ID: 1140478323

View in Genome Browser
Species Human (GRCh38)
Location 16:75249968-75249990
Sequence CCATCCGTATAATGGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140478314_1140478323 -3 Left 1140478314 16:75249948-75249970 CCTCAGTGTCCCCATCTGCACCA 0: 1
1: 5
2: 54
3: 379
4: 2168
Right 1140478323 16:75249968-75249990 CCATCCGTATAATGGGAAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1140478313_1140478323 30 Left 1140478313 16:75249915-75249937 CCAATTCTGAGGACAACTGACTG 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1140478323 16:75249968-75249990 CCATCCGTATAATGGGAAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140478323 Original CRISPR CCATCCGTATAATGGGAAAG GGG Intronic
901146238 1:7066554-7066576 CCATCCAGAACATGGGAAAGAGG - Intronic
903203972 1:21766595-21766617 TCATCCTTTGAATGGGAAAGGGG + Intronic
905135571 1:35796591-35796613 CCATCCATATAAAAGGAGAGAGG + Intergenic
910674624 1:89804126-89804148 TCATCTGCAAAATGGGAAAGAGG - Intronic
911160643 1:94679724-94679746 TCATCTGTAAAATGGGACAGTGG + Intergenic
915002389 1:152605158-152605180 CCATCTGTAAAATGGGACAAGGG - Intergenic
916316734 1:163456994-163457016 CTTCCCATATAATGGGAAAGAGG - Intergenic
922888086 1:229036006-229036028 CCACCTGTGAAATGGGAAAGTGG + Intergenic
923539664 1:234878844-234878866 TCATCCGTAAAATGGAAAAAGGG - Intergenic
924512043 1:244735711-244735733 CCATCCTCATAATGTGAATGTGG - Intergenic
1065294433 10:24261091-24261113 ACATATGTATAATGGCAAAGAGG - Intronic
1069821080 10:71229204-71229226 CAATCCTTAAAATGGGAAAGGGG - Intronic
1071794757 10:88992022-88992044 CCATCTGTAAAATGGGGATGTGG - Intronic
1079143323 11:17828886-17828908 CCATCCGTAAAATGGGAACAAGG + Intronic
1079498758 11:21077056-21077078 CCATACTTAAAATGGGAAGGTGG - Intronic
1080176240 11:29366258-29366280 CAATCTGTACAATGGTAAAGAGG + Intergenic
1081602919 11:44507717-44507739 CCTTCTGGATAATTGGAAAGCGG - Intergenic
1082190281 11:49234713-49234735 CCATGCTAATATTGGGAAAGAGG - Intergenic
1086590896 11:88512285-88512307 CCATCTGAATAACGTGAAAGTGG + Intronic
1089868730 11:121654179-121654201 CCAGCTGTAAAATGGGAAGGAGG + Intergenic
1091643626 12:2256400-2256422 CCATCAGAATAAGGGGAAAAAGG - Intronic
1093291820 12:17334800-17334822 CTGCCCTTATAATGGGAAAGGGG + Intergenic
1100443979 12:94643938-94643960 CCATCTGTAAAATGGAAAAGTGG + Intronic
1102092618 12:110204759-110204781 CCATCAGTAGAATGTGATAGAGG - Intronic
1104440098 12:128787175-128787197 CCATCAGGGAAATGGGAAAGAGG - Intergenic
1104646747 12:130502905-130502927 CCATCCCTACCAAGGGAAAGGGG - Intronic
1106541750 13:30696774-30696796 TCATCTGTAGAATGAGAAAGTGG - Intergenic
1109449730 13:62495272-62495294 CCATCAGTATTATAGGAAATGGG + Intergenic
1111889698 13:94066799-94066821 CCTACCTTATAAAGGGAAAGTGG - Intronic
1111985888 13:95066745-95066767 CCATCGGCAGAATGGGCAAGAGG - Intronic
1113884201 13:113649400-113649422 CGACCCGTATGAAGGGAAAGTGG - Exonic
1114258685 14:21022799-21022821 CCATCCTTCTACTGGGGAAGAGG + Intronic
1120764832 14:88319416-88319438 CCAGCAGTATTAGGGGAAAGTGG - Intronic
1121743465 14:96269625-96269647 CCATCTGTAAAATGGGAATGAGG + Intergenic
1122243903 14:100387617-100387639 TCATCTGTAAAATGGGAATGAGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1128024427 15:64422960-64422982 CCATTCTTATAATGGAAAATGGG - Intronic
1133257445 16:4525851-4525873 CCATCAGGACAATGGGAAATGGG - Intronic
1135349794 16:21719029-21719051 CCATCTGTAAAATGGGATTGTGG + Intronic
1139299352 16:65931900-65931922 CCATCTGTGAAATGGGGAAGTGG - Intergenic
1140478323 16:75249968-75249990 CCATCCGTATAATGGGAAAGGGG + Intronic
1142233714 16:88911599-88911621 TCATCTGTAAAATGGGAATGGGG + Intronic
1146912370 17:36657061-36657083 CCCTCCGCAGACTGGGAAAGGGG - Intergenic
1152219365 17:79053557-79053579 CCATCTGCATAATGAGAAATGGG - Intergenic
1160952987 19:1676453-1676475 CCATCTGTATAATGGGACCAGGG - Intergenic
1163536945 19:17882274-17882296 GCCTCAGTTTAATGGGAAAGAGG - Intronic
1166822029 19:45586465-45586487 CGATCTGTAAAATGGGAAGGGGG - Intronic
1167438284 19:49492767-49492789 ACATCAGTAAAATGGGAACGGGG - Intergenic
925383161 2:3442450-3442472 CCATCCGCATAATGACACAGGGG - Intronic
926535891 2:14111626-14111648 TCATCCTTATTATGGGAAACAGG + Intergenic
929544144 2:42844730-42844752 CCATCAGAATCATAGGAAAGTGG - Intergenic
929786169 2:44994021-44994043 CCATGATAATAATGGGAAAGAGG - Intergenic
932826341 2:74944433-74944455 CCATTCATAAAATTGGAAAGTGG - Intergenic
941703327 2:168629468-168629490 CCATCTCTATAATGGGAGACTGG - Intronic
944085397 2:195841274-195841296 ACATCCATATATGGGGAAAGAGG - Intronic
947789176 2:232853207-232853229 CCATGCATAAAATGGGAAAATGG + Intronic
948034606 2:234847862-234847884 CCAGCTGTACAATGGGAAGGTGG - Intergenic
948877084 2:240835318-240835340 CCATCCGTAAAATGGGGAGGAGG - Intergenic
1169409560 20:5356066-5356088 CCATCTGTACAATGGGCAGGTGG - Intergenic
1172049844 20:32109166-32109188 CCATCTGTGAAATGGGAAGGGGG - Intergenic
1175142360 20:56870467-56870489 TCATCTGTAAAATGGGGAAGTGG - Intergenic
1177530672 21:22354469-22354491 CCATCAGAAGAATGGAAAAGGGG - Intergenic
1177938136 21:27375463-27375485 GGATTCGTATAATGGGTAAGTGG + Intergenic
1179560920 21:42215651-42215673 CCATCCCGAGAAGGGGAAAGTGG + Intronic
1181956090 22:26589191-26589213 CCATCTGTAAAAGGGGAAGGGGG + Intronic
1183395268 22:37567876-37567898 CCATCTGCATAATGGAAATGAGG + Intronic
1183546407 22:38456405-38456427 CCATCTGTAAAATGGGGCAGTGG - Intergenic
961814994 3:129544814-129544836 CCATCCGTACAGTGGGGACGGGG - Intronic
967375233 3:188793480-188793502 CTATCAGTATAATGAGAAAGTGG - Intronic
970845799 4:20535849-20535871 ACATACGTATATTTGGAAAGAGG - Intronic
977980821 4:103319541-103319563 CCATTCATATAATGGGGATGGGG - Intergenic
981562266 4:146060756-146060778 CCATCTGTATAGTGTGCAAGGGG + Intergenic
985222979 4:187727740-187727762 CAATCTGGATGATGGGAAAGAGG + Intergenic
990276535 5:54202956-54202978 CTATCCTTATAATGGAAAAATGG - Intronic
991365149 5:65860314-65860336 CCATCCGTATGAGTAGAAAGTGG - Intronic
991455549 5:66799663-66799685 CCCTCTGGACAATGGGAAAGGGG - Intronic
992599286 5:78381662-78381684 TCAACAGTAAAATGGGAAAGAGG - Intronic
995437413 5:112152517-112152539 GCATCCCTACAATGTGAAAGGGG - Intronic
997351157 5:133232423-133232445 CAAACTGTATAATGGGAAGGAGG + Intronic
1000925416 5:167187804-167187826 CCCTCTTTATAATGGGAAGGAGG - Intergenic
1001434968 5:171693155-171693177 TCATCTGTAAAATGGGAATGAGG + Intergenic
1005164485 6:22903673-22903695 CCATCCTTTTAAATGGAAAGAGG + Intergenic
1007481200 6:42151237-42151259 CCATCTGTAAAATGGGATGGTGG + Intergenic
1008446902 6:51602955-51602977 TCATTCATACAATGGGAAAGGGG + Intergenic
1019338874 7:498817-498839 CCATCTGTACAATGGGAGAATGG - Intronic
1032514400 7:132496013-132496035 CCATCCCCACACTGGGAAAGAGG - Intronic
1040609642 8:48970560-48970582 CCTGCTGTATATTGGGAAAGTGG - Intergenic
1044296892 8:90538176-90538198 GCATGCTTATAATGGGAAATTGG - Intergenic
1050405689 9:5306446-5306468 CTTTCTGTAAAATGGGAAAGCGG - Intergenic
1053431115 9:38042471-38042493 CCAACCCTAAAATGGGAAGGGGG + Intronic
1054892785 9:70270325-70270347 ACATCCATATGCTGGGAAAGTGG - Intronic
1055991780 9:82114141-82114163 CTATCAGTATAATGGAAAAAAGG - Intergenic
1061071715 9:128314877-128314899 TCATCTGTAAAATGGGAATGAGG - Intronic
1061729227 9:132600582-132600604 CCATGCACATGATGGGAAAGAGG + Intronic
1061780434 9:132992946-132992968 CCATCTGTAAAATGGGAGAATGG - Intergenic
1061806713 9:133141039-133141061 CCATCTGTCAAATGGGCAAGGGG - Intronic
1189388808 X:40558756-40558778 CCATCCATATAATGGGAAGATGG - Intergenic
1189537668 X:41953372-41953394 TCATCTGTAAAATGGGATAGTGG + Intergenic
1196818320 X:119682950-119682972 CCATCCAAATACTAGGAAAGCGG + Intronic
1201594050 Y:15647522-15647544 CCATCAGTGAAATGGGAAACTGG - Intergenic
1201796651 Y:17903593-17903615 CCTTCAGGATAATGGGAAACAGG + Intergenic
1201804904 Y:18002392-18002414 CCTTCAGGATAATGGGAAACAGG - Intergenic