ID: 1140484136

View in Genome Browser
Species Human (GRCh38)
Location 16:75280678-75280700
Sequence CTCATTTTATAGACAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140484129_1140484136 0 Left 1140484129 16:75280655-75280677 CCAGGGATAATTTAATCAACCCC No data
Right 1140484136 16:75280678-75280700 CTCATTTTATAGACAGGCCAGGG No data
1140484128_1140484136 1 Left 1140484128 16:75280654-75280676 CCCAGGGATAATTTAATCAACCC No data
Right 1140484136 16:75280678-75280700 CTCATTTTATAGACAGGCCAGGG No data
1140484127_1140484136 2 Left 1140484127 16:75280653-75280675 CCCCAGGGATAATTTAATCAACC No data
Right 1140484136 16:75280678-75280700 CTCATTTTATAGACAGGCCAGGG No data
1140484126_1140484136 14 Left 1140484126 16:75280641-75280663 CCTAGTGTTAAGCCCCAGGGATA No data
Right 1140484136 16:75280678-75280700 CTCATTTTATAGACAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140484136 Original CRISPR CTCATTTTATAGACAGGCCA GGG Intergenic
No off target data available for this crispr