ID: 1140480302

View in Genome Browser
Species Human (GRCh38)
Location 16:75258859-75258881
Sequence TGCTGCGCCTGCCCCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 313}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140480302_1140480308 6 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480308 16:75258888-75258910 GTCTGCCTGGAGGGGTGCCTTGG 0: 1
1: 0
2: 0
3: 20
4: 254
1140480302_1140480312 19 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480312 16:75258901-75258923 GGTGCCTTGGCAGATGGCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 222
1140480302_1140480304 -7 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480304 16:75258875-75258897 CGCAGCAAGGAGTGTCTGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 118
1140480302_1140480314 30 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480314 16:75258912-75258934 AGATGGCCAGGGAAAAAAAGAGG 0: 1
1: 0
2: 5
3: 53
4: 492
1140480302_1140480306 -3 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480306 16:75258879-75258901 GCAAGGAGTGTCTGCCTGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 173
1140480302_1140480305 -4 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480305 16:75258878-75258900 AGCAAGGAGTGTCTGCCTGGAGG 0: 1
1: 0
2: 4
3: 27
4: 186
1140480302_1140480307 -2 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480307 16:75258880-75258902 CAAGGAGTGTCTGCCTGGAGGGG 0: 1
1: 0
2: 4
3: 21
4: 180
1140480302_1140480311 18 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480311 16:75258900-75258922 GGGTGCCTTGGCAGATGGCCAGG 0: 1
1: 0
2: 3
3: 21
4: 226
1140480302_1140480310 13 Left 1140480302 16:75258859-75258881 CCAGCGCTGGGGCAGGCGCAGCA 0: 1
1: 0
2: 3
3: 36
4: 313
Right 1140480310 16:75258895-75258917 TGGAGGGGTGCCTTGGCAGATGG 0: 1
1: 0
2: 1
3: 26
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140480302 Original CRISPR TGCTGCGCCTGCCCCAGCGC TGG (reversed) Intronic