ID: 1140504818

View in Genome Browser
Species Human (GRCh38)
Location 16:75464588-75464610
Sequence TGGCGACGGGATGGAGCGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504818_1140504827 23 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504818_1140504828 27 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504818_1140504823 -3 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504818_1140504826 17 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504818_1140504824 -2 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504818 Original CRISPR TGGCGACGGGATGGAGCGCG AGG (reversed) Exonic
901109842 1:6785656-6785678 CGGCGCCGGGCGGGAGCGCGGGG + Intronic
902475765 1:16686130-16686152 GGGCGACACGAGGGAGCGCGCGG + Intergenic
903750184 1:25616699-25616721 CGGCGGCGGGAGGGGGCGCGGGG + Intergenic
905867200 1:41382698-41382720 TGGGGACGGGACGGGGCGCCCGG - Exonic
907118673 1:51990450-51990472 GGGCGCCGAGAAGGAGCGCGGGG - Intronic
915503628 1:156338184-156338206 TGGCGACGCGATGCAGAGCCGGG + Exonic
921355610 1:214281585-214281607 TGGCGTGGGGCTGCAGCGCGGGG - Intronic
923306566 1:232694054-232694076 TGGCCACAGGATGGGGAGCGGGG - Intergenic
1067741869 10:48901673-48901695 TGGGGGCAGGATGGAGCGAGGGG + Intronic
1069595126 10:69665335-69665357 TGGCGGCGGGATGGAGAGATGGG - Intergenic
1072108062 10:92292024-92292046 TGGGGACGGGATGGGGCGGGGGG - Intronic
1076906121 10:133362070-133362092 TAGAGACGGGCTGGAGTGCGTGG - Intergenic
1077090731 11:777220-777242 CGGTGTCGGGATGGAGCTCGGGG - Intronic
1077192269 11:1260423-1260445 TGGCGACGGGCTGGAGCTGGAGG - Intronic
1083814011 11:65121910-65121932 TCGCGACGGGATGGTGGTCGCGG + Intronic
1086064932 11:82733901-82733923 GGGCGGAGGGAGGGAGCGCGCGG + Intergenic
1086438008 11:86800575-86800597 GGGCGCCGGGAGAGAGCGCGCGG - Exonic
1103043311 12:117714050-117714072 TGGGGGCGGGATGGAGTGAGGGG + Intronic
1113768397 13:112894466-112894488 GGGTGACGGGAGGGGGCGCGGGG + Intronic
1128067771 15:64775333-64775355 GGGCGGCGGGAAGGAACGCGAGG + Exonic
1129388098 15:75206898-75206920 TGGCGACAGGCTGGAGGGCAAGG - Exonic
1131418675 15:92284466-92284488 TGGGGATGGGATGGAGGCCGGGG + Intergenic
1132631136 16:918018-918040 TGGCGTCGGGACGTGGCGCGGGG + Intronic
1133206664 16:4238224-4238246 TGGCTGTGGGATGGAGCGCCTGG - Intronic
1133218848 16:4309708-4309730 CGGGGACGGGATGGGGCGCCTGG - Intergenic
1140504818 16:75464588-75464610 TGGCGACGGGATGGAGCGCGAGG - Exonic
1140512336 16:75517232-75517254 TGGCGACCGGATGGAGCTCTAGG - Intergenic
1141608520 16:85169073-85169095 GGGCGGGGGGAGGGAGCGCGCGG + Intergenic
1141694080 16:85611822-85611844 TTGCGACGGGAGCGAGCGCTGGG - Intronic
1142274898 16:89113267-89113289 TGGGGACTGGGAGGAGCGCGCGG - Intronic
1144631874 17:16877711-16877733 TGGAGACAGGATGGAGCCCAGGG - Intergenic
1147579140 17:41618708-41618730 TGGGGACGGGGTGGAGTGGGGGG - Intergenic
1148431876 17:47649715-47649737 GGGCAGCGGAATGGAGCGCGCGG - Intronic
1151450724 17:74196828-74196850 TAGTGCCGGGATGGAGGGCGTGG - Intergenic
1151906700 17:77053760-77053782 TGGCCGCGGGACTGAGCGCGGGG + Intergenic
1152178329 17:78802188-78802210 GGGCGAGGGGTTGGACCGCGTGG - Intronic
1152318269 17:79593501-79593523 TGGCCACGGGAGGGTGGGCGTGG + Intergenic
1152360864 17:79832485-79832507 TGGGGACGGGGAGGAGGGCGGGG - Intergenic
1152917844 17:83051322-83051344 GGGCGCGGGGAAGGAGCGCGGGG + Intronic
1153265136 18:3262291-3262313 GCGCGACGGGAGGGGGCGCGGGG - Intronic
1160151906 18:76401759-76401781 TGGTGGAGAGATGGAGCGCGGGG - Intronic
1160151926 18:76401822-76401844 TGGTGGAGAGATGGAGCGCGGGG - Intronic
1160251234 18:77204984-77205006 TGGCAGCGGGAGGGAGCACGGGG - Intergenic
1161061112 19:2215453-2215475 TGTCGACGGGATGGGGCTCTGGG - Intronic
1161204998 19:3036335-3036357 AGGCGACGGGCGGGAGAGCGCGG - Intronic
1161611915 19:5247923-5247945 TGGAGACAGGATGGAGGGAGTGG + Intronic
1162123318 19:8485697-8485719 GGGCCACGGCATGGATCGCGTGG + Exonic
1162141716 19:8589407-8589429 TGGAGAGGGGATGGGGAGCGGGG - Intronic
1162145535 19:8610736-8610758 TGGCCAGGGGAGGGGGCGCGGGG + Intergenic
1162559169 19:11406130-11406152 TGGGGAGGGGCTGGAGCCCGAGG - Intronic
1163587784 19:18173390-18173412 TGGGGATGGGATGGAGGCCGGGG - Intronic
926135127 2:10331049-10331071 AGGCCACGAGATGGAGCGAGAGG - Intronic
936278867 2:111121428-111121450 TTGGGACGGGATGCTGCGCGCGG + Intronic
942438041 2:176002295-176002317 TGGCGAGCGGCTGGAGCGCGGGG - Exonic
1174017694 20:47502050-47502072 GGGCGAGGGGGTGGAGTGCGAGG + Intronic
1178314602 21:31558222-31558244 CGGGGACGGGATAGGGCGCGGGG + Intronic
1183650862 22:39152591-39152613 CGGCGGCGTGAGGGAGCGCGAGG - Exonic
1185313539 22:50169622-50169644 AGGGGACGGGATGGGGCGTGGGG + Intergenic
949533818 3:4980115-4980137 TGGCGAGGGGATGCAGGGTGTGG + Intronic
955223523 3:57042582-57042604 TGGGGACAGGTTGGAGAGCGGGG - Intronic
956414665 3:69013520-69013542 CGGCGGCGGGAAGGAGAGCGGGG + Intronic
977694372 4:99950061-99950083 TGGCGACGGTTGGGAACGCGCGG - Intronic
980969755 4:139557021-139557043 TGGCGACCCGAAGGAGGGCGGGG - Intronic
982117481 4:152109536-152109558 TGGAGTCGGGAGGGAGTGCGAGG + Intergenic
996706286 5:126501895-126501917 TGGAAAGGGGATGGAGCGGGAGG + Intergenic
1004090366 6:12494519-12494541 TGGCGAGAGGAAGGAGGGCGGGG - Intergenic
1007451296 6:41941702-41941724 AGGCGACGGGCCGGAGAGCGCGG + Exonic
1012422494 6:99080121-99080143 TGGCAACAGGATGGAGAGGGAGG - Intergenic
1019109926 6:169701823-169701845 GGGCGCAGGGCTGGAGCGCGGGG - Intronic
1026890131 7:73977018-73977040 GGCCGAGGGGAGGGAGCGCGGGG + Intergenic
1027232361 7:76280398-76280420 GGGCGAGGGGATGGAGGGGGTGG - Intronic
1028385116 7:90245396-90245418 TGGCGGCGGGGTGGAGAGTGGGG - Exonic
1042916341 8:73878936-73878958 TGGGAAGGGGATGGAGCGAGGGG + Intergenic
1045674189 8:104589427-104589449 TGCCCAGGGGCTGGAGCGCGGGG + Intergenic
1048009278 8:130443345-130443367 GGGCGCCGGGACGGGGCGCGGGG - Intronic
1060941155 9:127543625-127543647 TGGGGATGGGAAGGAGAGCGGGG - Intronic
1062731575 9:138113078-138113100 TGGAGACGTGAGGGAGCACGGGG + Intronic
1062731597 9:138113165-138113187 TGGGAACGTGAGGGAGCGCGGGG + Intronic
1062731654 9:138113449-138113471 GGGAGACGTGAGGGAGCGCGAGG + Intronic
1185750870 X:2609074-2609096 TGGCGACGGGCTTGTGGGCGGGG + Intergenic
1187535924 X:20141715-20141737 GGGCGACACGAGGGAGCGCGCGG + Exonic
1189086760 X:38033264-38033286 TGGCGACGTGATGCAGCTGGCGG + Intronic
1189491451 X:41474239-41474261 TGGCAACGCGCTGGACCGCGTGG + Exonic
1190844878 X:54182694-54182716 CGGCGACGGCCTGGAGCTCGTGG - Exonic
1197774542 X:130110751-130110773 GGGGGGCGGGGTGGAGCGCGCGG + Intergenic
1197952064 X:131908262-131908284 TGGCAGCGGGATGCAGCTCGTGG + Intergenic
1200116710 X:153772731-153772753 TGGCCTCGGGAAGGAGGGCGTGG + Intronic
1200226558 X:154420805-154420827 GGGTGACGGGATGGAGAGGGTGG - Intronic