ID: 1140504819

View in Genome Browser
Species Human (GRCh38)
Location 16:75464597-75464619
Sequence TGTGGTGAATGGCGACGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504819_1140504828 18 Left 1140504819 16:75464597-75464619 CCATCCCGTCGCCATTCACCACA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504819_1140504826 8 Left 1140504819 16:75464597-75464619 CCATCCCGTCGCCATTCACCACA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504819_1140504827 14 Left 1140504819 16:75464597-75464619 CCATCCCGTCGCCATTCACCACA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504819 Original CRISPR TGTGGTGAATGGCGACGGGA TGG (reversed) Exonic
900731836 1:4267215-4267237 TGTGGCTAATGGCAAAGGGAAGG - Intergenic
900917149 1:5646918-5646940 TGTGGTGAATGTGGCCAGGAAGG + Intergenic
901323313 1:8352117-8352139 TGGGGTGAATGGCAAGGGGTGGG + Intergenic
902078051 1:13803078-13803100 TGTGCTGAATGGAGTGGGGAAGG + Intronic
902686492 1:18080817-18080839 TGTGGTGATTGGGGATGGGGAGG + Intergenic
905769869 1:40630605-40630627 TGTGGGGAAGGGAGAAGGGAAGG + Intronic
913349650 1:117843073-117843095 TGTGGTGAATGACCACAGGGAGG + Intergenic
919578201 1:199337537-199337559 TGTGGTGAATGGCCACAGGGAGG + Intergenic
920069664 1:203293342-203293364 TGAGGTGAATGGAGACAGGAAGG - Intergenic
920581754 1:207115634-207115656 TGTGGTGTATGGAGATAGGATGG - Intronic
920737311 1:208544648-208544670 TGTGGTGAAGGGCGGCTGGGAGG + Intergenic
922350786 1:224733279-224733301 TGTGGTGACTGGTGACTGGCAGG + Intronic
923006374 1:230053390-230053412 AGTGGTGGATGGGGAAGGGAGGG - Intergenic
924055298 1:240118837-240118859 TTTAGTGAATGACGAAGGGAGGG + Intronic
1063510029 10:6635612-6635634 TTTGGTGAATGGCAATAGGAAGG - Intergenic
1065799436 10:29337900-29337922 TGGGGTGAAGGGCGGAGGGAGGG + Intergenic
1066757315 10:38723664-38723686 TGTGGTGATTGGCTCCGGCATGG + Intergenic
1069801822 10:71086453-71086475 TGTGCTGAATGGGGACACGAAGG - Intergenic
1074943185 10:118254706-118254728 AGTGGTGAATGGGGACTTGAGGG - Intergenic
1077475426 11:2788074-2788096 TGTGGTGAATGTGGATGGCAGGG + Intronic
1079080661 11:17411517-17411539 TGTGGTGTAGGGAGAGGGGAGGG + Intronic
1081711171 11:45216449-45216471 TGTTGTGAATGGGGACAGAAGGG + Intronic
1084588155 11:70075208-70075230 TGTGGGCAATGCCAACGGGATGG + Intergenic
1085826454 11:79852955-79852977 TGTGGTTGATGGCTGCGGGAAGG - Intergenic
1086228520 11:84541041-84541063 TGTGGTGGAGGGAGAGGGGAGGG + Intronic
1089732161 11:120525795-120525817 TGTGGTGGGGGGTGACGGGAGGG + Intronic
1091311760 11:134579906-134579928 TGTGGGGAAGGGTGGCGGGAGGG - Intergenic
1093405577 12:18800492-18800514 TGTGGTGACTGGCGATGGGGAGG - Intergenic
1096923880 12:55120322-55120344 GGGGGTGAAGGGCTACGGGAGGG + Intergenic
1100066723 12:90655806-90655828 TGTGGTGACTGGTGAGGAGAAGG + Intergenic
1100710150 12:97247263-97247285 AGTGGTGAATGGTGAGGGCAGGG - Intergenic
1101124035 12:101612622-101612644 TGTGGAGAAAGGAGACTGGAGGG + Intronic
1101573228 12:105974357-105974379 AGTGGAGGATGGCGATGGGAAGG - Intergenic
1109368918 13:61396340-61396362 TGTTTTGAATGGAGATGGGAGGG - Intergenic
1110200489 13:72844480-72844502 TGGGGTGAAGGGCTAGGGGACGG - Intronic
1111262986 13:85767208-85767230 TCTGGGGAATGGGGAAGGGACGG + Intergenic
1117908738 14:60616214-60616236 AGTGGTGGATGGTGACAGGATGG - Intergenic
1121732532 14:96196565-96196587 TGTGGTGGAAGGCAACTGGAAGG + Intergenic
1123667267 15:22617504-22617526 TGGGGTGATTGGCGAGGGCAAGG + Intergenic
1124321108 15:28712071-28712093 TGGGGTGATTGGCGAGGGCAAGG + Intronic
1124481390 15:30083284-30083306 TGGGGTGATTGGCGAGGGCAAGG - Intronic
1124487845 15:30135380-30135402 TGGGGTGATTGGCGAGGGCAAGG - Intronic
1124522204 15:30413910-30413932 TGGGGTGATTGGCGAGGGCAAGG + Intronic
1124536461 15:30552308-30552330 TGGGGTGATTGGCGAGGGCAAGG - Intronic
1124542934 15:30604357-30604379 TGGGGTGATTGGCGAGGGCAAGG - Intronic
1124755684 15:32402941-32402963 TGGGGTGATTGGCGAGGGCAAGG + Intronic
1124762190 15:32455284-32455306 TGGGGTGATTGGCGAGGGCAAGG + Intronic
1124776439 15:32593784-32593806 TGGGGTGATTGGCGAGGGCAAGG - Intronic
1133599154 16:7322339-7322361 TGTGGTGAATGCTGACTGGCAGG + Intronic
1136416723 16:30108637-30108659 TCTGGTGAATGGTGACTGGAGGG - Intronic
1137357589 16:47781343-47781365 TTTGGTGAATGGGGGCAGGAAGG + Intergenic
1138447102 16:57071203-57071225 GGTGGTTAATGGGGAAGGGAGGG + Intronic
1138739666 16:59293568-59293590 TGGGGTGAGGGGCAACGGGAAGG - Intergenic
1140234293 16:73144587-73144609 TGGGGAGAAAGGAGACGGGAAGG + Intergenic
1140504819 16:75464597-75464619 TGTGGTGAATGGCGACGGGATGG - Exonic
1140512337 16:75517241-75517263 AGTGGTGAATGGCGACCGGATGG - Intergenic
1144082923 17:11781106-11781128 TGAGGTGGATGCCTACGGGACGG + Exonic
1145009588 17:19360231-19360253 TGTTCTGAATGGGGAGGGGAAGG + Intronic
1149695865 17:58615616-58615638 TGTGGGGAATGGGTAGGGGAGGG + Intronic
1151051853 17:70987106-70987128 AGTGGAGAATGGCAAGGGGAAGG - Intergenic
1153094369 18:1383694-1383716 TGTGGTGAATGCCCACAGGGAGG + Intergenic
1154019260 18:10648168-10648190 TGTGGTGAATGCCCACAGGGGGG + Intergenic
1154161152 18:11981580-11981602 TGTGGAGCCTGGCGGCGGGACGG + Exonic
1158365391 18:56728628-56728650 TATGGTGAGTGGGGATGGGATGG - Intronic
1159191791 18:65054950-65054972 TGGGGTGAATGGAGCGGGGAGGG - Intergenic
1160568021 18:79798754-79798776 TGTGGTCACTGGGGACGAGAAGG + Intergenic
1161256277 19:3311593-3311615 TGTGGGGAGGGGCGAGGGGAAGG - Intergenic
1162993604 19:14319401-14319423 TGTGGTGAATGGGGGCAGGAAGG + Intergenic
1165171491 19:33895023-33895045 TGTGGTGGATGCAGACGGGCAGG - Intergenic
1165901899 19:39173155-39173177 AGTGGTGACAGGCGACGGGCGGG + Exonic
1166137038 19:40783897-40783919 TGTGGAGAAGGGAGAAGGGAGGG - Intronic
1166254810 19:41595991-41596013 TGTGGGAAATGGCCAAGGGAAGG - Intronic
925550670 2:5070643-5070665 TGTGGTAAAGGGCAACTGGAAGG + Intergenic
926245731 2:11121489-11121511 TATGGTGAAAGGGGACAGGAAGG - Intergenic
928804968 2:35140108-35140130 TGTGGTGAATGCCCACAGGGAGG - Intergenic
928896219 2:36266663-36266685 TGTGGTGAAAGGCAACTGGGAGG + Intergenic
929138950 2:38650601-38650623 TGTGGTGAATGTCCCCTGGACGG - Intergenic
929151254 2:38751054-38751076 GGTGCTGAAGGGAGACGGGATGG - Intronic
929713372 2:44287206-44287228 GGTGGTGAATGCCAAGGGGAAGG + Intronic
931978206 2:67666458-67666480 TGTGGGGAGTGGTGAGGGGAGGG - Intergenic
943386470 2:187208595-187208617 TGTGGTGAATGGCCACATGGAGG + Intergenic
946325058 2:218980828-218980850 TGGGGTGAAGGGCAACCGGAAGG + Intergenic
1169049499 20:2564085-2564107 TGTGGTGAGTGGCGACAGTGTGG + Intronic
1169404993 20:5315511-5315533 TGTGCTGAGAGGCGAGGGGAAGG - Intergenic
1172588708 20:36102789-36102811 TATGGTGAGTGGGGACGGAAAGG - Intronic
1172787004 20:37475092-37475114 TGGGTTGAATGGCAGCGGGAAGG - Intergenic
1176414020 21:6464561-6464583 TGAGGTGAGTGGGGAAGGGAGGG + Intergenic
1179689518 21:43072883-43072905 TGAGGTGAGTGGGGAAGGGAGGG + Intronic
1180990054 22:19930312-19930334 TGTGGTGAATGGGGAGGGAAGGG - Intronic
1182500155 22:30740938-30740960 TGTGGGGAATGGCAGAGGGACGG - Intronic
950560905 3:13723608-13723630 TGTGGTGAAAGGCAACTGGGAGG - Intergenic
957279199 3:78128019-78128041 TGGAGGGAATGGCGAAGGGAAGG - Intergenic
958459062 3:94371165-94371187 TGTGGTGAATGCTCACAGGAAGG - Intergenic
960564947 3:119123135-119123157 TGTGGTGAATGGTGCCAGGCTGG - Intronic
962149360 3:132876544-132876566 TGTGGACAATGGCTACAGGAAGG + Intergenic
966224092 3:177579620-177579642 TGTGGGAAATGGTGAAGGGATGG + Intergenic
966320747 3:178699044-178699066 TGTGGTGGATGCCCACAGGATGG - Intronic
966714202 3:182999942-182999964 TGTGGTGAATGCCTGCGGGGAGG - Intergenic
968891071 4:3368770-3368792 TGGGGTGGATGCTGACGGGAAGG + Intronic
971055524 4:22908865-22908887 TGTGGTGATTGGGAACAGGAGGG + Intergenic
975259946 4:72286734-72286756 TGTGGTGGATGGGGATGGGTGGG + Intronic
980080407 4:128338126-128338148 TGTGGTGTATGGGAACTGGAAGG + Intergenic
982017942 4:151174466-151174488 TGTGGGGAATGGAGACAGGGAGG - Intronic
988186075 5:27863813-27863835 GGTGGTGAATGGCGAAAGGTGGG + Intergenic
995691454 5:114830279-114830301 TGTGGTGAATGCCCACAGGAAGG + Intergenic
995864680 5:116678558-116678580 TGGGGTGAAGGGCAAGGGGAAGG - Intergenic
998388633 5:141772899-141772921 TGTGGTGAAAGGCCACTGGGTGG + Intergenic
998718325 5:144911546-144911568 TGTGGTGGACGGCAAGGGGAGGG + Intergenic
1002011639 5:176287480-176287502 TGGGGTGGGTGGCTACGGGAGGG + Intronic
1006971459 6:38049906-38049928 AGTGGTGAATGAAGACGGGGTGG - Intronic
1007391227 6:41550587-41550609 TGTGGTGAAGGGAGAAAGGAAGG + Intronic
1011558489 6:88592268-88592290 GCTGGTGAATGGGGACTGGAAGG + Intergenic
1012252743 6:96997010-96997032 TGTGATGGATGGCGATGGGGAGG + Intronic
1012324841 6:97904250-97904272 TGTGGTGGAGGGCGGGGGGAGGG - Intergenic
1017284810 6:152662212-152662234 TGTAGTGGATGGAGAAGGGAGGG - Intergenic
1021351096 7:19595421-19595443 TGTGGTGAATGCCCTCAGGAAGG - Intergenic
1021610411 7:22452425-22452447 TTTGGTGTATGGCGCGGGGAGGG - Intronic
1022224068 7:28345488-28345510 TGGGGTGAATGGTGCTGGGAGGG + Intronic
1023985581 7:45092705-45092727 TATGGTGAAAGGCAACTGGAAGG + Intergenic
1026643675 7:72149596-72149618 TGTGGGGAACGGTGAGGGGAGGG - Intronic
1026963713 7:74425990-74426012 TGTGGTCAATGGAGACAGGAAGG + Intergenic
1027497836 7:78910135-78910157 TGGGGTGGGTGGCGAGGGGAGGG + Intronic
1027627425 7:80563631-80563653 TGTGGTGAATGCCCACAGGGAGG - Intronic
1030104968 7:105979393-105979415 TGTGGTGAAAGGAGAGGGTATGG - Intronic
1037740049 8:21601592-21601614 TCTTGTGAAAGGAGACGGGAGGG + Intergenic
1039292409 8:36110804-36110826 TGAGTTGAATGGGGATGGGATGG + Intergenic
1039936401 8:42050942-42050964 GGTGGGGAATGGGGACGGGAAGG - Intronic
1042074725 8:64979766-64979788 TGTGGTGGAGGGTGAGGGGAGGG - Intergenic
1042992070 8:74652648-74652670 TGGGGTGGGTGGAGACGGGAAGG + Intronic
1043235622 8:77862118-77862140 TGTGGTGAATGCCCACAGGGAGG - Intergenic
1046775443 8:118159070-118159092 TGTGGTGAGTGGAGTGGGGATGG - Intergenic
1051116178 9:13697390-13697412 TGTGGTGAATGCCCATAGGAAGG - Intergenic
1059938678 9:119336772-119336794 TGTGGGGAATGGGGACCAGAAGG + Intronic
1060192451 9:121601568-121601590 TGTGTTGAATGCTGAAGGGACGG - Intronic
1060899549 9:127245331-127245353 CGTGGTGATTGGCGGCCGGAGGG + Intronic
1062060785 9:134494147-134494169 GGTGGTGAATGGCACCGGGGTGG + Intergenic
1062060802 9:134494201-134494223 GGTGGTGGATGGCGCTGGGATGG + Intergenic
1062060838 9:134494327-134494349 TATGGTGAATGGCGCTGGGGTGG + Intergenic
1062060843 9:134494345-134494367 GGTGGTGGATGGCGCTGGGATGG + Intergenic
1203758445 Un_GL000218v1:158175-158197 TGGGGTGAAGGGCTAGGGGAGGG + Intergenic
1186448741 X:9654565-9654587 TGTGGTGAATGTGGAAAGGACGG + Intronic
1189574331 X:42335437-42335459 TGGGGTGAAGGGAGAGGGGAGGG - Intergenic
1190486315 X:50928540-50928562 TGTGGTGAATGGAGAAAGGCAGG - Intergenic
1194549228 X:95274807-95274829 TGTGGTGAATGTTCACAGGAAGG + Intergenic
1202366339 Y:24168452-24168474 TGTGGTGACTGGCAAGGGCAAGG - Intergenic
1202374164 Y:24218192-24218214 TGTGGTGATTGGCAAGGGCAAGG + Intergenic
1202496617 Y:25451928-25451950 TGTGGTGATTGGCAAGGGCAAGG - Intergenic
1202504442 Y:25501671-25501693 TGTGGTGACTGGCAAGGGCAAGG + Intergenic