9:75890740-75890762 GGAGCCCGGGCCAGCAGAGGGGG + Exonic
1057214096 9:93218690-93218712 AGGGCCAGCCCCAAAGGAGGAGG - Intronic
1057737482 9:97677842-97677864 AGGGCTCCCTCCAGAAGAGGAGG + Intronic
1059324518 9:113496158-113496180 TGGGCCTGCCCCAGAAGATGAGG + Intronic
1059500200 9:114745964-114745986 AGGGAGCACCCAAGCAGAGGAGG + Intergenic
1060826781 9:126692247-126692269 CTGGCCAGCCCCAGCAGAGGGGG + Intronic
1061723227 9:132566658-132566680 AGGGCCCATCCCACCTGAGGTGG + Intronic
1062322604 9:135997790-135997812 CGGGCCAGCCCCAGCAGAGTAGG - Intergenic
1062496489 9:136833855-136833877 AGGGGCCTCCCCAGCAGTGCCGG - Intronic
1203771445 EBV:51907-51929 AGTGCCCGTCGCAGTAGAGGAGG + Intergenic
1189700383 X:43712640-43712662 AGGGCCTTCCCGAGAAGAGGTGG + Intronic
1198051905 X:132958441-132958463 AGGGCCCGCGCGAACTGAGGCGG + Exonic
1200064434 X:153497722-153497744 AGGCCCCACCCCTCCAGAGGAGG - Intronic
1200126062 X:153815699-153815721 AGGCCCCACCCCTCCAGAGGAGG + Intronic
1200251690 X:154557493-154557515 CGTTCCCGCCCCAGCAGAGGCGG + Intronic
1200253897 X:154569177-154569199 CGTTCCCGCCCCAGCAGAGGCGG + Intergenic
1200263872 X:154635231-154635253 CGTTCCCGCCCCAGCAGAGGCGG - Intergenic
1200266077 X:154646923-154646945 CGTTCCCGCCCCAGCAGAGGCGG - Intergenic