ID: 1140476354

View in Genome Browser
Species Human (GRCh38)
Location 16:75241173-75241195
Sequence GTGTTTACACATATGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 3, 1: 0, 2: 1, 3: 11, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140476354 Original CRISPR GTGTTTACACATATGGGGTT TGG Intronic
900601260 1:3503736-3503758 GTGTGTACACGTTTGGGGGTGGG + Intronic
900717524 1:4154515-4154537 GCGTTTCAACATATGGGTTTTGG + Intergenic
905390408 1:37632777-37632799 GTGTGTGCGCATATGGGGTCAGG - Intronic
906096902 1:43230005-43230027 TTGTTTCCACATAAGGGGCTAGG + Intronic
910499416 1:87872396-87872418 GTGTTTCCACATGTGGGAGTTGG - Intergenic
913157576 1:116115016-116115038 GTGGTTACAAATATGGGCTTTGG + Intronic
916785336 1:168083025-168083047 GTATTTCCAAATATGGAGTTAGG - Exonic
917759781 1:178143265-178143287 GTGTTTATATTTATGGGCTTTGG + Intronic
919330751 1:196167905-196167927 TTGTTTACATTTATGGGGTATGG - Intergenic
924601088 1:245490032-245490054 GTGGTTACAAGTATGGGCTTTGG - Intronic
1063691758 10:8294547-8294569 GTGTTTAGAAATGTGGGCTTGGG + Intergenic
1065886605 10:30083136-30083158 GAGATTACACAAATGGGGATAGG - Intronic
1069290356 10:66771579-66771601 GTGATTACACATATGGGCTGGGG + Intronic
1074875850 10:117612839-117612861 GTGATTACACAGATGGGCTTCGG + Intergenic
1078692775 11:13598444-13598466 GTGTATACACACATGGGGGTGGG + Intergenic
1078756563 11:14216284-14216306 GGGTTTTCACATCTGGGGCTGGG + Intronic
1082745379 11:56955206-56955228 GTATTTACACTGATGTGGTTTGG - Intergenic
1083713306 11:64561772-64561794 GTGTTTAAGAACATGGGGTTTGG - Intronic
1085996571 11:81923301-81923323 GTGGTTACACAGATGGGGTTAGG - Intergenic
1087302575 11:96453163-96453185 GTGTATATATATATAGGGTTTGG + Intronic
1087995027 11:104795177-104795199 ATGTTTACACATATGGCTTGAGG + Intergenic
1088875176 11:113929597-113929619 GGGTTTCAACATATGGGTTTTGG + Intronic
1090666548 11:128918446-128918468 GTGTTGACACACACGGGCTTCGG + Exonic
1095089109 12:38087640-38087662 GTGTATACACTCATGGGCTTGGG - Intergenic
1097960530 12:65527921-65527943 GTGTTTAAAAATCTTGGGTTGGG - Intergenic
1098499558 12:71175056-71175078 GAGTTTACATATAAAGGGTTTGG + Intronic
1098952000 12:76649072-76649094 GTTTTTAGCTATATGGGGTTGGG + Intergenic
1100418184 12:94400467-94400489 GTGCTTTCCCATATGTGGTTTGG + Intronic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1101323697 12:103696393-103696415 GTGTCTTCTCATGTGGGGTTGGG + Intronic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1103586189 12:121957978-121958000 GTGTATGCAAATATGGAGTTTGG - Intronic
1105718701 13:23092832-23092854 TTGTTTCCACAAATGGGGCTCGG - Intergenic
1107061160 13:36161153-36161175 GTGTTTAATCATATGGGTCTGGG + Intergenic
1107826775 13:44335685-44335707 GTGTGTACACAGATGGGCTCTGG + Intergenic
1109192587 13:59343336-59343358 GTGTTCACACATACAGAGTTAGG - Intergenic
1110391733 13:74982361-74982383 ATGTTTAAATATATGGGCTTTGG + Intergenic
1113097867 13:106685174-106685196 GTGTGTACACATGTGTGTTTAGG - Intergenic
1115147414 14:30241410-30241432 GAGCATACACAGATGGGGTTAGG - Intergenic
1115455777 14:33600780-33600802 GTGTTTAGACTTATGCTGTTTGG - Intronic
1115807607 14:37069413-37069435 GTGTGTACAAATATGTGTTTAGG + Intronic
1116644221 14:47506163-47506185 GTGTTTAGGCAAATGGAGTTTGG + Intronic
1118663706 14:68043299-68043321 GTTTTTACATGTTTGGGGTTTGG + Intronic
1120901556 14:89580091-89580113 GTGTTTAGAAATATGGGTTATGG - Intronic
1121599769 14:95194675-95194697 GGGTTTCCACGTATGGGTTTAGG + Intronic
1122119539 14:99544742-99544764 GTCTTTTCACATCTGGGGCTGGG - Intronic
1123412524 15:20072408-20072430 GTGTTTACACATATGGGGTTTGG + Intergenic
1123521866 15:21079521-21079543 GTGTTTACACATATGGGGTTTGG + Intergenic
1123678906 15:22742049-22742071 GTGTTTACAGATAGGTAGTTTGG + Intergenic
1123776047 15:23581231-23581253 ATGTTTATACACATTGGGTTGGG - Intronic
1124331115 15:28816343-28816365 GTGTTTACAGATAGGTAGTTTGG + Intergenic
1126559448 15:50027156-50027178 GGGTGCACACATATGGGGTAGGG - Intronic
1127273626 15:57423328-57423350 GTGTTTACAGCCATGGGGGTTGG - Intronic
1127903613 15:63359496-63359518 GTGTGTACATATATATGGTTAGG - Intronic
1129150816 15:73686765-73686787 TTGGTTGCACATACGGGGTTTGG + Intronic
1130921278 15:88347002-88347024 GTGTTTACTCAGATTGGGTTGGG - Intergenic
1134312972 16:13093032-13093054 GTATTTCCACAAATGGGTTTTGG - Intronic
1137454189 16:48605722-48605744 GTGTTTACACCTCTGGGCTGGGG - Intronic
1139291327 16:65860554-65860576 GTGGCTACAAATATGGGGTTGGG - Intergenic
1140476354 16:75241173-75241195 GTGTTTACACATATGGGGTTTGG + Intronic
1142587297 17:981251-981273 GTCTTTTCACAAATGGAGTTTGG - Intergenic
1143272221 17:5684175-5684197 GTGTTTACCCTTGTGGGGTGGGG - Intergenic
1146051267 17:29555470-29555492 GTGTGTACATATATGGGGGTGGG + Intergenic
1149950019 17:60975963-60975985 TTGTTTCCACATTTGGGCTTAGG + Intronic
1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG + Intronic
1150705990 17:67487807-67487829 GAGTTCACACACTTGGGGTTTGG + Intronic
1152515003 17:80817869-80817891 GTGGTTGCACAAATGGGGTGTGG + Intronic
1154018038 18:10637699-10637721 GTGATTGCACATATTGGGGTGGG - Intergenic
1154186831 18:12191883-12191905 GTGATTGCACATATTGGGGTGGG + Intergenic
1155980375 18:32173771-32173793 TTGTTTTCAAATAAGGGGTTAGG - Intronic
1157984686 18:52423635-52423657 CTGTTTACACATATGTGCTGAGG + Intronic
1158216416 18:55104699-55104721 GTGGGTACACATATTGGTTTGGG + Intergenic
1162669252 19:12240707-12240729 GTCTTTAAACATATGTTGTTGGG + Intronic
1163127637 19:15252885-15252907 GTGTGTGCACAGATGGGGTGGGG - Intronic
1163291725 19:16383630-16383652 GTGTTTACACAGATGAGCCTGGG - Intronic
1163892723 19:20031162-20031184 GTGATATCACATATGGGTTTAGG - Intronic
1167607670 19:50490070-50490092 TTGTTTTCAGTTATGGGGTTGGG - Exonic
926057749 2:9785259-9785281 TAATTTACACATATGTGGTTGGG - Intergenic
928918414 2:36499856-36499878 GTTTTAACATATATGGGGGTGGG - Intronic
931635469 2:64337448-64337470 GGGGATTCACATATGGGGTTGGG - Intergenic
939416351 2:141903729-141903751 GAGTTTACAGATTTGGGGTTGGG + Intronic
939565232 2:143779350-143779372 GTGTTTACATACAAGGGGCTGGG - Intergenic
939660360 2:144881448-144881470 GTGTCTCCACATTGGGGGTTAGG + Intergenic
939982889 2:148802065-148802087 GTGCTCACAGATATGGTGTTTGG + Intergenic
940945261 2:159608968-159608990 GCGTTTCCACACATGGTGTTAGG - Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
943256732 2:185602996-185603018 ATTTTTACACGGATGGGGTTGGG - Intergenic
944896898 2:204174388-204174410 GTGTTTTCAAATATGGGGCATGG + Intergenic
945226623 2:207537350-207537372 GTCTTTACATATTTGGGGATGGG + Intronic
945438482 2:209848855-209848877 GTGTTTACAGTTATGGGCCTGGG - Intronic
946659390 2:221983535-221983557 GTGGTTAAACATAGGGGTTTGGG - Intergenic
948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG + Exonic
948768871 2:240237115-240237137 GTGTGTATACATGTGGGGTGGGG + Intergenic
948916765 2:241038345-241038367 GTGTTTACACATATTGGTATTGG + Intronic
1172030164 20:31976262-31976284 GTGGTTCCACATGTGGGTTTGGG - Intronic
1173541549 20:43855914-43855936 GTGGTTAAACACATGGGCTTTGG + Intergenic
1174253869 20:49239474-49239496 ATGTTTCCACATTTGGGGTGTGG + Intronic
1174407270 20:50310504-50310526 GTGTGTGCACGTATGGGGTGGGG + Intergenic
1178481330 21:32981757-32981779 GTGTTTAAGAATATGGGCTTTGG + Intergenic
1181379507 22:22489762-22489784 GTGTTTAGAAACATGGGCTTTGG + Intronic
1183010709 22:34944379-34944401 CTGTTTACACAGCAGGGGTTGGG - Intergenic
1183420779 22:37710197-37710219 GAGTGTACACATATGGGCCTTGG - Intronic
1184250022 22:43254640-43254662 GTGTTTGCAGCTATGGGGTCAGG - Intronic
951126594 3:18991961-18991983 GTGTGTACATATCTGGGGATTGG - Intergenic
952489519 3:33853465-33853487 GTGTTTACAGATAGGTAGTTTGG + Intronic
955073657 3:55592726-55592748 GTGTCTACACGTATTTGGTTTGG - Intronic
955124283 3:56094955-56094977 GTGCTAAAACAGATGGGGTTGGG + Intronic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
956527794 3:70184053-70184075 GTGGTTGCAAAGATGGGGTTTGG + Intergenic
956933646 3:74074735-74074757 GAGTTTACATGTATGGTGTTAGG - Intergenic
959328469 3:104970274-104970296 TTTTTTACTCATTTGGGGTTTGG + Intergenic
962403263 3:135079494-135079516 GTGTTTGCACTGATGGGGTCAGG - Intronic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
970498316 4:16650897-16650919 GGGTTTTCACATTTGGGTTTGGG - Intronic
971440013 4:26674559-26674581 GTGTTTAAAAACATGGGTTTTGG + Intronic
974969536 4:68807163-68807185 GTATTTACAAAGATGTGGTTTGG + Intergenic
975836682 4:78429774-78429796 CAGTTTCTACATATGGGGTTTGG + Intronic
978643136 4:110895373-110895395 GGGTATACACATGTGTGGTTTGG + Intergenic
981942342 4:150295689-150295711 GTGTATACACATATAGGCATAGG + Intronic
982947853 4:161648646-161648668 CTGTTTACACAATTTGGGTTTGG + Intronic
983606198 4:169588132-169588154 GTGATTAGAAATATGGGCTTGGG + Intronic
984035202 4:174659027-174659049 GTGATTAAACGTATTGGGTTTGG - Intronic
986931617 5:12831120-12831142 GTGTGTACACATATGCATTTAGG - Intergenic
989554836 5:42781752-42781774 GTATTTACACACAAGGAGTTGGG + Intronic
993777218 5:92014172-92014194 CTGTTTAGACCTGTGGGGTTTGG - Intergenic
994055644 5:95411180-95411202 GTGTTTTAACACATGGGCTTTGG + Intronic
994106950 5:95959964-95959986 GTGTGCACACTTATGGGGTGGGG + Intronic
996421680 5:123269740-123269762 GTGTTTAGATATATTGGATTTGG + Intergenic
996785979 5:127237151-127237173 ATGTTTGCACATCTGGGTTTTGG + Intergenic
997764925 5:136492734-136492756 ATGTTTCCTCATATGTGGTTAGG - Intergenic
998890070 5:146736518-146736540 GGCTTTAGACATATGAGGTTTGG - Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
1003985069 6:11427237-11427259 GTGTGTGCACATGTGGTGTTGGG - Intergenic
1004409318 6:15366039-15366061 GTGTAAACAAAAATGGGGTTGGG - Intronic
1004669059 6:17778536-17778558 GTGTTTAAGCATATGTGCTTTGG + Intronic
1007507045 6:42343688-42343710 GTGATAACAGGTATGGGGTTTGG + Intronic
1008662864 6:53686942-53686964 GTGTGTACACAGTTTGGGTTTGG + Intergenic
1009047341 6:58247410-58247432 GTGTGTACACACCCGGGGTTTGG - Intergenic
1009223148 6:61001709-61001731 GTGTGTACACACCCGGGGTTTGG - Intergenic
1009590187 6:65658826-65658848 GTGTTTACAGATATTGTCTTGGG + Intronic
1010570535 6:77468232-77468254 GTGTTTATTCATATGGAGATAGG - Intergenic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1014279543 6:119425699-119425721 GTGTTTAAAGTTATGGGATTAGG + Intergenic
1014721341 6:124921252-124921274 GTATTTACAGATATATGGTTTGG - Intergenic
1014948799 6:127529968-127529990 GTATTTCCACACATTGGGTTTGG + Intronic
1015157782 6:130116418-130116440 GTGGTTACACATATGATCTTAGG - Intronic
1018640586 6:165900588-165900610 GTGTATATACACATGGGGGTTGG - Intronic
1020952108 7:14692962-14692984 ATGTTGGCACATATGGGTTTAGG - Intronic
1021958948 7:25853116-25853138 GTGTTTAAACAAATGGAGATGGG - Intergenic
1023249089 7:38238237-38238259 GTGTTTAAATATATGGGCTCTGG + Intergenic
1029960537 7:104685421-104685443 GTGTTTACACACACTGGGCTAGG - Intronic
1032356269 7:131213995-131214017 ATGTTTACACCTTTGGGGTAGGG - Intronic
1033176371 7:139127587-139127609 GTGGGCACACATAAGGGGTTGGG + Intergenic
1034951759 7:155302426-155302448 GTGTTTTCAAATATTGGCTTTGG + Intronic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1038297229 8:26305357-26305379 CTTTTTATATATATGGGGTTCGG + Intronic
1041247655 8:55904461-55904483 CTGAGTTCACATATGGGGTTAGG + Intronic
1043445228 8:80313046-80313068 ATGTTTCCACAAATGGGGTGGGG + Intergenic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1046214916 8:111131488-111131510 GTGTTCATACATATGGTGATGGG + Intergenic
1048228842 8:132617208-132617230 GTGTTTACAGCCATGGGATTTGG + Intronic
1050518514 9:6471714-6471736 GTACTTACTCATATGGGGGTGGG - Intronic
1052532820 9:29709463-29709485 GTGTATACACATATCAGGTATGG + Intergenic
1054739754 9:68793110-68793132 GTGTATACACATATAGTGTAAGG + Intronic
1055107712 9:72529516-72529538 GTGTATATACATATGTGTTTAGG + Intronic
1058745162 9:107983278-107983300 CTGTTTACCCATGTGGGGTTGGG - Intergenic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1186761179 X:12723770-12723792 GTTCTTACGGATATGGGGTTTGG + Exonic
1187029222 X:15468438-15468460 TTGTTTGCACATATGGTCTTGGG + Intronic
1189252287 X:39610769-39610791 GTGTTTGCAAATCTGTGGTTTGG - Intergenic
1189256833 X:39646501-39646523 GGGTTTTAACATATGGGTTTTGG - Intergenic
1191833139 X:65436443-65436465 GTGTCCACACATATTGGGTGAGG + Intronic
1195228326 X:102820863-102820885 GGGTTTCCACATATGAGTTTTGG + Intergenic
1195271319 X:103233774-103233796 TTGTTTACATATAGGGGGATTGG + Intergenic
1201722116 Y:17110819-17110841 GTAGTTACAAATATGGGGTATGG - Intergenic