ID: 1140504820

View in Genome Browser
Species Human (GRCh38)
Location 16:75464601-75464623
Sequence TCTCTGTGGTGAATGGCGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504820_1140504828 14 Left 1140504820 16:75464601-75464623 CCCGTCGCCATTCACCACAGAGA 0: 1
1: 0
2: 4
3: 13
4: 113
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504820_1140504827 10 Left 1140504820 16:75464601-75464623 CCCGTCGCCATTCACCACAGAGA 0: 1
1: 0
2: 4
3: 13
4: 113
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504820_1140504826 4 Left 1140504820 16:75464601-75464623 CCCGTCGCCATTCACCACAGAGA 0: 1
1: 0
2: 4
3: 13
4: 113
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504820 Original CRISPR TCTCTGTGGTGAATGGCGAC GGG (reversed) Exonic
900080949 1:856954-856976 TCTCTGTGGAGAATGGTGACTGG - Intergenic
901116876 1:6852920-6852942 ACTCTCGGGAGAATGGCGACTGG - Intronic
903226533 1:21896954-21896976 TATCTGGGCTGAATGGGGACAGG + Intronic
903298801 1:22363362-22363384 TCTCTTCTGTGAATGGTGACTGG + Intergenic
905033450 1:34902659-34902681 TCTCTGTAGAGAATGGGGAAGGG - Intronic
905693861 1:39960990-39961012 TTTTTGTGGTGAATGGGGTCTGG + Intronic
909132576 1:71756662-71756684 TGTCTGTGAGGAATGGAGACAGG - Intronic
913349648 1:117843069-117843091 TCACTGTGGTGAATGACCACAGG + Intergenic
917338257 1:173947746-173947768 CCTCTGAGGTGAGGGGCGACAGG + Intronic
919578199 1:199337533-199337555 CCACTGTGGTGAATGGCCACAGG + Intergenic
920737309 1:208544644-208544666 TGGCTGTGGTGAAGGGCGGCTGG + Intergenic
920771818 1:208893520-208893542 TCTCTCTTGTAAATGTCGACAGG - Intergenic
920952801 1:210588041-210588063 TCACTGTGGAGAATGGAGTCCGG + Exonic
922350785 1:224733275-224733297 TCAATGTGGTGACTGGTGACTGG + Intronic
1062826820 10:576025-576047 TCACTGTGCTGGATGGCAACAGG - Intronic
1068308788 10:55251676-55251698 TCTCTGTGATGAATGTCCACAGG + Intronic
1073420367 10:103419459-103419481 TCTCTGTGGAGAAAGGAGATGGG + Intronic
1078047437 11:7928741-7928763 TTTCTGGGGTGAATGCAGACTGG - Intergenic
1082012442 11:47459296-47459318 TCTCAGGGCTGAATGGCCACAGG + Intergenic
1083253189 11:61481530-61481552 TCCCAGTGGTAAATGGGGACAGG + Intronic
1084177979 11:67433336-67433358 TCTCTGCGGTGAAGGGCGGCTGG - Exonic
1084237636 11:67798244-67798266 TCTCTTTGCTGAGTGGCGATTGG - Intergenic
1085183970 11:74559765-74559787 TCTCAGAGGTGAATGGAGAGGGG - Intronic
1089102634 11:115976432-115976454 TCTTTGTGGTGGATGGGGAAGGG + Intergenic
1089344390 11:117781480-117781502 GCTCTGAGATGAATGGCTACAGG + Intronic
1091217056 11:133908531-133908553 TCTCTGTGGTCAGTGGAGGCAGG - Intergenic
1096548178 12:52355723-52355745 TGTATGTGATGAATGGAGACAGG + Intergenic
1096749557 12:53750146-53750168 TTGCTGTGGTGAATGTCAACGGG - Intergenic
1096802516 12:54120546-54120568 GCCCTGTGGTGACTGGCGAGAGG + Intergenic
1098393208 12:69991395-69991417 TCCCTGTGGTGAAAGGAGAATGG + Intergenic
1098915268 12:76250819-76250841 TCTCTATGGTGTATGGCTCCAGG - Intergenic
1101044443 12:100790142-100790164 TCTCTGTGGGGAATAGCAACAGG + Intronic
1102254665 12:111408613-111408635 TGTCTGTGGTGAGGGGAGACCGG + Intronic
1107115593 13:36742451-36742473 TATCTGTGGGGATTGGGGACAGG + Intergenic
1110961976 13:81638111-81638133 TCACCGTGGTAAATGGCCACAGG + Intergenic
1113037236 13:106063584-106063606 TATCTGTGCTGAATTACGACTGG - Intergenic
1114418738 14:22561927-22561949 TGTTTGTGGTGAATGGCTTCCGG + Intergenic
1115530243 14:34320435-34320457 TATCTGTGATGAATTGGGACAGG - Intronic
1115774804 14:36703428-36703450 TGTCTGTGGTGAATGACCACAGG + Intronic
1119037832 14:71245683-71245705 TTGCTCTGGTTAATGGCGACTGG + Intergenic
1119900012 14:78251575-78251597 TGTCTGTGATGAATGGTCACTGG - Intronic
1128127424 15:65203389-65203411 TCTCTGTGCTGTAAGGCCACAGG - Exonic
1130028067 15:80286732-80286754 TCTCTGTGGGGAATGGCTTCTGG - Intergenic
1135548523 16:23381121-23381143 TCTCTGGGGTGGATGGAGACTGG - Exonic
1140504820 16:75464601-75464623 TCTCTGTGGTGAATGGCGACGGG - Exonic
1140512338 16:75517245-75517267 ACTCAGTGGTGAATGGCGACCGG - Intergenic
1141464870 16:84198729-84198751 TCACTGTGGGGAAAGGAGACAGG - Intergenic
1141787799 16:86213321-86213343 TCTGTGTGGTGTATGGGGAGGGG - Intergenic
1145391447 17:22459106-22459128 TCTCTGGGGTGAATGCCCAGGGG - Intergenic
1147179491 17:38675064-38675086 TCTGTGTGCGGAATGGGGACGGG - Exonic
1148442074 17:47716594-47716616 TTTCTGTGGTGGCTGGGGACAGG + Intergenic
1154019256 18:10648164-10648186 CCACTGTGGTGAATGCCCACAGG + Intergenic
1154325320 18:13387037-13387059 GGTCTGTGGTGCATGGCCACTGG - Intronic
1156534657 18:37850812-37850834 TCTCAATGGTGAATGGAGCCAGG + Intergenic
1163626002 19:18390102-18390124 TCTCTGAGAGGAATGGCGATGGG + Intergenic
1166000650 19:39875622-39875644 GCTCTGGGGTGCACGGCGACGGG + Exonic
1166003448 19:39891877-39891899 GCTCTGGGGTGCACGGCGACGGG + Exonic
927257095 2:21049043-21049065 TCTCTGGGGAGAAGGGAGACAGG + Intergenic
927705078 2:25291686-25291708 TCTCTGGGGAGAAGGGAGACAGG - Intronic
928804970 2:35140112-35140134 TCTCTGTGGTGAATGCCCACAGG - Intergenic
931517396 2:63058083-63058105 TCTCTGTCCTGGATGGCGAGGGG - Intergenic
936530992 2:113277184-113277206 TCTCTGAGGGGAATGGGGGCCGG + Intronic
937447246 2:121969202-121969224 TCTCTGTGATTAATAGAGACAGG + Intergenic
937797658 2:126042922-126042944 TCTCTGTGATCAATGACTACGGG + Intergenic
938754224 2:134365039-134365061 TCTCTGAGGTGAATCGGGATTGG - Intronic
946368484 2:219265906-219265928 TCTCTCTGGAGAATGGGGAGAGG - Intronic
1170885688 20:20338088-20338110 TCTGTGTATTGAATGGAGACAGG + Intronic
1171794229 20:29554040-29554062 GCCCTGTGGTGACTGGCGAGAGG - Intergenic
1171854243 20:30330351-30330373 ACCCTGTGGTGACTGGCGAGAGG + Intergenic
1174775101 20:53336046-53336068 TCTGTGGGGTGAAAAGCGACAGG + Intronic
1175487177 20:59354806-59354828 TCTCTGGGGTGACTGTCCACTGG - Intergenic
1182500156 22:30740942-30740964 TCTCTGTGGGGAATGGCAGAGGG - Intronic
1183281406 22:36934662-36934684 TCACTGTGGTGAAAGGTGAGGGG - Intronic
1184549928 22:45199103-45199125 TCTCTGTGGGAAATGGCTCCTGG - Intronic
1185201185 22:49506451-49506473 TCTCTGTGATGAATGCCGCCAGG + Intronic
950168828 3:10822270-10822292 CCTCTGAGGTGAATGGATACAGG + Intronic
950455498 3:13090567-13090589 TCTGTGGGGTGATTGGTGACAGG + Intergenic
951315100 3:21180025-21180047 CCTCTGTGGTGAAGGGAGTCTGG - Intergenic
951394904 3:22153315-22153337 GCTCTGTGGACAATGGCCACTGG - Intronic
953663347 3:44907030-44907052 TCTCAGAAGTGAATGGTGACAGG + Exonic
953970456 3:47343376-47343398 GCTCTTTGGTGTATGGGGACAGG - Intronic
956363709 3:68476326-68476348 TCACTGTGTTGAATGGCTGCAGG - Intronic
966092752 3:176159793-176159815 TGTCTTTTGTGAATGGCTACTGG - Intergenic
968893076 4:3382421-3382443 TATCTGTGCTGAGTGCCGACTGG + Intronic
968954820 4:3712879-3712901 TCTCAGTGGAGAATGCTGACTGG + Intergenic
971970160 4:33609116-33609138 TGACTGTGGTGAATGCCTACAGG + Intergenic
974268737 4:59621637-59621659 GCTCTGTGGTGTATGGCCCCAGG + Intergenic
975526933 4:75361209-75361231 TATCTGTGGTACTTGGCGACTGG + Intergenic
977405511 4:96592889-96592911 TCTCTGTGGTGAGTGGTGAGAGG + Intergenic
978476174 4:109133676-109133698 TCTGTGTGCAGAATGGTGACTGG + Intronic
981454022 4:144933119-144933141 CCTCTGTGATGAATGTCCACAGG - Intergenic
982017944 4:151174470-151174492 GCTATGTGGGGAATGGAGACAGG - Intronic
983656164 4:170087034-170087056 TCTCTGTGGTTAAGTGCGAGAGG + Intronic
985214110 4:187631109-187631131 TCTCTTTGATGAATGGTGATGGG + Intergenic
988263603 5:28923573-28923595 TCTCTGTGGAGAAAGTCCACAGG + Intergenic
989084469 5:37661077-37661099 TATCTGTGGGGATTGGCTACAGG - Intronic
993902953 5:93596658-93596680 TCTCTGTGGGTAATGCAGACAGG - Intergenic
995691453 5:114830275-114830297 TTACTGTGGTGAATGCCCACAGG + Intergenic
1002716623 5:181232071-181232093 TCACTGTGTTTAATGGCGTCGGG + Intronic
1004584647 6:16987804-16987826 GCTCTGTGGGGAGTGGCCACAGG + Intergenic
1008023818 6:46610976-46610998 TATCTGTGGTGAATACAGACTGG + Intronic
1011912758 6:92463462-92463484 TATCTGTGGTGAAAGACCACTGG + Intergenic
1012807211 6:103909212-103909234 TCTCTGTGCTGCATGGCCACTGG + Intergenic
1015945868 6:138500304-138500326 TCTCTGTGGTTAATTGCCAATGG - Intronic
1015950366 6:138546962-138546984 TCTCTGTGGGGAAGGACCACGGG - Intronic
1018548877 6:164969854-164969876 TTTCTGTGGTGAATAGTAACTGG - Intergenic
1024241244 7:47438341-47438363 TCTCTTTGGGGAAGGGGGACTGG + Intronic
1027627427 7:80563635-80563657 CCACTGTGGTGAATGCCCACAGG - Intronic
1027975625 7:85150864-85150886 CCTCTGTGGTGAATGGTGAATGG + Intronic
1028775244 7:94668890-94668912 TGTCTGTGGTGGATGACAACTGG - Exonic
1034786844 7:153934189-153934211 TCCCTGTGGGGCCTGGCGACAGG + Intronic
1035524320 8:300508-300530 TCTCTGTGGAGAATGGTGACTGG + Intergenic
1036074420 8:5479008-5479030 TCTCTCTGGTGCATTGTGACAGG + Intergenic
1036836682 8:12076386-12076408 TCTCTGTGAAGAATGGAAACAGG - Intergenic
1036858525 8:12322954-12322976 TCTCTGTGAAGAATGGAAACAGG - Intergenic
1042992069 8:74652644-74652666 TCTCTGGGGTGGGTGGAGACGGG + Intronic
1043003172 8:74784385-74784407 TCTTTGTGTTGATTGGCCACAGG + Intronic
1043396591 8:79843184-79843206 AATCTGAGGTGACTGGCGACTGG + Intergenic
1049293338 8:141815916-141815938 TCTCCCTGGTGCATGGTGACAGG - Intergenic
1050450205 9:5772609-5772631 GCTCCATGGTGGATGGCGACTGG + Exonic
1060752980 9:126186267-126186289 GCTCTGTTCTGAATGGGGACTGG - Intergenic
1203361702 Un_KI270442v1:222246-222268 TCGCTGTGGTGAATGGAGGAGGG + Intergenic
1186585034 X:10864347-10864369 TGTCTGTGGTAAATAGCAACTGG + Intergenic
1189714862 X:43854734-43854756 GCTCTGTGTTGAATGGAGAAAGG - Intronic
1190042575 X:47083043-47083065 TTGCTGTGGTGAATGGTCACAGG - Intronic
1190873058 X:54440691-54440713 TCGCTGTGGAGAATGGCTTCGGG + Exonic
1191933771 X:66404525-66404547 TCACTGTTGTGAAAGGCCACAGG - Intergenic
1195165324 X:102214391-102214413 TCACTGTGGTGACTGGCCAGTGG + Intergenic
1195193534 X:102472700-102472722 TCACTGTGGTGACTGGCCAGTGG - Intergenic
1199375959 X:147109610-147109632 CCACTGTGGTGAATGCCCACAGG + Intergenic
1200045660 X:153400195-153400217 TCTTCGTGGGGAATGGCGACAGG - Intergenic