ID: 1140485510

View in Genome Browser
Species Human (GRCh38)
Location 16:75290156-75290178
Sequence CAAGCAGGTGGGTGTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140485510_1140485523 11 Left 1140485510 16:75290156-75290178 CCCCATGGACACCCACCTGCTTG No data
Right 1140485523 16:75290190-75290212 GGGTCACTGGCTGGTGCCAAAGG No data
1140485510_1140485519 -2 Left 1140485510 16:75290156-75290178 CCCCATGGACACCCACCTGCTTG No data
Right 1140485519 16:75290177-75290199 TGGTCCTCTGCCTGGGTCACTGG No data
1140485510_1140485516 -10 Left 1140485510 16:75290156-75290178 CCCCATGGACACCCACCTGCTTG No data
Right 1140485516 16:75290169-75290191 CACCTGCTTGGTCCTCTGCCTGG No data
1140485510_1140485517 -9 Left 1140485510 16:75290156-75290178 CCCCATGGACACCCACCTGCTTG No data
Right 1140485517 16:75290170-75290192 ACCTGCTTGGTCCTCTGCCTGGG No data
1140485510_1140485521 2 Left 1140485510 16:75290156-75290178 CCCCATGGACACCCACCTGCTTG No data
Right 1140485521 16:75290181-75290203 CCTCTGCCTGGGTCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140485510 Original CRISPR CAAGCAGGTGGGTGTCCATG GGG (reversed) Intergenic