ID: 1140504821

View in Genome Browser
Species Human (GRCh38)
Location 16:75464602-75464624
Sequence TTCTCTGTGGTGAATGGCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504821_1140504828 13 Left 1140504821 16:75464602-75464624 CCGTCGCCATTCACCACAGAGAA 0: 1
1: 0
2: 0
3: 3
4: 130
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504821_1140504827 9 Left 1140504821 16:75464602-75464624 CCGTCGCCATTCACCACAGAGAA 0: 1
1: 0
2: 0
3: 3
4: 130
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504821_1140504826 3 Left 1140504821 16:75464602-75464624 CCGTCGCCATTCACCACAGAGAA 0: 1
1: 0
2: 0
3: 3
4: 130
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504821 Original CRISPR TTCTCTGTGGTGAATGGCGA CGG (reversed) Exonic
900808460 1:4783317-4783339 TCCCCTGGGGTGAATGGTGATGG - Exonic
901416599 1:9120835-9120857 TTTTCTGAGGTGACTGGTGAAGG - Intronic
904818161 1:33220937-33220959 TGCTCTGTGGGGAATGTGGAAGG + Intergenic
905033451 1:34902660-34902682 CTCTCTGTAGAGAATGGGGAAGG - Intronic
909628028 1:77740726-77740748 TTCTCTGTGAAGGATGGGGAAGG - Intronic
916684475 1:167132266-167132288 TTCTCTGTGCTGAATAACGTGGG - Intergenic
916753654 1:167746602-167746624 TGCTCTGTTGTGAATGGAGTTGG + Intronic
918751798 1:188281452-188281474 TTCTGTGTTGTGAATGGAAAAGG - Intergenic
922671805 1:227514257-227514279 TGCTCTGTGGAGAATAGCAATGG + Intergenic
924468194 1:244316538-244316560 TGCTCTCTGGTGACTGGAGATGG + Intergenic
1066473677 10:35724122-35724144 TGCCCTGTGGTAACTGGCGAGGG - Intergenic
1068263453 10:54615877-54615899 TTCCCAGTGGAAAATGGCGATGG + Intronic
1068566222 10:58578738-58578760 TTCTCTCTGATGAGGGGCGAGGG - Intronic
1070992163 10:80741932-80741954 GTCTCTGTGGTAAAAGGAGAAGG + Intergenic
1073420366 10:103419458-103419480 TTCTCTGTGGAGAAAGGAGATGG + Intronic
1074428296 10:113371320-113371342 ATCTCTGTGGTGGATTGCAATGG - Intergenic
1074971552 10:118543571-118543593 TTCTGTGTGCAGAATGGGGAAGG + Intergenic
1076201633 10:128563608-128563630 TGCACTGTGGTGAATGGGGTGGG - Intergenic
1078316529 11:10297957-10297979 CTCTCTTTGGTGAAAGGTGATGG - Intergenic
1080987512 11:37486963-37486985 ATCTTTGTGGTGGATGGTGATGG + Intergenic
1081690972 11:45078274-45078296 TTTTCTGAGGTGAGTGGGGAGGG + Intergenic
1084597386 11:70125033-70125055 TTCTCTGTGGTGCCTTGGGAAGG - Intronic
1084614052 11:70223327-70223349 TTGTATGTGGTGAAAGGCAAGGG - Intergenic
1085183971 11:74559766-74559788 GTCTCAGAGGTGAATGGAGAGGG - Intronic
1086062736 11:82717207-82717229 TACTCTGTGTTGGATGGCGTTGG - Intergenic
1086355681 11:85996991-85997013 TTATCTGTGGTGGGTGGAGAAGG - Intronic
1089059214 11:115612472-115612494 TTCCCTGCGGTGAATGGAAAAGG + Intergenic
1089102633 11:115976431-115976453 CTCTTTGTGGTGGATGGGGAAGG + Intergenic
1092755491 12:11759296-11759318 TTCGCTGTGGGGGATGGGGAGGG + Intronic
1096521585 12:52187554-52187576 TTGTCTGCTGTGAATGTCGAAGG - Intronic
1096749558 12:53750147-53750169 TTTGCTGTGGTGAATGTCAACGG - Intergenic
1096992524 12:55816970-55816992 TTCTCTCTGGTGGTTGGAGATGG + Intronic
1099766400 12:86991978-86992000 TTCACTGCGGTGTATGGAGATGG - Intergenic
1104387126 12:128360652-128360674 TTGACCGTGGTGAATGGTGAAGG + Intronic
1105806431 13:23954033-23954055 TTCACTGTGGTTTGTGGCGACGG - Intergenic
1109834660 13:67841221-67841243 TTCTCAGTGGTGAAGGCCGCTGG + Intergenic
1112683671 13:101796976-101796998 TTCTCTGTGGTGCAGGGCTTGGG + Intronic
1118164598 14:63323992-63324014 TTCTCTGGGGTAAATGACCAAGG - Intergenic
1121745613 14:96288193-96288215 TTCTCTGTGGTACTTGGGGAAGG + Intronic
1125314093 15:38412586-38412608 GGGTCTGTGGTGAATGGTGAGGG - Intergenic
1125966793 15:43881209-43881231 CTCTCTGTGGAGGATGGGGATGG + Intronic
1127825202 15:62696839-62696861 TCCTCTGTGGTCAATGGTGGTGG + Intronic
1128349759 15:66881025-66881047 GTCTCTGTGGAGACTGGCGAAGG + Intergenic
1128360763 15:66960007-66960029 CCCTCTGTGGTGAATGGGCAGGG - Intergenic
1129127694 15:73458630-73458652 TTCTCTGCTGTGCATGGCCATGG + Intronic
1130900029 15:88200146-88200168 TTCTTTGTGGTGAATGCAGGGGG - Intronic
1135550892 16:23397478-23397500 TTCCCAGGGGTGAATGGGGAGGG + Intronic
1136033918 16:27524157-27524179 GTGTCTGTGGTGAAAGGGGAAGG + Intronic
1137730259 16:50684284-50684306 TTCTCTGTGGTGGAGGCAGAAGG + Intergenic
1137791898 16:51181965-51181987 TTCTCTGTGGTGGTTAGTGATGG + Intergenic
1140504821 16:75464602-75464624 TTCTCTGTGGTGAATGGCGACGG - Exonic
1141787800 16:86213322-86213344 GTCTGTGTGGTGTATGGGGAGGG - Intergenic
1145391448 17:22459107-22459129 GTCTCTGGGGTGAATGCCCAGGG - Intergenic
1147143687 17:38473498-38473520 TCCTCTGTGGAGAATGACTAAGG + Intronic
1147971613 17:44221308-44221330 TTCTCTGCGGGGACTGGCGGCGG - Exonic
1150002343 17:61449407-61449429 AACTCTTTGGTGAATGGTGAAGG - Intergenic
1156383393 18:36583996-36584018 TTCTGTGTTTTGAATGGAGATGG + Intronic
1157715401 18:49882210-49882232 TATTCTGTGGGGAATGGTGACGG - Intronic
1158604427 18:58882734-58882756 TTCTCTTTGGAGACTGGGGATGG - Intronic
1163626001 19:18390101-18390123 ATCTCTGAGAGGAATGGCGATGG + Intergenic
1164836531 19:31358461-31358483 TTCTCCTTGGTGAATGGGCAGGG - Intergenic
1166000649 19:39875621-39875643 TGCTCTGGGGTGCACGGCGACGG + Exonic
1166003447 19:39891876-39891898 TGCTCTGGGGTGCACGGCGACGG + Exonic
1167277795 19:48549440-48549462 ATCTCTGTGGAGAATGAGGAGGG - Intergenic
1167978649 19:53254468-53254490 TTCTCCCTGGAGAAGGGCGAAGG + Intronic
925333810 2:3078427-3078449 TTCTCACTTGTGAATGGAGAAGG + Intergenic
927873562 2:26639765-26639787 TTCCGTGTGGTGACTGGGGAGGG + Intronic
928453856 2:31401770-31401792 TTCTCTGTGGGGAAAGGGGGAGG + Intronic
928774241 2:34739233-34739255 TTCTCTGTGATGAATGTTGGTGG + Intergenic
929718756 2:44343701-44343723 TCCTCTGTGTTGAAAGGCAACGG - Intronic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929830870 2:45345374-45345396 TTCTCTGTAGGAAATGGGGATGG - Intergenic
929878073 2:45813573-45813595 TTCTCTTTTGTGAAAGACGAGGG - Intronic
930709286 2:54534906-54534928 TTCTCTGAGGTGACTGAGGAAGG - Intronic
931517397 2:63058084-63058106 GTCTCTGTCCTGGATGGCGAGGG - Intergenic
937536512 2:122895554-122895576 TTACCTGTGGTGAATTGGGATGG + Intergenic
937797657 2:126042921-126042943 TTCTCTGTGATCAATGACTACGG + Intergenic
937833711 2:126449998-126450020 TTCTCAGTGGTGGCTGGTGATGG + Intergenic
943283592 2:185968565-185968587 TTCTCTGTCATGAATGCCCAAGG - Intergenic
943575300 2:189624899-189624921 TTCTCTGAGGTGAGTGAAGAAGG - Intergenic
945606276 2:211936345-211936367 TTCTCTGTGGTGAAAATCAAAGG - Intronic
1169763637 20:9124747-9124769 TTCTCCCTGGGGAATGGCCAAGG - Intronic
1173658722 20:44718566-44718588 TTCTCTGATGTGGGTGGCGAGGG + Intronic
1179605393 21:42512911-42512933 TTCCCTCTGGAGAATGGAGAAGG - Intronic
1180639689 22:17288417-17288439 TTCTCTGGGGAGGTTGGCGACGG - Intergenic
1182500157 22:30740943-30740965 CTCTCTGTGGGGAATGGCAGAGG - Intronic
1182541649 22:31046317-31046339 TTCTGGGTGGTGAATGGAGGTGG + Intergenic
1183281407 22:36934663-36934685 GTCACTGTGGTGAAAGGTGAGGG - Intronic
949516857 3:4815210-4815232 TTATCTGTGGTGAGTGTCGCTGG + Exonic
950166676 3:10806127-10806149 TCCTCTTTGGAGAATGGCAAGGG - Intergenic
950650691 3:14404807-14404829 GTCACTGTGGTGTATGGCAAGGG + Intronic
956321831 3:68006614-68006636 TTCTCTTTAGAGAATGGCAATGG + Exonic
961373385 3:126446368-126446390 TCATCTGCGGTGAATGGAGATGG + Intronic
970461854 4:16282696-16282718 TTCTCTGTGGTCTATAGCGAGGG - Intergenic
971830653 4:31688254-31688276 TTCTCTGTGGTAAATGTTTAAGG - Intergenic
974009624 4:56594921-56594943 TCCTCTGTGGGGAATGCAGAAGG - Intronic
978612182 4:110554769-110554791 TTTTCTGTGGTGTATGGTGCAGG + Intronic
978947004 4:114511841-114511863 TTCTTGGAGGTGAATGGCTAAGG - Intergenic
979177809 4:117686300-117686322 TTTTCTCTGGTGAAAGGCTAGGG - Intergenic
981164572 4:141542206-141542228 TTCTCTGTGGTCAAGGGGCAGGG + Intergenic
982311386 4:153988780-153988802 TTCTCTGGGGTGACTGGGCATGG + Intergenic
982313655 4:154010224-154010246 TTCTCTGTGGAGAAGGGCAGGGG + Intergenic
983199901 4:164850147-164850169 TTCTCTGGGGTGAATGACAGTGG + Intergenic
985214109 4:187631108-187631130 GTCTCTTTGATGAATGGTGATGG + Intergenic
985516484 5:347929-347951 TCCTCTGTGGTGATGGGGGATGG + Intronic
987143274 5:14966653-14966675 TTTTCTGTGGTGTATGGCTGGGG + Intergenic
994100736 5:95889869-95889891 TTTTCTGTGGGGATTGGTGAGGG + Intronic
994591829 5:101783562-101783584 TTCTCTGTGAGGAAGGGGGAAGG - Intergenic
995617600 5:113983801-113983823 TTCTCTGGGGTAAATGCCCAAGG + Intergenic
999394927 5:151221297-151221319 TTCTTTGTGGAGAATGGAGGTGG - Intronic
1000759481 5:165204515-165204537 TTCACTGTGATGAATGCAGAAGG - Intergenic
1001851076 5:174966189-174966211 TTCTCTGTGGTGATTGTGAATGG + Intergenic
1002855934 6:1038303-1038325 TTCTCAGTGGTCAATGGTCATGG + Intergenic
1004336308 6:14767680-14767702 TTCTCTGTGGTGAAAGAGGCAGG - Intergenic
1005370038 6:25122951-25122973 TTCCTTGTAGTGAATGGCAAAGG + Intergenic
1011182861 6:84641239-84641261 CTCCCAGTGGTGAATGGCGCAGG - Intergenic
1011189957 6:84718119-84718141 TTCTCTGTGGTCAATAGAGGTGG - Intronic
1012642499 6:101636917-101636939 TTCTATGTGGTGAAGTGGGAAGG + Intronic
1015711883 6:136150930-136150952 TTGTCTTTGGTGAAGGGAGAAGG + Intronic
1020436589 7:8169360-8169382 TTCTCTTTGGTAAATGTCTAAGG + Intronic
1020855230 7:13412692-13412714 TTCTCTTTGCTGAATGACTATGG + Intergenic
1022108213 7:27211866-27211888 TTCTCTTTTGTGAATGGCTGGGG - Intergenic
1030473100 7:109992696-109992718 TTCTATATGGTGAAAGGTGAAGG + Intergenic
1036105990 8:5840153-5840175 TTCTTTGTTGTGAATGCCCATGG + Intergenic
1040893440 8:52340666-52340688 TTCTGTGGGGTGAGTGGCAAGGG - Intronic
1042992068 8:74652643-74652665 TTCTCTGGGGTGGGTGGAGACGG + Intronic
1043134755 8:76507278-76507300 TCATCTGTGGTGAATTGGGATGG - Intergenic
1047238063 8:123060000-123060022 TTCTATGTGGAGAATGGCAGAGG - Intronic
1059077744 9:111212260-111212282 ATCTCAGTGGTGTATGGAGAAGG - Intergenic
1059526613 9:114997072-114997094 TTCTCTGGGATGAATGCCTAAGG + Intergenic
1203361701 Un_KI270442v1:222245-222267 ATCGCTGTGGTGAATGGAGGAGG + Intergenic
1186323661 X:8455925-8455947 TTCTCAGTGGTGAAGTGAGAAGG + Intergenic
1193572351 X:83160255-83160277 TTCTCTGAGGTAAGTGCCGAGGG + Intergenic
1193670635 X:84381316-84381338 TTCTCTGTGGAGAATGTCCCTGG - Intronic