ID: 1140504816

View in Genome Browser
Species Human (GRCh38)
Location 16:75464586-75464608
Sequence GCGACGGGATGGAGCGCGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504816_1140504827 25 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504816_1140504823 -1 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504816_1140504826 19 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504816_1140504824 0 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504816_1140504828 29 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504816 Original CRISPR GCGACGGGATGGAGCGCGAG GGG (reversed) Exonic
900484908 1:2917902-2917924 GCGACAGGATGCAGAGCGTGGGG - Intergenic
901930864 1:12595576-12595598 GCGACTGGGTGGAGCGGGTGAGG + Intronic
902148942 1:14426726-14426748 GGCACTGGATGGAGCGGGAGGGG - Intergenic
902769364 1:18636762-18636784 GGGACGGGAGGGAGGGAGAGAGG + Intronic
907390795 1:54157015-54157037 GCCAGGGTATGGAGCTCGAGAGG - Intronic
907461692 1:54609137-54609159 GGGACAGGATGGAGTGGGAGTGG - Intronic
913047972 1:115089601-115089623 GCGACGGGTGGGGGCGCCAGCGG + Intergenic
916747105 1:167693139-167693161 GAGAAGGGATGGAGTGTGAGGGG - Intronic
918238791 1:182604111-182604133 GCGCGGGGATGGGGCGCTAGAGG - Intronic
918511372 1:185317261-185317283 GCGAGGGGGTGCGGCGCGAGCGG - Exonic
921383963 1:214551448-214551470 GGGAGGGGAAGGAGCGCCAGTGG + Intronic
1092843166 12:12562245-12562267 GCGACGGGACGGGACGCGAGCGG - Exonic
1097262076 12:57725823-57725845 GAGAAGGGATGGAGCAGGAGCGG - Intronic
1138247346 16:55477750-55477772 GTGAGGGGATGGAGCTGGAGGGG - Intronic
1140504816 16:75464586-75464608 GCGACGGGATGGAGCGCGAGGGG - Exonic
1141608522 16:85169075-85169097 GCGGGGGGAGGGAGCGCGCGGGG + Intergenic
1148079599 17:44960380-44960402 GACACGGGAGGGAGGGCGAGAGG + Intronic
1152464426 17:80457870-80457892 GCGTGGGGATGGAGAGAGAGTGG - Intergenic
1152624458 17:81381909-81381931 GGGACAGGATGGAGCGGGAGCGG - Intergenic
1152924196 17:83080022-83080044 GGGACGGGAGGGGACGCGAGGGG - Intronic
1159798404 18:72868908-72868930 GGGAAGGGCTGGAGCGCGCGGGG + Intergenic
1161479136 19:4501949-4501971 GCGACCGGCAGGAGCGCGAGAGG + Exonic
1162012100 19:7823515-7823537 GGGAGGGGATGGAGGGGGAGGGG + Intergenic
1163708980 19:18834006-18834028 GCGAAGGGAGGGAGGGAGAGAGG + Intronic
1166688807 19:44810870-44810892 GAGAAGGGATGGAGGGCGAAAGG + Intronic
1167375377 19:49108199-49108221 GCCACCGGAGCGAGCGCGAGCGG + Exonic
925487183 2:4348451-4348473 GAGACTGGATGGAGGGGGAGTGG - Intergenic
927508410 2:23629187-23629209 GGGACGTGGAGGAGCGCGAGGGG - Intronic
932036725 2:68252870-68252892 CCGGCGGGAGGAAGCGCGAGGGG + Intronic
932042969 2:68319459-68319481 CCGAGTGGCTGGAGCGCGAGGGG + Exonic
932123321 2:69121027-69121049 GTGATGGGATGGAGTGGGAGAGG - Intronic
942313999 2:174682258-174682280 GAGGCGGGCTGGAGCGCGGGAGG + Intronic
946212758 2:218160852-218160874 GCCAGGGGATGGAGGGCAAGGGG + Intergenic
1171223235 20:23420563-23420585 GCGCCGGGGTGGAGCCGGAGGGG - Intronic
1173165959 20:40687703-40687725 GCGACGGGCGGGTGCGCGGGCGG - Exonic
1175336049 20:58197079-58197101 GTGACGGGGTGGAGTGGGAGAGG - Intergenic
1176164341 20:63664902-63664924 GCGAGGGGAAGGGGCACGAGGGG - Intronic
1176556980 21:8257982-8258004 GCGACGGGAGAGAGAGCGCGCGG - Intergenic
1176575922 21:8441019-8441041 GCGACGGGAGAGAGAGCGCGCGG - Intergenic
1178764788 21:35440084-35440106 CCCAAGGGATGGAGCGGGAGAGG - Intronic
1183577385 22:38700710-38700732 GCGAAGGGCTGGCCCGCGAGGGG + Intronic
1183650860 22:39152589-39152611 GCGGCGTGAGGGAGCGCGAGGGG - Exonic
1184481841 22:44752640-44752662 GCGGCGGGAGGGAGCGCGCAGGG + Intronic
1203253972 22_KI270733v1_random:130077-130099 GCGACGGGAGAGAGAGCGCGCGG - Intergenic
1203262028 22_KI270733v1_random:175156-175178 GCGACGGGAGAGAGAGCGCGCGG - Intergenic
955132873 3:56188223-56188245 GCAACTGGATGGAGAGCCAGAGG - Intronic
961406032 3:126680093-126680115 GAGATGGGATGGAGTGAGAGAGG + Intergenic
963868109 3:150384904-150384926 GGGAGGGGCTGGAGCGGGAGAGG - Intergenic
968599388 4:1501918-1501940 GCGAGGGGATGGAGAGCTCGTGG + Intergenic
972653972 4:41048650-41048672 GAGACGGGAGGGAGAGGGAGGGG - Intronic
975870741 4:78776294-78776316 GGGACGGGGCGGGGCGCGAGGGG - Intergenic
979696366 4:123617725-123617747 GGGACGGGATGGGGCGGGGGCGG + Intergenic
982117483 4:152109538-152109560 GAGTCGGGAGGGAGTGCGAGGGG + Intergenic
985478393 5:92298-92320 GCGGCGGGTGGGGGCGCGAGCGG + Intergenic
992067369 5:73120415-73120437 GCGAGGGAATGGAGAGCCAGGGG - Exonic
993519458 5:88883235-88883257 GCGAGGGGAGCGCGCGCGAGGGG + Intronic
999300225 5:150486195-150486217 GCACCGGGAGGGAGCGGGAGGGG + Intronic
1001019307 5:168169540-168169562 GCTACGGGATGGGGAGGGAGCGG - Intronic
1001945226 5:175772813-175772835 GCGTCGGCTTGGAGCGGGAGGGG - Intergenic
1001959406 5:175871340-175871362 GAGACGGGAGGGAGGGAGAGAGG + Intronic
1005120481 6:22384145-22384167 GTTGCGGGATGGAGCGTGAGGGG - Intergenic
1006860762 6:37170358-37170380 GCGGCGGGAGGGCGCGCCAGCGG - Exonic
1007451298 6:41941704-41941726 GCGACGGGCCGGAGAGCGCGGGG + Exonic
1015910086 6:138161552-138161574 ACGACGGGATGCAGCGGGCGCGG + Intergenic
1019407155 7:889746-889768 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407178 7:889826-889848 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407189 7:889866-889888 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407211 7:889946-889968 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407222 7:889986-890008 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407233 7:890026-890048 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407244 7:890066-890088 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407254 7:890105-890127 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407264 7:890144-890166 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407274 7:890183-890205 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407285 7:890223-890245 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1019407307 7:890303-890325 GGGAGTGGAGGGAGCGCGAGCGG + Intronic
1020082245 7:5292516-5292538 GAGACGGGGTGGAGGGAGAGGGG - Intronic
1023986928 7:45102219-45102241 GGGAGAGGATGGAGAGCGAGGGG + Intronic
1026523358 7:71134465-71134487 GGGATGGGATGGAGGGAGAGGGG + Intronic
1026966265 7:74442023-74442045 GGGACAGGATGGAGCCCGACGGG - Intergenic
1027232359 7:76280396-76280418 GCGAGGGGATGGAGGGGGTGGGG - Intronic
1033476918 7:141701376-141701398 GGGACGGGGTGGGGGGCGAGCGG + Intronic
1033476933 7:141701406-141701428 GGGACGGGGTGGGGGGCGAGCGG + Intronic
1033476947 7:141701436-141701458 GGGACGGGATGGGGGGCGAGCGG + Intronic
1035054643 7:156026396-156026418 GCGCCGGGATGGTGCCTGAGAGG - Intergenic
1035153219 7:156892654-156892676 TCGAACGGAGGGAGCGCGAGGGG + Intronic
1036206034 8:6806312-6806334 GCGGGGGGATGGAGGGTGAGAGG + Intergenic
1036209233 8:6828569-6828591 GAGGCGGGATGGAGAGCGTGGGG + Intronic
1039921736 8:41897707-41897729 CCCACGGGATGGAGAGGGAGTGG - Intergenic
1045327339 8:101126847-101126869 GCGACGGGACGGAGGGGCAGGGG - Intergenic
1050405408 9:5304059-5304081 GCGACGGGGTGGAAAGGGAGGGG - Intronic
1050408710 9:5339225-5339247 GCGACGGGGTGGAAAGGGAGGGG - Intronic
1061931737 9:133836354-133836376 GCGAGGGGCTGGTGCGGGAGCGG - Intronic
1203470373 Un_GL000220v1:113221-113243 GCGACGGGAGAGAGAGCGCGCGG - Intergenic
1203478194 Un_GL000220v1:157193-157215 GCGACGGGAGAGAGAGCGCGCGG - Intergenic
1187443902 X:19344111-19344133 GGGCCGGGATGGGGCGCGAGTGG + Intronic
1197774544 X:130110753-130110775 GGGGCGGGGTGGAGCGCGCGGGG + Intergenic