ID: 1140504817

View in Genome Browser
Species Human (GRCh38)
Location 16:75464587-75464609
Sequence GGCGACGGGATGGAGCGCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504817_1140504827 24 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504817_1140504826 18 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504817_1140504824 -1 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504817_1140504828 28 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504817_1140504823 -2 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504817 Original CRISPR GGCGACGGGATGGAGCGCGA GGG (reversed) Exonic
901109843 1:6785657-6785679 GGCGCCGGGCGGGAGCGCGGGGG + Intronic
902475766 1:16686131-16686153 GGCGACACGAGGGAGCGCGCGGG + Intergenic
903826830 1:26151924-26151946 GGAGAAGGGATGGAGAGGGATGG - Intergenic
915911450 1:159918182-159918204 GGTGAGGGGATGGAGAGGGAGGG - Exonic
919712142 1:200739142-200739164 GGCGACGGGAGGGAGCACAGAGG + Intergenic
924090188 1:240493378-240493400 GGCGAGGGGATGGCGCCCGCCGG + Exonic
1064583526 10:16817229-16817251 GGGGAGGGGATGGAGTGGGAAGG + Exonic
1067937587 10:50624510-50624532 GGCGACGCCTGGGAGCGCGACGG + Intronic
1072108061 10:92292023-92292045 GGGGACGGGATGGGGCGGGGGGG - Intronic
1073546683 10:104354885-104354907 GGGGAGGGGGTGGAGCACGATGG - Intronic
1074531864 10:114303837-114303859 GGTGACAGGCTGGAGCGGGAGGG - Intronic
1074819745 10:117168912-117168934 GCAGACGGGATGGAGAGAGATGG + Intergenic
1077192268 11:1260422-1260444 GGCGACGGGCTGGAGCTGGAGGG - Intronic
1077281870 11:1749537-1749559 GGCGCTGGGGTGGAGCGCCATGG - Intronic
1078887895 11:15523649-15523671 GGCGATGGGATGCAGTGAGAGGG - Intergenic
1083560588 11:63670824-63670846 GGGGCCTGGATGGAGCGGGAAGG - Intronic
1092727615 12:11500412-11500434 GGCGGCGGTGGGGAGCGCGAGGG - Intronic
1097114648 12:56688410-56688432 GGCGCCAGGAAGGATCGCGAAGG - Intergenic
1100830814 12:98515533-98515555 GGCGACGGGAGGAAGCGCGGCGG - Intronic
1101788996 12:107911372-107911394 GGTGACTGGATGGAGCTCTAAGG + Intergenic
1102028285 12:109725899-109725921 GGCGCCCGGATGGTGCGCGCCGG + Intronic
1103888839 12:124223184-124223206 GGGGAAGGGATGGAGAGGGAGGG + Intronic
1114473703 14:22980640-22980662 GGAGACAGGATGGAGCGCCCTGG - Intronic
1114866191 14:26597937-26597959 GGAGCCGGGAAGGAGCGCGGCGG + Intergenic
1122641691 14:103163778-103163800 GGCAAGGGGATGGAGCTGGAAGG - Intergenic
1124425107 15:29556908-29556930 GGCCATGGGATGGAGCGCTCTGG - Intronic
1128067772 15:64775334-64775356 GGCGGCGGGAAGGAACGCGAGGG + Exonic
1131405724 15:92162891-92162913 GGCGAAGGATTTGAGCGCGATGG - Exonic
1131646245 15:94348392-94348414 GGAGAGGGGATGGAGAGGGAAGG - Intronic
1133218847 16:4309707-4309729 GGGGACGGGATGGGGCGCCTGGG - Intergenic
1138247347 16:55477751-55477773 GGTGAGGGGATGGAGCTGGAGGG - Intronic
1140504817 16:75464587-75464609 GGCGACGGGATGGAGCGCGAGGG - Exonic
1140512335 16:75517231-75517253 GGCGACCGGATGGAGCTCTAGGG - Intergenic
1141608521 16:85169074-85169096 GGCGGGGGGAGGGAGCGCGCGGG + Intergenic
1143541988 17:7574276-7574298 CCCGATGGGATGGAGCCCGAAGG + Exonic
1152178328 17:78802187-78802209 GGCGAGGGGTTGGACCGCGTGGG - Intronic
1153265135 18:3262290-3262312 CGCGACGGGAGGGGGCGCGGGGG - Intronic
1158602925 18:58870484-58870506 TGCGAGGGGATGGAGCTGGAAGG + Intronic
1160448646 18:78947024-78947046 GACGAGGGGAGGGAGGGCGAGGG + Intergenic
1160775450 19:853163-853185 GGCGACGGGCCTGAGGGCGAAGG - Intronic
1161204997 19:3036334-3036356 GGCGACGGGCGGGAGAGCGCGGG - Intronic
1161499693 19:4607087-4607109 GGCCACAGGAGGGAGCGCGTAGG + Intergenic
1162012099 19:7823514-7823536 GGGGAGGGGATGGAGGGGGAGGG + Intergenic
1162123319 19:8485698-8485720 GGCCACGGCATGGATCGCGTGGG + Exonic
1162559168 19:11406129-11406151 GGGGAGGGGCTGGAGCCCGAGGG - Intronic
1163665986 19:18604278-18604300 GGCGACGGGTTGTAGGGGGAAGG + Intronic
1163816118 19:19465565-19465587 GGCGAAGGGCTGGTGGGCGATGG + Exonic
1166876812 19:45902506-45902528 GGGGACGGCAGGGAGAGCGAAGG + Intronic
925735225 2:6958022-6958044 GGAGTCGGGATGGAGCTCCAGGG + Intronic
932042967 2:68319458-68319480 GCCGAGTGGCTGGAGCGCGAGGG + Exonic
934105526 2:88691690-88691712 GGCGTCGGGATGCAGCGCCCCGG + Exonic
938719932 2:134057960-134057982 GGTGAGGGGATGGGGAGCGAAGG - Intergenic
939104187 2:137929959-137929981 GGAGACGGGATGGAGTGAGGAGG + Intergenic
939285319 2:140121831-140121853 GGGAAGGGGATGGAGCGGGAAGG - Intergenic
946212757 2:218160851-218160873 GGCCAGGGGATGGAGGGCAAGGG + Intergenic
946458401 2:219848409-219848431 GGTGAGGGGATGGAGCAGGATGG + Intergenic
1170613761 20:17933554-17933576 GGGGAGGGGATGGAGAGCAAAGG + Intergenic
1172883826 20:38218341-38218363 AGCGACTGGATGGAGCAGGAAGG - Exonic
1175553897 20:59834237-59834259 GGAGATGGGATGGAGGGGGAAGG - Intronic
1180231022 21:46426800-46426822 GGAGATGGGAGGGAGCGTGATGG - Intronic
1181571142 22:23768276-23768298 GGCGACGGGATGGGGCCAGCTGG + Exonic
1183577384 22:38700709-38700731 GGCGAAGGGCTGGCCCGCGAGGG + Intronic
1183650861 22:39152590-39152612 GGCGGCGTGAGGGAGCGCGAGGG - Exonic
1184205344 22:42998942-42998964 GGAGATGGGATGGAGTGGGAAGG - Intronic
1184481840 22:44752639-44752661 GGCGGCGGGAGGGAGCGCGCAGG + Intronic
1185313540 22:50169623-50169645 GGGGACGGGATGGGGCGTGGGGG + Intergenic
950617362 3:14171838-14171860 GGGGACGGGACGGGGCGGGACGG + Intronic
956414666 3:69013521-69013543 GGCGGCGGGAAGGAGAGCGGGGG + Intronic
957895955 3:86421423-86421445 GGAAAGGGGATGGAGCGGGAAGG + Intergenic
962807518 3:138938018-138938040 GGTGAGGGGAGGGAGCGAGAAGG + Intergenic
968137767 3:196231404-196231426 GGAGACAGGATGGAGAGAGAAGG - Intronic
970565376 4:17327125-17327147 GGCGTGGAGATGGAGCACGATGG - Intergenic
971505203 4:27358958-27358980 GGGGAGGGGATGGACCGCCAAGG + Intergenic
972653973 4:41048651-41048673 GGAGACGGGAGGGAGAGGGAGGG - Intronic
975870742 4:78776295-78776317 GGGGACGGGGCGGGGCGCGAGGG - Intergenic
982117482 4:152109537-152109559 GGAGTCGGGAGGGAGTGCGAGGG + Intergenic
983537870 4:168877817-168877839 GGCGGCGGGAAGGGGGGCGAGGG - Intronic
999300224 5:150486194-150486216 GGCACCGGGAGGGAGCGGGAGGG + Intronic
1001065121 5:168529709-168529731 GGCGACGGCAAGGATCGCGGCGG + Exonic
1006403418 6:33830820-33830842 GGCGATGGGATGGAGTGGGACGG + Intergenic
1007451297 6:41941703-41941725 GGCGACGGGCCGGAGAGCGCGGG + Exonic
1015315048 6:131808027-131808049 GGGGCCACGATGGAGCGCGACGG + Exonic
1017021438 6:150143201-150143223 GGCGACGGGCAGCAGCGAGACGG + Exonic
1019109925 6:169701822-169701844 GGCGCAGGGCTGGAGCGCGGGGG - Intronic
1019309178 7:351971-351993 GGGGACGGGCTGGAGGGCGGAGG - Intergenic
1022032935 7:26508555-26508577 GCAGACAGGATGGAGGGCGAGGG + Intergenic
1026966266 7:74442024-74442046 TGGGACAGGATGGAGCCCGACGG - Intergenic
1027232360 7:76280397-76280419 GGCGAGGGGATGGAGGGGGTGGG - Intronic
1029361150 7:100089332-100089354 GACAAGGGGATGGAGAGCGACGG - Exonic
1029896398 7:103989343-103989365 GGCGGCGGCATGGAGCGCAGTGG - Exonic
1031258069 7:119482066-119482088 GGAGAGGGGATGGAGCAGGAAGG - Intergenic
1035370343 7:158375858-158375880 GGAGAGGGGATGGAGTGGGAAGG - Intronic
1036851382 8:12203874-12203896 GGCGCCGAGAGTGAGCGCGAGGG + Intergenic
1036872746 8:12446148-12446170 GGCGCCGAGAGTGAGCGCGAGGG + Intergenic
1037239457 8:16760560-16760582 GTCGATGGGATGGGGCGCCATGG + Intergenic
1037867440 8:22457097-22457119 GGGGAAGGGATGGAGGGGGAAGG - Intronic
1038760986 8:30384349-30384371 GGCGGCCGGATGGCGCGCGCCGG - Intergenic
1041988409 8:63954661-63954683 GGGAAGGGGATGGAGCGAGAAGG + Intergenic
1045432087 8:102123896-102123918 GCCGGCGGGATGGGGCGCGCTGG - Intronic
1056905389 9:90642949-90642971 TGCGAGCGGGTGGAGCGCGAGGG - Exonic
1060842486 9:126804898-126804920 GGCGTCGGGAGAGAGCGCGGAGG - Intergenic
1062435769 9:136546015-136546037 GGCCGCGGGAGGGAGCGCAAGGG - Intergenic
1187535925 X:20141716-20141738 GGCGACACGAGGGAGCGCGCGGG + Exonic
1187915428 X:24149406-24149428 GGCGGCGGGCGGGAGCGCGGAGG + Intronic
1194294789 X:92114400-92114422 CCCGATGGGATGGAGCCCGAAGG - Intronic
1197774543 X:130110752-130110774 GGGGGCGGGGTGGAGCGCGCGGG + Intergenic