ID: 1140484127

View in Genome Browser
Species Human (GRCh38)
Location 16:75280653-75280675
Sequence GGTTGATTAAATTATCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140484127_1140484138 6 Left 1140484127 16:75280653-75280675 CCCCAGGGATAATTTAATCAACC No data
Right 1140484138 16:75280682-75280704 TTTTATAGACAGGCCAGGGGAGG No data
1140484127_1140484137 3 Left 1140484127 16:75280653-75280675 CCCCAGGGATAATTTAATCAACC No data
Right 1140484137 16:75280679-75280701 TCATTTTATAGACAGGCCAGGGG No data
1140484127_1140484136 2 Left 1140484127 16:75280653-75280675 CCCCAGGGATAATTTAATCAACC No data
Right 1140484136 16:75280678-75280700 CTCATTTTATAGACAGGCCAGGG No data
1140484127_1140484130 -4 Left 1140484127 16:75280653-75280675 CCCCAGGGATAATTTAATCAACC No data
Right 1140484130 16:75280672-75280694 AACCCCCTCATTTTATAGACAGG No data
1140484127_1140484139 12 Left 1140484127 16:75280653-75280675 CCCCAGGGATAATTTAATCAACC No data
Right 1140484139 16:75280688-75280710 AGACAGGCCAGGGGAGGCAGAGG No data
1140484127_1140484140 13 Left 1140484127 16:75280653-75280675 CCCCAGGGATAATTTAATCAACC No data
Right 1140484140 16:75280689-75280711 GACAGGCCAGGGGAGGCAGAGGG No data
1140484127_1140484135 1 Left 1140484127 16:75280653-75280675 CCCCAGGGATAATTTAATCAACC No data
Right 1140484135 16:75280677-75280699 CCTCATTTTATAGACAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140484127 Original CRISPR GGTTGATTAAATTATCCCTG GGG (reversed) Intergenic
No off target data available for this crispr