ID: 1140477443

View in Genome Browser
Species Human (GRCh38)
Location 16:75245899-75245921
Sequence CTAGATGCTCAGAGAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140477443_1140477445 -9 Left 1140477443 16:75245899-75245921 CCTTAGCCTCTCTGAGCATCTAG 0: 1
1: 0
2: 1
3: 36
4: 390
Right 1140477445 16:75245913-75245935 AGCATCTAGATCCTCTCTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 116
1140477443_1140477447 13 Left 1140477443 16:75245899-75245921 CCTTAGCCTCTCTGAGCATCTAG 0: 1
1: 0
2: 1
3: 36
4: 390
Right 1140477447 16:75245935-75245957 GATGACAGCCCTCATTTCATAGG 0: 1
1: 0
2: 1
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140477443 Original CRISPR CTAGATGCTCAGAGAGGCTA AGG (reversed) Intronic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
901314524 1:8297160-8297182 CTACATTCTCAGAGGGGTTACGG - Intergenic
901864029 1:12092292-12092314 CTAGCTACTCAGAAAGGCTGAGG - Intronic
902451658 1:16500191-16500213 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
902631073 1:17705069-17705091 CTACATGTTCAGAGAGGACAGGG - Intergenic
903340964 1:22654034-22654056 CAAGAGGCTCAGAGAGGTTAAGG + Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
903837377 1:26214028-26214050 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
905343963 1:37298928-37298950 ATAGAGGCTCAGAGAAGCTATGG + Intergenic
905484583 1:38286301-38286323 CTAGATCCCCAGAAAGGCTGAGG + Intergenic
905980755 1:42224536-42224558 CTAGCTACTCGGAGGGGCTAAGG + Intronic
906144748 1:43553250-43553272 CTAGAGGCCCAGAGAGGTTAAGG - Intronic
908109000 1:60876156-60876178 CCAGCTACTCAGAGAGGCTGAGG - Intronic
908168460 1:61481862-61481884 CTTGATCCTCATAGAGGCCAAGG + Intergenic
908540948 1:65121647-65121669 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
909286215 1:73822320-73822342 TTTGATTTTCAGAGAGGCTATGG - Intergenic
909758297 1:79255941-79255963 ATTGAAGATCAGAGAGGCTAAGG + Intergenic
911842053 1:102695205-102695227 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
912321132 1:108714718-108714740 CCAGCTGCTCGGAGAGGCTGAGG - Intronic
912353610 1:109037509-109037531 CCAGCTACTCAGAGAGGCTGAGG + Intronic
912524219 1:110268841-110268863 CCAGCTACTCAGAGAGGCTGAGG - Intronic
912799362 1:112711567-112711589 ATTGATGCACAGAGAGGTTAAGG + Intronic
914889011 1:151606437-151606459 CTAGGTGCTCAGTGTGGCTCTGG - Intergenic
916175658 1:162036149-162036171 CTGGAGGCTCAGGGAGGCCATGG - Intergenic
916368047 1:164056138-164056160 ATTAAGGCTCAGAGAGGCTAAGG - Intergenic
916784056 1:168070744-168070766 CTAGAAGCTTTGAGAGGCTTTGG + Intronic
918247361 1:182671697-182671719 CTGGATGGTCAGAGAGGCTTCGG + Exonic
918769917 1:188544326-188544348 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
920979589 1:210820854-210820876 CTAGATGCTGAGAAAGACCAGGG + Intronic
921252005 1:213307176-213307198 CCAGCTACTCGGAGAGGCTAAGG - Intergenic
922486812 1:225979744-225979766 ACTGATGCTCAGAAAGGCTATGG + Intergenic
922516485 1:226211984-226212006 ACCGATGCTCAGAGAGGTTAAGG + Intergenic
923499413 1:234551850-234551872 CCAGCTGCTCAGGGAGGCTGAGG - Intergenic
923759836 1:236831843-236831865 CTATCTGCTCAGATGGGCTATGG + Intronic
1064194730 10:13235420-13235442 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1065039415 10:21676300-21676322 CTAGCTACTCGGAGAGGCTGAGG + Intronic
1065911740 10:30312452-30312474 CCAGCTACTCAGAGAGGCTGAGG + Exonic
1069003782 10:63295207-63295229 TGAGATACTCAGGGAGGCTAAGG - Intronic
1069051403 10:63798689-63798711 CTTGATGCTCAGAGATGCCTGGG + Intergenic
1069880942 10:71592801-71592823 GCAGATGCTCAGAGAGGGCACGG - Intronic
1069923808 10:71834168-71834190 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1070607887 10:77912084-77912106 CTAGCTACTCAGGGAGGCTGAGG + Intronic
1071207533 10:83298437-83298459 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1071439096 10:85674591-85674613 CTGGAGGCTCTGAGAGGTTAAGG + Intronic
1071600519 10:86956621-86956643 CCTGAGGCTCAGAGAGGCTGAGG - Intronic
1073410159 10:103335160-103335182 CCAGCTGCTCAGGTAGGCTAAGG - Intronic
1074051091 10:109881901-109881923 CTTGAGGCTCAGAGAGGATTGGG - Intronic
1074581753 10:114725858-114725880 CCAGCTGCTCTGAGAGGCTGAGG - Intergenic
1074720904 10:116264297-116264319 CTTGAAGCTCAGAGAGGGGAGGG - Intronic
1076413038 10:130265287-130265309 CTTGAGGCTCAGAGAGGCAGTGG - Intergenic
1077260077 11:1612744-1612766 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1078441805 11:11374265-11374287 TCGGAGGCTCAGAGAGGCTAGGG - Intronic
1078599584 11:12718297-12718319 TTTCATGCTCTGAGAGGCTAGGG - Intronic
1080805538 11:35649712-35649734 CTAGCTACTCAGGGAGGCTGAGG + Intergenic
1081158874 11:39729057-39729079 AATGATGCTCAGAGAGGCCAAGG + Intergenic
1081968070 11:47181459-47181481 CTGGAAGCTCAGAGAGGCTAAGG - Intronic
1082280909 11:50270360-50270382 CCAGATACTCAGGGAGGCTGAGG + Intergenic
1083569992 11:63754810-63754832 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1083980427 11:66163233-66163255 TTAGCTGCTCAGGGAGGCTAAGG + Intronic
1084529070 11:69716524-69716546 ATAGAAGCTCAGAAAGGCTCAGG + Intergenic
1084609471 11:70193116-70193138 CAGGAGGCTCAGAGAGGCTCAGG + Intergenic
1085198334 11:74685533-74685555 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1087687146 11:101277723-101277745 CTTGAGGCACAGAGAGGTTAAGG + Intergenic
1088474721 11:110223235-110223257 CCAGCTGCTCAGGGAGGCTGAGG + Intronic
1089931394 11:122316872-122316894 CCTGAAGCTCAGAGAGGTTAGGG - Intergenic
1091471252 12:730088-730110 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1092184520 12:6469066-6469088 ATAACTCCTCAGAGAGGCTATGG + Intronic
1092351045 12:7756027-7756049 TCAGTTGCTCAGGGAGGCTAAGG + Intergenic
1092466123 12:8733766-8733788 CTAGCTACTCGGAGAGGCTGAGG + Intronic
1093339251 12:17950641-17950663 GTAGATGCTCAGAGTAGTTACGG - Intergenic
1093987484 12:25552489-25552511 CTAGCTACTCCGAGAGGCTGAGG + Intronic
1093994655 12:25628742-25628764 CTAGAAGCTAAAAGAGGCAAGGG + Intronic
1094411089 12:30169711-30169733 CTAGAAGCCCAGAGAGGCTGGGG + Intergenic
1094426814 12:30324592-30324614 CAAGATTCTCTGAGAGCCTATGG - Intergenic
1094571717 12:31646913-31646935 CAAGATCCTTAGGGAGGCTAAGG - Intergenic
1096186829 12:49587065-49587087 CTACAAGCCCAGAGAGGCAAAGG + Intronic
1096200799 12:49681314-49681336 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1096976505 12:55702293-55702315 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1097001252 12:55878850-55878872 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1097097228 12:56559298-56559320 CCAGCTACTCAGGGAGGCTAAGG - Intronic
1097251936 12:57639318-57639340 CCAGCTACTCAGAGAGGCTAAGG + Intergenic
1100382102 12:94071611-94071633 ATTGAGGCCCAGAGAGGCTAAGG - Intergenic
1101677082 12:106927015-106927037 CTAGCTACTTAGGGAGGCTAAGG - Intergenic
1101985866 12:109446646-109446668 CCAGATACTCAGGGAGGCTGAGG + Intronic
1102207867 12:111102757-111102779 ACAGAGGCTCAGAGAGGTTAAGG - Intronic
1102254771 12:111409222-111409244 CCTGTGGCTCAGAGAGGCTAAGG - Intronic
1102383876 12:112490555-112490577 CTAACTACTCAGAGAGGCTGAGG - Intronic
1102862908 12:116351848-116351870 CCAGATGCTGAGAGGGGCTCGGG + Intergenic
1102887834 12:116534878-116534900 CTGGATGCTGGGAGAGGCTGCGG - Intergenic
1104299033 12:127547149-127547171 ATAGAGGCTCAGAGAGGTTCAGG - Intergenic
1104299083 12:127547741-127547763 GTAGAGGCTCAGAGAGGCTCAGG - Intergenic
1104889559 12:132133758-132133780 CTAGTTGCTGAGAGACTCTAGGG - Intergenic
1105417843 13:20228597-20228619 CCAGCTGCTCAGAGAGGCTGAGG - Intronic
1107014068 13:35695018-35695040 ATAGGTGCTCAGAGAAGCTGTGG + Intergenic
1108540581 13:51441117-51441139 CTTGATGCTCAGAGAGATTAAGG + Intronic
1109051979 13:57494816-57494838 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1109185106 13:59259059-59259081 CCAGAAGCTCAAAGAGGCAAAGG + Intergenic
1109250761 13:60017286-60017308 CCAGCTACTCGGAGAGGCTAAGG + Intronic
1110580793 13:77122572-77122594 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1111944410 13:94648592-94648614 CTAGATGCTAAGAGTGGCCGTGG - Intergenic
1112596989 13:100816391-100816413 AGAGATGCTCAGAGATGCTGGGG + Intergenic
1113105912 13:106771487-106771509 CGAGATGCTCACAGATGCTGAGG - Intergenic
1113645514 13:111992404-111992426 CTCGGTGTTCAGAGAGGCCAAGG - Intergenic
1114323755 14:21568824-21568846 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1114346762 14:21804477-21804499 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1115739609 14:36374178-36374200 GCACATGCTCAGAGAGGCTTTGG - Intergenic
1119179615 14:72596811-72596833 CAGGATGCTCAGAGAGGCTCAGG + Intergenic
1119313306 14:73669231-73669253 CTAGCTACTCAGGGAGGCTGAGG - Intronic
1119902758 14:78275410-78275432 TTTGAGGCTCAGAGAAGCTAAGG + Intronic
1120408059 14:84114196-84114218 CTAGAAGCTGAGAAAGTCTAAGG + Intergenic
1122052370 14:99068570-99068592 GCAGAGGCTCAGAGAGGTTAAGG - Intergenic
1122113788 14:99517906-99517928 CAAGATGCTGGGAGAGGCTTGGG + Intronic
1122559274 14:102600200-102600222 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1123432369 15:20229580-20229602 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1123631738 15:22265734-22265756 CTAGCTGCTCAGGGAGGCCTCGG - Intergenic
1125934908 15:43626693-43626715 CCAGATACTCGGAGAGGCTGAGG - Intergenic
1126783883 15:52161115-52161137 CCTGGAGCTCAGAGAGGCTAAGG + Intronic
1128123033 15:65168970-65168992 CTGGATACTCAGGGAGGCTGAGG - Intronic
1128661868 15:69507281-69507303 CAAAATGCTCAGAGAGGTTGAGG - Intergenic
1128797736 15:70477704-70477726 CAGGAGGCTCAGAGGGGCTAAGG + Intergenic
1128867102 15:71122314-71122336 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1128926316 15:71659525-71659547 CCAGCTACTCAGGGAGGCTAAGG - Intronic
1129098156 15:73231617-73231639 CTAGCTGCTCAGGGAGGCTGAGG + Intronic
1129593912 15:76944106-76944128 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1130247399 15:82264184-82264206 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1130526245 15:84709279-84709301 CCAGCTGCTCAGGGAGGCTGAGG - Intronic
1131059276 15:89394633-89394655 ATAGAGGATCAGAGAAGCTAAGG - Intergenic
1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG + Intronic
1131616267 15:94020055-94020077 CCAGATGCTCAGGGAGGCTGAGG - Intergenic
1132083576 15:98887817-98887839 CATGATGATCAGAGAGGGTAGGG - Intronic
1132276231 15:100566677-100566699 TTAGATGCTCAGAAAGGCCAAGG + Intronic
1132907493 16:2290401-2290423 CCAGGAGCTCAGAGAGGCCAGGG + Intronic
1134211855 16:12284280-12284302 CTTGAGGCTTAGAGAGGTTAGGG - Intronic
1134375481 16:13668682-13668704 ATAGAGGCTTAGAGAGGTTAAGG - Intergenic
1135127390 16:19822627-19822649 CTAAAGACACAGAGAGGCTATGG + Intronic
1135191844 16:20360778-20360800 CTGGAGGCTAAGAGAGGTTAGGG - Intronic
1135525101 16:23208229-23208251 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1135768043 16:25194948-25194970 GGAGCTGCTCAGAGAGGCTAAGG - Intergenic
1135889146 16:26341661-26341683 CAAGATGCTCAGAGACCCTGGGG + Intergenic
1136852273 16:33621560-33621582 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1137589141 16:49682744-49682766 ACTGAGGCTCAGAGAGGCTAGGG - Intronic
1137909655 16:52363705-52363727 CTGGATGCTGATAGAGGCAAAGG + Intergenic
1138621647 16:58216264-58216286 CTAGCTACTCGGAGAGGCTGAGG - Intergenic
1139509679 16:67420011-67420033 CTAGATGCTGGAAAAGGCTAGGG + Intergenic
1140477443 16:75245899-75245921 CTAGATGCTCAGAGAGGCTAAGG - Intronic
1141643796 16:85356826-85356848 CCAGTTGCTCAGAGAGGTGAGGG + Intergenic
1142319157 16:89369973-89369995 ATGGAAGCTCAGAGAGGCTGGGG + Intronic
1203113868 16_KI270728v1_random:1470031-1470053 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1203141195 16_KI270728v1_random:1767918-1767940 TGAGAAGCTCAGAGAGGCTGGGG - Intergenic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1143243355 17:5462685-5462707 CTAGCTGCTGAGAGAGACAATGG + Intronic
1143284052 17:5776028-5776050 ATTGAGGCTCAGAGAGGTTAAGG + Intronic
1143698728 17:8641016-8641038 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1143724185 17:8834039-8834061 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1143734164 17:8898744-8898766 CAGGAGGCTCAGAGAGTCTAAGG + Intronic
1144409728 17:14988833-14988855 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1144708907 17:17387761-17387783 CTGGAAACTCAGAGAGGTTAGGG - Intergenic
1145903311 17:28501719-28501741 CTAGATGCTTAGACAGGCTGGGG - Intronic
1145973878 17:28973184-28973206 ACAGAGGCTCAGAGAAGCTAAGG + Intronic
1146261813 17:31427072-31427094 CCAGCTACTCAGGGAGGCTAAGG - Intronic
1146503285 17:33382683-33382705 ATTGAGGATCAGAGAGGCTAAGG + Intronic
1147180475 17:38681683-38681705 CCAGCTGCTCGGAGAGGCTGAGG + Intergenic
1147693395 17:42332722-42332744 CCAGCTACTCAGGGAGGCTAAGG + Intronic
1147708673 17:42447106-42447128 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1148325449 17:46780659-46780681 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1148861422 17:50606249-50606271 ACAGAGGCTCAGAGAGGGTAAGG + Intronic
1149033591 17:52110390-52110412 ATTGAGGCTCAGAGAGGTTAAGG - Intronic
1150071273 17:62152302-62152324 CCAGCTGTTCAGGGAGGCTAAGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151657106 17:75501252-75501274 CCAGAGGCTCAGGGAGGCAAGGG + Intronic
1152559188 17:81069423-81069445 CAAGGTGGTCAGAGAGGCTGGGG + Intronic
1153866438 18:9273788-9273810 CTCAATGCTCTGGGAGGCTAAGG - Intronic
1155438200 18:25834469-25834491 CTAGCTGCTTAGGGAGGCAAAGG - Intergenic
1156518168 18:37698611-37698633 CTGGATGCTGAGAGAGGTTCAGG + Intergenic
1156574647 18:38300733-38300755 ATGGAAGCTCAGAGAGGCTGGGG + Intergenic
1157158024 18:45286778-45286800 CTAAATGCTCATAGATGTTATGG + Intronic
1157243668 18:46034749-46034771 ATTGAGGTTCAGAGAGGCTATGG - Intronic
1157802294 18:50630523-50630545 CTGGATGCCCAGAATGGCTACGG - Intronic
1157986631 18:52446045-52446067 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1158078182 18:53556332-53556354 CTAGATTCTCAGAGATTATAAGG + Intergenic
1158159855 18:54468829-54468851 ACAGAAGCTCAGAGAGGTTATGG - Intergenic
1158535119 18:58301597-58301619 AGAGACGCTCAGAGAGGCTAGGG + Intronic
1159330659 18:66990620-66990642 CTCGATCCTCAGAAAGGCCAAGG - Intergenic
1159658720 18:71065406-71065428 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1159955877 18:74518144-74518166 CCAGCTGCTCAGAGAGGCTGAGG + Intronic
1160087056 18:75786356-75786378 CTAGAAGCTCAAAAAGGCAAAGG - Intergenic
1160713897 19:566303-566325 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1160828369 19:1091155-1091177 CTCGATGAGCAGAGAGGCTGGGG - Intronic
1161119989 19:2520451-2520473 ATGGAGGCTCAGAGAGGTTAAGG + Intronic
1161226284 19:3147770-3147792 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1161819862 19:6523397-6523419 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1161913366 19:7211315-7211337 CTTGGTGCTTAGAGAGGCCAAGG - Intronic
1163170827 19:15529897-15529919 CTAGAATCTCAGATAGGCTCTGG - Intronic
1163590150 19:18188727-18188749 CCAGTTACTCAGAGAGGCTGAGG - Intergenic
1163711360 19:18849156-18849178 GGAGATGCTCAGAGTGGCCATGG + Intronic
1164056396 19:21625594-21625616 CTAGGTACTCAGGGAGGCTGAGG - Intergenic
1165028595 19:32980951-32980973 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1165637842 19:37358258-37358280 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1166841567 19:45700518-45700540 CTAGTTCCTTAGAAAGGCTAGGG - Intronic
1167374171 19:49102351-49102373 CAAGATTCTCAGAGAGCATACGG - Intronic
1168265825 19:55223572-55223594 CCAGACGCTCACAGAGGCCACGG - Intergenic
926105318 2:10146162-10146184 CTTGAGGCTCAGGGAGGTTAAGG + Intronic
926707439 2:15846656-15846678 CCAGAGGCTCAGGGAGGCTGAGG + Intergenic
927593818 2:24379762-24379784 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
928118618 2:28565745-28565767 AGAGAAGCTCAGAGAGGTTAGGG - Intronic
928225204 2:29442563-29442585 GCAGAGGCTCAGAAAGGCTAAGG - Intronic
928292127 2:30048743-30048765 TGAGAGGCTCAGAGAGGGTAAGG - Intergenic
929024865 2:37590398-37590420 CTATATCCTCAGAGAAGCTCAGG - Intergenic
929224250 2:39496650-39496672 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
930041249 2:47126439-47126461 CCAGTTACTCAGCGAGGCTAAGG - Intronic
930253440 2:49061262-49061284 TTAGATGCTCACAGCAGCTATGG - Intronic
933900427 2:86845977-86845999 ATAGATGCGCAGAGAGGGGAAGG + Intronic
934102933 2:88670146-88670168 ATGGATACTCAGAGAGGTTAAGG + Intergenic
934694467 2:96389247-96389269 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
935059767 2:99597090-99597112 GATGAGGCTCAGAGAGGCTAAGG + Intronic
935242643 2:101191799-101191821 CTAGCTACTCAGGGAGACTAAGG + Intronic
935780121 2:106503248-106503270 ATAGATGCGCAGAGAGGGGAAGG - Intergenic
935899313 2:107773670-107773692 TCTGATGCTCAGAGAGGTTAAGG + Intergenic
936043039 2:109164296-109164318 CTAGCTACTCAGGGAGGCTGAGG - Intronic
937158566 2:119739124-119739146 CTAGATGCTTAGCAATGCTAGGG - Intergenic
937158583 2:119739272-119739294 CTAGATGCTCAGCAATGCTAGGG - Intergenic
937566238 2:123292636-123292658 CTAGCTACTCAGGGAGGCTGAGG - Intergenic
937950776 2:127386911-127386933 CTTGAGGCTCAGAGAGATTAAGG - Intronic
938066423 2:128284190-128284212 CTAGGTGCTCAGACAGGGCAGGG + Intronic
938734842 2:134176455-134176477 CTAGCTACTCAGGGAGGCTGAGG + Intronic
939205724 2:139100509-139100531 GAAGATACTAAGAGAGGCTACGG - Intergenic
939872166 2:147537844-147537866 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
940350425 2:152679964-152679986 CCAGCTACTCAGAGAGGCTGAGG - Intronic
942443931 2:176065876-176065898 CCAGCTGCTCAGGGAGGCTGAGG + Intergenic
942700284 2:178699840-178699862 CCAGCTACTCAGAGAGGCTGAGG - Intronic
944087654 2:195868209-195868231 CCAGCTACTCAGAGAGGCTGAGG - Intronic
944798126 2:203208168-203208190 CCAGCTACTCAGGGAGGCTAAGG + Intronic
945675744 2:212853350-212853372 GTAGATGCTCCAAAAGGCTATGG - Intergenic
945752119 2:213800480-213800502 CTAGATACTCAAGGAGGCTAAGG - Intronic
945979799 2:216300141-216300163 GTTAAAGCTCAGAGAGGCTAAGG - Intronic
946072456 2:217046218-217046240 CTGGGAGCTCAGAGAGACTAAGG + Intergenic
946630144 2:221658303-221658325 CTAGAAGGTCAGAGTGGCTGTGG - Intergenic
947237379 2:227956413-227956435 CCAGATGCTCAGAGAACATAGGG + Intergenic
1168810608 20:702088-702110 CCAGAAGCTCAGAGAGGTAACGG - Intergenic
1169070988 20:2730275-2730297 CCAGAAGCTAAGAGAGGCAAGGG - Intronic
1169271300 20:4201489-4201511 CCAGCTGCTCCCAGAGGCTAAGG - Intergenic
1170239346 20:14146201-14146223 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1171323769 20:24272159-24272181 ATAGATGCTAAGAGAGGTGAGGG - Intergenic
1172595608 20:36149170-36149192 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1172674304 20:36656865-36656887 CTTGATGCACAGAGAAGTTAGGG - Intronic
1172857498 20:38017137-38017159 CTAGAGGCTCTGAGAGGGCAGGG + Intronic
1173279582 20:41617196-41617218 AGAGATGCTCAGAGATGCCAAGG + Intronic
1173850138 20:46212596-46212618 ATAGATGCTGAGAGAGGTAAAGG - Intronic
1174107148 20:48170857-48170879 ATTGATACTCAGAGAGGGTAAGG - Intergenic
1174180392 20:48670645-48670667 AAGGATACTCAGAGAGGCTAAGG - Intronic
1174191579 20:48744369-48744391 ATAGAGGCTCAGAGAGGCAAAGG + Intronic
1174288690 20:49491095-49491117 ATTGAGGCTCAGAGAGGTTAGGG - Intergenic
1174458710 20:50667862-50667884 ATGGAAGCTCAGAGAGGCTACGG - Intronic
1174874783 20:54215639-54215661 ATAGAGGCTTAGAGAGGTTATGG + Intronic
1175825550 20:61934662-61934684 CCAGATGCTCAGAGAGGCAGAGG + Intronic
1179085364 21:38211954-38211976 ACAGAGGCTCAGAGAGGTTAAGG - Intronic
1179270234 21:39845141-39845163 CTACATCCTCAGAGAAGCAAGGG - Intergenic
1179270266 21:39845303-39845325 CTACATCCTCAGAGAAGCAAGGG - Intergenic
1179501433 21:41811797-41811819 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1179545852 21:42111754-42111776 CCAGAGGCTCACACAGGCTATGG - Intronic
1180092476 21:45540133-45540155 CCTGATGCCCAGAGAGGCCACGG + Intronic
1180524809 22:16247403-16247425 CTAGATGCTCAAAGAGGAGCAGG + Intergenic
1182833895 22:33325913-33325935 CAAGGTGCTCAGAGAAGCTGGGG + Intronic
1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG + Intronic
1183101698 22:35588135-35588157 TTAGAGGCACAGAGAGGTTAAGG - Intergenic
1183263194 22:36809564-36809586 ACTGAGGCTCAGAGAGGCTAAGG - Intronic
1183491290 22:38117320-38117342 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1184410249 22:44322152-44322174 CTAGGAGCTCAGAGAGGCAAAGG - Intergenic
1185379475 22:50501531-50501553 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
949854670 3:8450648-8450670 GTAGATGCTCACAGATGCTCTGG - Intergenic
950128047 3:10522783-10522805 CTGGAGGCTCAGAGAGGTAATGG + Intronic
950223327 3:11213358-11213380 ATTGAGGCTCAGAGATGCTAAGG - Intronic
950269311 3:11600981-11601003 CCAGCTGCCCAGAGAGTCTACGG - Intronic
951659467 3:25046566-25046588 CCAGCTACTCAGGGAGGCTAAGG - Intergenic
952340598 3:32442382-32442404 CCAGCTACTCAGAGAGGCTGAGG + Intronic
953851491 3:46468598-46468620 CTAGAGGCTCATAGAGGGCAGGG - Intronic
953993758 3:47503773-47503795 CCAGCTACTCAGAGAGGCTGAGG + Intronic
954391057 3:50268079-50268101 GGAGAGGCTCAGAGAGGCTGTGG + Intronic
955754702 3:62215717-62215739 TTAGATTCTCAGAGAGGTTCAGG - Intronic
958734668 3:97994750-97994772 ATAGAAGCTCAGAGTGGCTAAGG + Intronic
959549643 3:107640133-107640155 ATAGAGGCTCAGAGAGGCTTAGG + Intronic
960075539 3:113480771-113480793 CTAGAGGCTGAGGGAGGCTGAGG + Intronic
960624109 3:119663488-119663510 CAGCAGGCTCAGAGAGGCTAAGG + Intronic
961085385 3:124063012-124063034 CTAGATGCACAGAGGACCTAAGG + Intergenic
961381855 3:126500561-126500583 GCAGAGGCTCAGAGAGGTTAAGG + Intronic
962851460 3:139311298-139311320 CAAGATGCTCACAGATGCTGAGG + Intronic
962890037 3:139663463-139663485 CAAGGTGCTCAGAGAAGCAATGG + Intronic
964355598 3:155849026-155849048 CCAGCTACTCAGGGAGGCTAAGG - Intronic
964418164 3:156471930-156471952 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
966202172 3:177368671-177368693 CCAGCTACTCAGAGAGGCCAAGG - Intergenic
966984722 3:185168707-185168729 CTGGAGGCACAGAGAGGTTAAGG + Intergenic
968413965 4:412855-412877 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
969581283 4:8067068-8067090 GTCGAGGCTCAGAGAGGCGAGGG + Intronic
970232353 4:13923757-13923779 ATTGAAGCTTAGAGAGGCTAAGG + Intergenic
971176868 4:24290443-24290465 ATGGAGGCTCAGAGAGGCTAAGG - Intergenic
972684080 4:41334971-41334993 CTAGAAGCTGAAAGAGGTTAGGG + Intergenic
973817878 4:54634789-54634811 CAAGATGAGGAGAGAGGCTAGGG - Intergenic
976137625 4:81955904-81955926 CCTGAGGCTCAGAGGGGCTAAGG - Intronic
976216616 4:82721043-82721065 CCAGCTACTCAGAGAGGCTGAGG + Intronic
976931612 4:90573130-90573152 CCAGATGCTCAGGGAAGCTGTGG + Intronic
977353968 4:95922360-95922382 CAAGATGCTTGGAGAGGCTGTGG + Intergenic
978564086 4:110063652-110063674 CTAGAGCCTCAAAGAGGCTGAGG + Intronic
978830869 4:113083292-113083314 CCAGCTACTCAGGGAGGCTAAGG - Intronic
979478615 4:121187676-121187698 TCAGATGTTCAGAGAGGCTTGGG + Intronic
979603376 4:122610019-122610041 CTATATGCTCCCAGAGACTAAGG + Intergenic
980942649 4:139289015-139289037 CCAGCTACTCGGAGAGGCTAAGG + Intronic
981696750 4:147566596-147566618 CTAGCAACTCAGTGAGGCTAAGG - Intergenic
982224059 4:153149628-153149650 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
984969405 4:185173712-185173734 CTAGATGCCCTTAGAGGATAGGG + Intronic
987003576 5:13686607-13686629 AAAGATGCTCAGAGAAGCCAAGG + Intergenic
987012211 5:13779036-13779058 GCTGAAGCTCAGAGAGGCTATGG - Intronic
987765778 5:22227309-22227331 CTAGATACTCAGAGATCCCAAGG + Intronic
987906697 5:24087771-24087793 ACAGAGGCCCAGAGAGGCTAAGG + Intronic
989546480 5:42680617-42680639 CCAGCTACTCAGAGAGGCTGAGG - Intronic
990367089 5:55082107-55082129 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
990705448 5:58523848-58523870 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
990799190 5:59580580-59580602 CCAGTTACTCAGGGAGGCTAAGG - Intronic
992872643 5:81022337-81022359 GGAGATGCTCAGGGAGGCTCTGG + Intronic
993017910 5:82557029-82557051 CTAGCTACTCAGGGGGGCTAAGG - Intergenic
994140276 5:96333836-96333858 AATGAAGCTCAGAGAGGCTAAGG - Intergenic
994167714 5:96625509-96625531 CTGGAAGCACAGAGAGGATAGGG - Intronic
994283421 5:97934456-97934478 ATAGAGGCACAGAGAAGCTATGG + Intergenic
995550698 5:113278223-113278245 ATAGAAGCTCAGACAGGTTAAGG - Intronic
997771534 5:136558953-136558975 CCAGCTACTCAGGGAGGCTAAGG + Intergenic
998625521 5:143841519-143841541 ACAGATGCTCAGAGAAGTTAAGG + Intergenic
999582345 5:153052787-153052809 CTAGCTACTCAAGGAGGCTAAGG + Intergenic
999627128 5:153532675-153532697 CCAGATGCCCACAGGGGCTAGGG - Intronic
1001911982 5:175528033-175528055 CCAGCTTCTCAGAGAGGCTGAGG - Exonic
1002860668 6:1076730-1076752 CTAGAAGCTCCCAGAGGCCAGGG - Intergenic
1006180574 6:32151372-32151394 CGAGATTCTCACAGAGGCTGGGG - Intronic
1006353672 6:33540732-33540754 CTAGAGGCTGAGGGAGGCTGAGG + Intergenic
1006378279 6:33683767-33683789 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1008162840 6:48099722-48099744 CTAGAAGCTCAGGGAGGCCAAGG - Intergenic
1008231378 6:48988233-48988255 CTAGCTACTCAGGGAGGCTGAGG - Intergenic
1011870988 6:91892288-91892310 CTAGATGCTGAGTGAGGGAATGG - Intergenic
1012552699 6:100478825-100478847 CCAGCTGCTTAGTGAGGCTAAGG - Intergenic
1012574335 6:100773553-100773575 CTAGTTGTTGAGAGAAGCTACGG - Intronic
1012756096 6:103232459-103232481 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1013104543 6:107015580-107015602 CTGGCTACTCAGGGAGGCTAAGG - Intergenic
1014812488 6:125902357-125902379 TTGGAAGCTCAGAGAGGTTAAGG + Intronic
1016885271 6:148953654-148953676 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1017254967 6:152323321-152323343 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1018224893 6:161619272-161619294 CTCGATGCCCAGAGTAGCTAAGG + Intronic
1018411246 6:163550829-163550851 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1018417965 6:163617698-163617720 CTAGAAGCTGGGAGAGGCAAGGG + Intergenic
1019245033 6:170703215-170703237 CCAGATGCTCACAGAAGGTAGGG + Intergenic
1019608661 7:1923755-1923777 CTGGGTGCTCAGAGTGGCTCTGG + Intronic
1022547074 7:31199845-31199867 CCAGGTGAGCAGAGAGGCTAAGG - Intergenic
1023266180 7:38408634-38408656 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1023349612 7:39307837-39307859 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1025240009 7:57263583-57263605 CTAGATACTCTGGGAGGCTGAGG + Intergenic
1025240038 7:57263776-57263798 CTAGATACTCTGGGAGGCTGAGG + Intergenic
1025949517 7:66132793-66132815 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1026273766 7:68859267-68859289 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1026640053 7:72116463-72116485 TTAGAGGCTGAGAGAGGCTGAGG + Intronic
1027123797 7:75541413-75541435 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1027535983 7:79402505-79402527 ATAGAAGCTCAGAGAGGGTAAGG + Intronic
1029615098 7:101651282-101651304 CCAGAGGCTCAGAGAGGGCATGG + Intergenic
1030221467 7:107103524-107103546 CTAGAAGCTCAGATAGCCTGAGG + Intronic
1030694049 7:112565140-112565162 TCTGAAGCTCAGAGAGGCTAAGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033295242 7:140127073-140127095 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1033505559 7:141996183-141996205 CCAGCTACTCGGAGAGGCTAAGG + Intronic
1033926872 7:146472990-146473012 GTAGATGTTTAGAGAGGCTAGGG + Intronic
1034051544 7:147989335-147989357 GTAGAAGCCCAGAGAGGTTAAGG - Intronic
1034073240 7:148207971-148207993 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1035085830 7:156256985-156257007 CCAGCTACTCAGGGAGGCTAAGG + Intergenic
1035739763 8:1917888-1917910 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1036787890 8:11700043-11700065 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1038424951 8:27458917-27458939 CTTGATGCACAGAGAAGCTGGGG + Exonic
1039624716 8:39037170-39037192 CCAGCTACTCAGAGAGGCTGAGG - Intronic
1042066205 8:64879993-64880015 CCAGCTGCTCGGAGAGGCTGAGG + Intergenic
1042070081 8:64923499-64923521 CCAGCTGCTCAGAGAGGCTGAGG - Intergenic
1043242825 8:77957438-77957460 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1043448912 8:80347043-80347065 AAAGAGGCTCAGAGAGGTTAAGG - Intergenic
1043855524 8:85260947-85260969 CTACATACTCAGAGAGGCTTAGG + Intronic
1044702348 8:94976081-94976103 CCAGCTACTCAGAGAGGCTGAGG + Intronic
1044984207 8:97743652-97743674 CTAGCTGCTCAGAGGGCCTGGGG + Intergenic
1044998892 8:97863053-97863075 CCAGTTACTCAGAGAGGCTGAGG - Intergenic
1045172219 8:99684397-99684419 CTTAATGCTCAGAGGGACTAGGG - Intronic
1045331479 8:101159233-101159255 TTAAATGGTCAGAGAGGCCAAGG + Intergenic
1045507422 8:102788630-102788652 ATCGAAGCTCAGAGAGGTTATGG - Intergenic
1045835011 8:106509884-106509906 CCAGCTACTCAGGGAGGCTAAGG - Intronic
1045865478 8:106860564-106860586 CCAGATACTCAGGGAGGCTGAGG + Intergenic
1046675465 8:117103343-117103365 CTTGATGCTCAGAGAGCCTGAGG + Intronic
1047268201 8:123328914-123328936 CCAGCTGCTCGGAGAGGCTGAGG - Intronic
1047867047 8:129036161-129036183 TCAGATGCTCAGAGAAGATAAGG - Intergenic
1049246948 8:141567880-141567902 CTTGAAGCTGAGAGAGGCTAAGG - Intergenic
1051170046 9:14313120-14313142 CGAGCTGCTGAGAGGGGCTACGG + Intronic
1051637124 9:19190800-19190822 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1052955726 9:34251861-34251883 CTAGTTGCTGAGAGGGGCTGGGG + Exonic
1053022008 9:34701534-34701556 CGAGCTCCTCAGAGAGGCTGCGG + Intergenic
1053384686 9:37677555-37677577 GTACAGGCTCAGGGAGGCTAAGG + Intronic
1055007387 9:71524261-71524283 CCAGGTGCTCCGAGAAGCTAAGG - Intergenic
1057506869 9:95641811-95641833 ACTGATGCCCAGAGAGGCTAAGG + Intergenic
1057851007 9:98566729-98566751 CCAGCTGCTCAGGGAGGCTGAGG + Intronic
1057859834 9:98632241-98632263 CTGGAGGCTTAGAGAGGTTAAGG - Intronic
1057954904 9:99399777-99399799 ATTGAAGCTCAGAGAGGCTGGGG + Intergenic
1058091270 9:100808449-100808471 CTAGCTACTCAGGGAGGCTGAGG + Intergenic
1058389757 9:104481974-104481996 CCATATGGTCAGAGAGCCTAAGG - Intergenic
1060029936 9:120205589-120205611 CCAGAGGCCCAGAGAAGCTATGG + Intergenic
1060084659 9:120686203-120686225 CCAGCTGCTCAGAGAGGCTGAGG - Intronic
1060541474 9:124433401-124433423 CCAGAAGCTGAGAGAGGCAAGGG + Intergenic
1060800082 9:126538425-126538447 AGAGATGCTCAGAGAGGACAGGG + Intergenic
1061242885 9:129384433-129384455 ATGGATGCTCAGAGAGGTTAAGG - Intergenic
1061680500 9:132240617-132240639 CTAGTTGCCCAGAGAGGGGAAGG + Intronic
1061755418 9:132808998-132809020 CTGCAAGCTCAGAGATGCTAGGG + Intronic
1062470551 9:136701735-136701757 CTGGATCCTTAGAGAGGCCAGGG - Intergenic
1062572012 9:137190104-137190126 CTTCATGCTCACACAGGCTATGG + Exonic
1188765195 X:34081843-34081865 CCAGCTACTCTGAGAGGCTAAGG + Intergenic
1188772548 X:34171442-34171464 AAAGATCCTCAGAGATGCTATGG - Intergenic
1189377353 X:40475999-40476021 CTCCCTGCTCAGAGAGGCCAGGG - Intergenic
1189442450 X:41049404-41049426 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1192257436 X:69474257-69474279 CTAGCTACTCAGGGAGGCTTAGG - Intergenic
1192953548 X:76044023-76044045 CCAGATGCTCAGAAAGGGGAAGG + Intergenic
1194392372 X:93335940-93335962 CTAGATGGTCAGAGTGAGTAGGG - Intergenic
1194439850 X:93918741-93918763 CCAGCTACTCAGAGAGGCTGAGG + Intergenic
1194546280 X:95239093-95239115 CCTAGTGCTCAGAGAGGCTACGG - Intergenic
1195408586 X:104544301-104544323 ATAGAATCTCAGAGAGGCAAGGG - Intergenic
1195548460 X:106139209-106139231 CAGGATGCTCAGAGGGGCAAGGG - Intergenic
1196052700 X:111322233-111322255 ATAGGGGCTCAGAGAGGGTATGG + Intronic
1196671302 X:118370697-118370719 CCAGCTACTCAGGGAGGCTAAGG - Intronic
1197104504 X:122698325-122698347 CCAGCTACTCAGAGAGGCTGAGG - Intergenic
1199653633 X:149972897-149972919 CTGGAGGCTAAGAGAGGCTCAGG - Intergenic
1199830548 X:151545380-151545402 CCAGCTGCTCAGGGAGGCTGAGG - Intergenic
1200237183 X:154473295-154473317 CCAGGTGCTCAGAGAGAATAGGG - Exonic
1200358474 X:155577462-155577484 CCAGATACTCAGGGAGGCTGAGG + Intronic