ID: 1140497493

View in Genome Browser
Species Human (GRCh38)
Location 16:75402025-75402047
Sequence CTATATTCACTAGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140497493 Original CRISPR CTATATTCACTAGGAAACAC TGG Intronic
906300320 1:44676817-44676839 CAATATCCAGCAGGAAACACAGG + Intronic
908641767 1:66231772-66231794 CTCTATTCACTTCAAAACACTGG + Intronic
909127426 1:71691649-71691671 CTTTTTTCATTATGAAACACTGG + Intronic
909363501 1:74792982-74793004 CTATATTTCCTTGAAAACACTGG + Intergenic
912581002 1:110720838-110720860 CTGTATCCAGTTGGAAACACAGG - Intergenic
914007606 1:143746280-143746302 CTATAATGACAAGGAAACATGGG + Intergenic
915971673 1:160359501-160359523 CTTTATTCACTCTGAGACACTGG + Intergenic
918542392 1:185646541-185646563 CTGTTTTCACTAGGGAGCACAGG + Intergenic
919236304 1:194847661-194847683 CTATATTCATTAGGTACTACAGG - Intergenic
919497386 1:198290610-198290632 CATAATTCACTAGGGAACACAGG - Intronic
923303606 1:232667134-232667156 CTATAGTCACCATGGAACACAGG + Intergenic
924521042 1:244806426-244806448 CTATATCCACTAGGAGAGGCCGG + Intergenic
1063858558 10:10283041-10283063 CCATATTCACTATGAAATACGGG - Intergenic
1065093260 10:22255041-22255063 ATATATTGACTATCAAACACTGG - Intergenic
1065978638 10:30867747-30867769 TTATATTCTCAAGGAAACAAAGG - Intronic
1066469706 10:35686842-35686864 TGTTATTCACTAGGAAACAAGGG - Intergenic
1069252854 10:66293298-66293320 CTACAGTTAGTAGGAAACACAGG - Intronic
1071192572 10:83119246-83119268 CCATATTGGCTAGGAAAGACTGG + Intergenic
1071754577 10:88522557-88522579 ATATTTTCAATAAGAAACACAGG + Intronic
1072900337 10:99401474-99401496 CTAGAGTCACTGGGACACACAGG + Intronic
1075602008 10:123776686-123776708 CAATATTCGCTGAGAAACACAGG + Intronic
1085994044 11:81889146-81889168 CTCTTTTAACTAGGAAACAAAGG - Intergenic
1086918695 11:92561166-92561188 CTATATTCACTAGGGTACTGTGG - Intronic
1087084544 11:94203216-94203238 CTCTATCCACTAGGACACTCTGG - Intergenic
1088323622 11:108579603-108579625 CTATATTTCCTAGGAGAGACAGG - Intronic
1093390805 12:18618257-18618279 CTATAGTCTCTGGCAAACACAGG - Intronic
1094824115 12:34254935-34254957 CTTTATACATTTGGAAACACTGG + Intergenic
1095087057 12:38068277-38068299 CTTTATACATTTGGAAACACCGG - Intergenic
1102940011 12:116932213-116932235 CTGTATTCTCTAGGAGACACTGG + Intronic
1105861846 13:24422375-24422397 GAATATTTACTAGGAAACATTGG - Intronic
1105918046 13:24935531-24935553 GAATATTTACTAGGAAACATTGG + Intergenic
1106477665 13:30112258-30112280 TTATATTCACTGGGAAAAGCTGG - Intergenic
1107579548 13:41767942-41767964 AAATATTCACTAAGAAACAATGG + Intronic
1109035728 13:57257677-57257699 ATATATTCCCTAAGAGACACTGG + Intergenic
1109395827 13:61757200-61757222 ATATATTCTCAAGAAAACACTGG - Intergenic
1109397333 13:61777366-61777388 CAATAATCACTATGAAATACTGG + Intergenic
1109446182 13:62443995-62444017 CTATATCCAGATGGAAACACAGG - Intergenic
1111310551 13:86479150-86479172 ATATATTAACTAGAGAACACTGG + Intergenic
1112672606 13:101658037-101658059 CTCTCTTCACTAGGAAAGAATGG + Intronic
1114238594 14:20844978-20845000 CCATAGTCACTTGGGAACACAGG + Intergenic
1116818809 14:49607970-49607992 CTAAATTCACTAGGCAAAAATGG - Exonic
1119073649 14:71613760-71613782 ATATCTTCACTAGCAAACAATGG + Intronic
1121036028 14:90704365-90704387 CTTTATACATGAGGAAACACAGG + Intronic
1123901379 15:24880568-24880590 CTATATTCAGTAGGAGAGACAGG + Intronic
1125143301 15:36435683-36435705 TTATATTCACTATGAAGCAGTGG + Intergenic
1126322508 15:47440419-47440441 CTATAGTCAGTAAGAAATACTGG + Intronic
1127597073 15:60495962-60495984 TTATCTTCACTAGGAAACTGTGG - Intronic
1129625698 15:77196492-77196514 CTAAATTTACTGAGAAACACTGG + Intronic
1130400733 15:83550754-83550776 CTATATATATTTGGAAACACAGG - Intronic
1132094181 15:98969802-98969824 CCATATTAATTAGGAGACACTGG - Intronic
1138789120 16:59881499-59881521 CTGGATTCATTAGGAAGCACAGG + Intergenic
1140497493 16:75402025-75402047 CTATATTCACTAGGAAACACTGG + Intronic
1144186608 17:12802486-12802508 CGATCTTCACTTGGAAACAGGGG + Intronic
1144617946 17:16794037-16794059 CTATATTTTCTGGGGAACACAGG - Intronic
1144802125 17:17936712-17936734 CTATATTAAGTGGGAAAAACAGG + Intronic
1147789243 17:43003007-43003029 CATTATTGAATAGGAAACACTGG + Intergenic
1149113147 17:53059095-53059117 CTATGTTCATTAGGGACCACTGG - Intergenic
1157937687 18:51891289-51891311 CTATATACATTAAGAAACCCAGG - Intergenic
1159614003 18:70558976-70558998 CTTTGTTCATTAGGACACACTGG - Intergenic
927822084 2:26275976-26275998 CAATATTTACTATGAAATACTGG - Intronic
928024101 2:27725765-27725787 GTATGTGCACAAGGAAACACAGG + Intergenic
929985563 2:46728296-46728318 CTATATTCAGTAGGAGAGACAGG + Intronic
932225297 2:70034883-70034905 GAATACTCACCAGGAAACACAGG + Intergenic
936282200 2:111152019-111152041 CTCTATTGACTAGGAAGAACTGG + Intronic
937763813 2:125635870-125635892 GTATATATACTAGCAAACACTGG - Intergenic
939489318 2:142857731-142857753 CTATTTTCACAACTAAACACTGG + Intergenic
941766441 2:169302327-169302349 GTATTTTCATTAGGAGACACAGG - Intronic
941836917 2:170032658-170032680 ATCTAATCACTAGGAAATACTGG - Intronic
942440641 2:176032009-176032031 CTTTATTCATGAGAAAACACTGG - Intergenic
944319500 2:198321755-198321777 CTTTATTTGCTGGGAAACACTGG + Intronic
945942870 2:215967117-215967139 CTATAATAACGAGGAAAGACTGG - Intronic
946895880 2:224323012-224323034 CTAGAATCCCTAGGAAACATTGG - Intergenic
947304258 2:228725949-228725971 CTTTACTCACTGGGAAATACGGG + Intergenic
947906536 2:233767763-233767785 CTATACTAACTAGAAAACAGGGG - Intronic
950986071 3:17368378-17368400 ATATATTCTCTTGGAAAAACTGG + Intronic
955011832 3:55025030-55025052 CTATCTTCACTAAGAGATACTGG - Intronic
955452717 3:59087251-59087273 CCATATTCAATAGAAAAGACTGG - Intergenic
957656445 3:83083731-83083753 CTATTCTCACTAGCAAAAACTGG - Intergenic
959611600 3:108301142-108301164 CTAAATTCAATAGGGAACATTGG - Intronic
963092873 3:141502374-141502396 CTTTATTCAGTAGGCAACAAGGG - Intronic
966547201 3:181163127-181163149 CTATATTAACTAAGAAAAAAGGG - Intergenic
972708286 4:41567590-41567612 CTTTATTCCCTAGGAAAACCTGG + Intronic
975931926 4:79534832-79534854 CTATATCCACTAGGAAGAAGGGG + Intergenic
978634756 4:110790879-110790901 CTATATTTATCTGGAAACACTGG - Intergenic
979137330 4:117126172-117126194 CTATTGTCACTCTGAAACACTGG + Intergenic
979986114 4:127317816-127317838 CCATATCCACAAGGAAACATAGG - Intergenic
980182081 4:129413921-129413943 ATATATTCTCTAAGAAACAAAGG - Intergenic
981044163 4:140251262-140251284 CAATATTCACTTGGTCACACAGG + Intergenic
981505174 4:145491810-145491832 CAATATGCTCTAGGAAGCACTGG - Intronic
982488579 4:155999684-155999706 GTATATTCAATGGGAAAGACAGG + Intergenic
984562295 4:181284758-181284780 CTATATTCAACAGAATACACTGG + Intergenic
984636762 4:182119307-182119329 CTATATACACCAGGAAGAACTGG + Intergenic
985423260 4:189804978-189805000 CTTTATCCACTAGGACACAGAGG + Intergenic
988090242 5:26529939-26529961 CAATATTCCATAGGATACACAGG + Intergenic
989266752 5:39483586-39483608 ATAGCTTCACTAGGAAAGACTGG + Intergenic
991221157 5:64219846-64219868 GTAGTTTCACTATGAAACACTGG - Intronic
992073597 5:73171310-73171332 CTATATCCACTAAGAATAACTGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993538173 5:89113987-89114009 CTATATAAAATAGGAAACATTGG + Intergenic
993899514 5:93574883-93574905 TCCTATTCACTAGGAAACCCGGG + Intergenic
995067844 5:107882456-107882478 GTATTTTCACTGGAAAACACTGG - Intronic
995123016 5:108555194-108555216 CTAAGTTCACTAGCAAACAGTGG - Intergenic
995184566 5:109258473-109258495 ATATGTTCAACAGGAAACACAGG - Intergenic
995803594 5:116026596-116026618 GTATATTCACTAGAAGACAGTGG + Exonic
998434230 5:142093803-142093825 ATATTTTCAGTAGAAAACACGGG + Intergenic
999390881 5:151188822-151188844 CTACATTCAGTAGGAAAAACTGG - Intronic
1001270032 5:170304076-170304098 CCATATTTATTAGGAAAGACAGG + Intergenic
1003721121 6:8703125-8703147 CTATTTTCATTTGGAAACAATGG + Intergenic
1007874491 6:45080487-45080509 CTATTGTGACTAGTAAACACGGG - Intronic
1010364157 6:75030558-75030580 CTATATTCACTGAGCAACCCTGG - Intergenic
1013391386 6:109689588-109689610 CTGAATTCACTAGGGAATACTGG - Intronic
1013871520 6:114767612-114767634 CTATATTCAAAAGGAAAAAAGGG - Intergenic
1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG + Intronic
1028432138 7:90759703-90759725 CTAGATTCAGTAGGAAAGAAAGG - Intronic
1028660694 7:93269433-93269455 GTATATTCTCTAGTAAAAACTGG - Intronic
1031058850 7:117026369-117026391 TTATATTGACTAGGAAAAAATGG - Intronic
1031752177 7:125589646-125589668 CTATTTTCAGTAGAGAACACTGG - Intergenic
1032503281 7:132416134-132416156 GAAAATTCACTAGGTAACACTGG + Intronic
1036214063 8:6864546-6864568 CTGTAATGGCTAGGAAACACCGG - Intergenic
1037121910 8:15298721-15298743 CTACATTCAGTAGGAGAAACAGG + Intergenic
1037532140 8:19787766-19787788 CTATATTCAAAAGGAAAGAATGG + Intergenic
1038869262 8:31476314-31476336 TTATTTTTACTAGAAAACACTGG - Intergenic
1042277037 8:67016346-67016368 CTAAATTTTCTTGGAAACACAGG - Intronic
1043405699 8:79930219-79930241 CTTAATTAACTAGGCAACACAGG + Intronic
1044176646 8:89133107-89133129 CAATATTCACTAGGCAATCCAGG + Intergenic
1044547656 8:93477393-93477415 CTATACTCTCTGGGAAACTCAGG + Intergenic
1049995660 9:1031644-1031666 CTGTAGACACGAGGAAACACAGG - Intergenic
1052633904 9:31075136-31075158 CTATTTTCAAAAGGAAACAAGGG + Intergenic
1056212615 9:84379174-84379196 CTATATTCACTAAGACAGCCTGG + Intergenic
1059835445 9:118146933-118146955 CAATATTCACTACAAAACAAAGG - Intergenic
1187386830 X:18856733-18856755 CTATAATCACTTAGAAATACTGG - Intergenic
1189102092 X:38201443-38201465 CTGCATTCAGTAGGAAAGACAGG - Intronic
1195555129 X:106212861-106212883 CTATATTTAGAAGGAAATACAGG + Intergenic
1195669119 X:107454262-107454284 CTTTATTGACAAGGACACACAGG + Intergenic
1197740557 X:129889709-129889731 CTATATTCACTAGTTAATTCTGG - Intergenic
1198884034 X:141314032-141314054 TTATATGCACTAAGAAGCACAGG + Intergenic